**Synergistic Potential of *Rumex roseus* Extracts in Oxidative Stress and Inflammation Management**

This study investigates the synergistic potential of methanolic extracts from different parts of *Rumex roseus*—roots (RRR), stems (RRS), and leaves (RRL)—in mitigating oxidative stress and inflammation, two interconnected pathological processes underlying chronic diseases such as cardiovascular disorders, neurodegeneration, and inflammatory bowel disease. While individual extracts have been analyzed for their bioactivity, this work focuses on the collective and complementary effects of these plant-derived fractions, highlighting their capacity to act in concert to enhance therapeutic outcomes.

Phytochemical profiling revealed distinct metabolic fingerprints across the three organs. RRL was rich in apigenin and luteolin glycosides, compounds known for their ability to modulate redox-sensitive signaling pathways and inhibit pro-inflammatory mediators. RRS contained a balanced mix of phenolic acids and flavonoids, including p-coumaric acid and ferulic acid, which contribute to radical scavenging and membrane stabilization. RRR, however, stood out due to its high concentration of condensed tannins and quinic acid derivatives such as diCQA and CFQA—molecules with documented anti-oxidative, anti-inflammatory, and protein-protective properties. The presence of multiple compound classes within each extract suggests that the biological effects are not solely attributable to single constituents but arise from complex interactions among various phytochemicals.

In vitro antioxidant assays confirmed that while RRR exhibited the strongest activity in TAC-Pm, TEAC, FRAP, and SOD-like assays, RRL showed exceptional performance in ORAC and HOCl-induced albumin protection. This divergence underscores the importance of assay-specific mechanisms: RRR’s superior reducing power may stem from its tannin content, whereas RRL’s effectiveness in preventing protein oxidation likely results from luteolin and caffeic acid, which readily interact with reactive oxygen species and stabilize macromolecules. Notably, when combined, the extracts demonstrated additive or even synergistic effects in certain assays, indicating that mixing components from different plant parts could amplify overall bioactivity beyond what is observed individually.

The anti-inflammatory evaluation using TNF-α-stimulated Caco-2 cells further supported this synergy. Pretreatment with RRR and RRS significantly suppressed TNF-α-induced upregulation of IL-6 and IL-8 mRNA expression in a dose-dependent manner, confirming their ability to interfere with NF-κB activation. However, RRL failed to show significant activity under the same conditions, possibly due to cytotoxicity at higher concentrations or the inability of certain flavonoids to penetrate cellular targets effectively. Despite this limitation, the combination of RRR and RRL may offer a more comprehensive approach: RRR provides systemic antioxidant and NF-κB inhibitory effects, while RRL contributes targeted protein protection and modulation of immune responses.SF3A3 Antibody Autophagy

Moreover, biocompatibility testing revealed that RRR and RRS were safe at all tested concentrations (up to 70 µg/mL), whereas RRL induced cytotoxicity at the highest dose.Raf-B Antibody Biological Activity This safety profile supports the use of root and stem extracts in formulations requiring prolonged exposure.PMID:35116025 The absence of toxicity in RRR, despite its high polyphenol load, suggests that its tannin structure may confer favorable bioavailability and low cellular toxicity compared to other polyphenols.

These findings suggest that the full therapeutic potential of *Rumex roseus* lies not in isolating single fractions but in harnessing the natural synergy between its organ-specific metabolites. A formulation combining RRR and RRS could deliver potent antioxidant and anti-inflammatory action, while inclusion of RRL might enhance protection against protein damage. Such an integrative strategy aligns with traditional herbal medicine practices, where whole-plant preparations are preferred over isolated compounds.

In conclusion, this study demonstrates that the methanolic extracts of *Rumex roseus* possess complementary and potentially synergistic bioactivities. Their combined use offers a promising avenue for developing effective, multi-targeted nutraceuticals and phytopharmaceuticals aimed at preventing and managing diseases driven by oxidative stress and chronic inflammation.MedChemExpress (MCE) offers a wide range of high-quality research chemicals and biochemicals (novel life-science reagents, reference compounds and natural compounds) for scientific use. We have professionally experienced and friendly staff to meet your needs. We are a competent and trustworthy partner for your research and scientific projects.Related websites: https://www.medchemexpress.com

Single-Label Hybridization and Electrostatic Control of Conjugate-RNA Interactions

Clear evidence of strong interactions at 1:1 molar ratio between the complementary RNA sequence and conjugate C2 or C1 (Figure 3), both in the presence of monovalent ions (i.e. in Tris buffer) and in their absence (i.e. in water), was provided by a noticeable response from fluorescein tag located at the 5′-terminal phosphate of the 2′-O-methyl-RNA sequences, which was also supported by UV-visible spectroscopy (see Figure S7 in the Supplementary Material). In Tris buffer, this can be attributed to the formation of the C2:FAM-RNA1 or C1:FAM-RNA1 duplexes stabilized by Watson-Crick hydrogen bonding between the oligonucleotide moiety of the POC and the complementary region of the RNA1 sequence (see Figures 3A and 3E, respectively). The oligonucleotide recognition component seemed to play the dominant role in the interactions between the C2 or C1 conjugates and the complementary target in the presence of a high level of counter cations under buffered-electrolyte conditions, which was sufficient to minimize repulsion between the negatively charged oligonucleotide strands, as demonstrated by a pictorial diagram shown in Figure 4.

Remarkably, the base-specificity and the cleavage efficacy of this class of the peptidyl-oligonucleotide conjugates strongly depend on the nature, sequence and structural features of the RNA target. Earlier, C1 and C2 conjugates were evaluated against the linear (e.g. non-structured) complementary oligoribonucleotide 5′-[P³²]-GAUUGAAAAUCCCC, which corresponded to a sequence from the anticodon arm of E.Coli tRNAPhe, (Pyshnyi et al., 1997, Mironova et al., 2004c) and had some sequence similarity with RNA1 studied in this research. In contrast to the data presented here (see Figure 2A) showing clear Pyr-A preference in cleavage of 5′-[³²P]-RNA-HIV-1, both conjugates demonstrated exclusive G-X base-specificity for the site-directed cleavage of this short, linear complementary target, mainly at G1-A2 and G5-A6 positions. C1 showed 80% cleavage activity, whereas the activity of C2 against this target was not reported. Similarly, G-X basespecificity was detected again for these C1 and C2 conjugates, when they were studied against the linear (i.e. non-structured) non-complementary 20-mer sequence 5′-[P³²]UUACACACACUGGGAAGUUU (Mironova et al., 2004c), which had full homology with RNA2 studied here. The overall cleavage efficiency of C1 and C2 against this target was found to be 80% and 63%, respectively, with the main cleavage sites seen at G12-G13, G13-G14, G14-A15 and G17-U18 positions (Mironova et al., 2004c). Neither peptide alone nor the mixture of the unconjugated peptide and oligonucleotide possessed cleavage activity, thus suggesting that only the hybrid peptide-oligonucleotide could promote catalysis.

The behavior of peptidyl-oligonucleotide conjugates (POCs) in hybridization with RNA targets is profoundly influenced by the ionic environment, particularly the concentration of monovalent counter cations such as K⁺. This study reveals a fundamental dichotomy in conjugate-RNA interactions: one mode dominates under physiological conditions, while another emerges under non-physiological, low-ionic settings.

In Tris-buffered electrolyte (50 mM Tris-HCl, 200 mM KCl, pH 7.0), the oligonucleotide recognition element governs the interaction with complementary RNA. Fluorescence quenching of FAM-labeled RNA1 upon addition of C1 or C2 conjugates—up to 28% and 30%, respectively—was observed, indicating stable duplex formation via Watson-Crick base pairing. This is further corroborated by UV-visible spectroscopy, where hypochromic effects and slight blue shifts in absorption maxima confirm close molecular proximity and stacking interactions. These findings are consistent with the expected behavior of nucleic acid hybrids, where electrostatic repulsion between negatively charged backbones is effectively screened by physiological levels of K⁺, allowing complementary strands to associate freely. The dominance of the oligonucleotide component ensures high sequence specificity, minimizing off-target binding.

However, in de-ionized water—where counter cations are absent—the dynamics shift dramatically. Under these conditions, the same conjugates induce significantly stronger fluorescence quenching (30–38%) with both complementary (FAM-RNA1) and non-complementary (FAM-RNA2) targets. This indicates robust, non-specific binding driven primarily by the positively charged peptide moiety. Without charge screening, electrostatic repulsion between the oligonucleotide backbones cannot be overcome, leading to destabilization of the duplex. Instead, the arginine-rich peptide acts as an “electrostatic anchor,” forming transient but strong interactions with the RNA backbone through salt bridge formation with phosphate groups. This mechanism explains why both C1 and C2 bind equally well to non-complementary RNA in water—sequence independence becomes irrelevant when the driving force is purely electrostatic.

This switch in binding mode highlights a critical design principle: the functional outcome of POCs is not fixed but tunable. In physiological environments, the conjugate behaves as a precise molecular scalpel—targeting only complementary sequences. In non-physiological conditions, it transforms into a promiscuous binder, capable of interacting with any RNA regardless of sequence.IL-8 Antibody medchemexpress This phenomenon underscores the importance of maintaining proper ionic strength in experimental systems and has direct implications for therapeutic applications.Saccharocin Epigenetics For instance, in vivo delivery must preserve the cellular ionic milieu to ensure specificity and prevent off-target cleavage.PMID:35100396

Moreover, the dependence on target structure is evident from comparative studies using linear oligoribonucleotides. When tested against a non-structured, single-stranded target (5′-[³²P]-GAUUGAAAAUCCCC), C1 and C2 exhibited exclusive G-X specificity, cleaving primarily at G1-A2 and G5-A6. This contrasts sharply with their Pyr-A preference in structured HIV-1 RNA, demonstrating that the catalytic activity is not solely determined by the conjugate’s intrinsic chemistry but is modulated by the local RNA architecture. Flexible regions facilitate access to the catalytic site, while rigid helices hinder it.

These results collectively illustrate a dynamic interplay between electrostatic forces, conformational flexibility, and sequence complementarity. The oligonucleotide provides specificity and stability under physiological conditions, while the peptide enables catalytic turnover and transient binding. By leveraging this dual functionality, synthetic ribonucleases can achieve both precision and potency—key attributes for next-generation RNA-targeted therapeutics.MedChemExpress (MCE) offers a wide range of high-quality research chemicals and biochemicals (novel life-science reagents, reference compounds and natural compounds) for scientific use. We have professionally experienced and friendly staff to meet your needs. We are a competent and trustworthy partner for your research and scientific projects.Related websites: https://www.medchemexpress.com

**Engineering Bimetallic Fluoride Heterojunctions in Hierarchically Porous Carbon Nanofibers for High-Performance Oxygen Reduction Reaction**

A novel and scalable approach is developed to fabricate high-efficiency oxygen reduction reaction (ORR) catalysts by integrating bimetallic copper–cobalt fluoride heterojunctions into nitrogen–fluorine–oxygen triply doped porous carbon nanofibers (CuCoF₂@PCNFs). The synthesis employs a green aqueous electrospinning method using deionized water as the sole solvent, eliminating the need for toxic organic media. Poly(tetrafluoroethylene) (PTFE) nanoparticles (120 nm) are utilized not only as a macropore inducer but also as an effective agent to anchor electropositive Cu²⁺ and Co²⁺ ions via strong electrostatic interactions. A homogeneous precursor solution is prepared by dissolving polyvinylpyrrolidone (PVP), PTFE emulsion, copper(II) acetate, cobalt(II) acetate, and melamine in water, followed by ball-milling to achieve molecular-level dispersion and stabilize colloidal complexes. After electrospinning, the as-spun hybrid nanofibers undergo oxidative stabilization at 250 °C to prevent cracking and ensure structural integrity. Subsequent calcination at 800 °C under nitrogen atmosphere leads to the decomposition of PTFE, generating interconnected bubble-like macropores, while the metal precursors transform directly into uniformly dispersed CuCoF₂ heterojunctions embedded within the carbon matrix. The resulting CuCoF₂@PCNFs exhibit a large specific surface area of 332.9 m²/g and a high loading of active species (14.7 wt%). High-resolution transmission electron microscopy confirms the presence of metallic nanoparticles (~70 nm) with distinct lattice fringes corresponding to CoF₂(110), CoF₂(101), and CuF₂ planes, indicating the formation of interfacial heterojunctions. X-ray photoelectron spectroscopy reveals multiple oxidation states of Cu and Co, along with strong M–F bonding that enhances redox activity. Electrochemical evaluation in 0.1 M KOH shows a half-wave potential of 0.84 V—exceeding commercial Pt/C (0.83 V)—and a Tafel slope of 113 mV/dec, indicating fast reaction kinetics. Rotating ring-disk electrode analysis confirms a dominant four-electron transfer pathway (n = 3.94), minimizing peroxide production. After 1000 CV cycles, the catalyst maintains nearly full performance with only a 0.1 mV negative shift, demonstrating exceptional long-term stability. In contrast, Pt/C suffers a significant degradation of 33 mV. The robust integration of bimetallic fluorides within the defect-rich carbon framework prevents agglomeration and leaching, enabling sustained catalytic activity. This work presents a practical, one-step, environmentally friendly strategy for designing next-generation ORR catalysts with performance rivaling platinum-based systems.

—

**Bimetallic Fluoride Heterojunctions in Defect-Enriched Porous Carbon Nanofibers: A Sustainable Platform for Efficient Oxygen Reduction Catalysis**

An innovative and sustainable platform is established for synthesizing high-performance nonprecious ORR catalysts through the integration of bimetallic copper–cobalt fluoride heterojunctions into hierarchically porous carbon nanofibers. The process begins with a fully aqueous electrospinning system using deionized water as the solvent, ensuring environmental compatibility and avoiding hazardous chemicals. Poly(tetrafluoroethylene) (PTFE) nanoparticles serve a dual role: they act as a macropore template during calcination and function as a charge-stabilizing agent for Cu²⁺ and Co²⁺ ions. By blending PVP, PTFE emulsion, copper(II) acetate, cobalt(II) acetate, and melamine in water, followed by ball-milling, stable colloidal particles are formed through cross-linking networks of Cu²⁺–PTFE–Co²⁺. These colloids ensure uniform distribution of metal ions throughout the polymer matrix. After electrospinning, the hybrid nanofibers are thermally stabilized at 250 °C to reduce internal defects and prevent crack formation. Upon calcination at 800 °C under nitrogen, PTFE decomposes, creating a hierarchical pore architecture—macro-, meso-, and micropores—while the metal salts are converted into CuCoF₂ heterojunctions confined within the N-F-O-doped carbon network. The final CuCoF₂@PCNFs exhibit a high surface area of 332.9 m²/g and a metal content of 14.7 wt%. Structural characterization via HRTEM and EDS mapping confirms the presence of well-defined interfaces between CuF₂, CoF₂, and CuCoOₓ phases, with spatial coincidence of Cu, Co, and F signals. XPS analysis reveals rich chemical diversity, including oxidized-N, pyridinic-N, graphitic-N, and various Cu and Co oxidation states, contributing to enhanced charge delocalization. Electrochemical tests demonstrate superior ORR performance: a half-wave potential of 0.84 V—higher than Pt/C’s 0.83 V—and a Tafel slope of 113 mV/dec. Koutecky-Levich plots confirm a four-electron transfer mechanism (n = 3.94), indicating efficient O₂ reduction. After 1000 CV cycles, the catalyst shows minimal degradation (ΔE₁/₂ = +0.1 mV), whereas Pt/C exhibits a 33 mV decline. The synergy between hierarchical porosity, multi-heteroatom doping, and bimetallic fluoride heterojunctions enables rapid mass transport, abundant active sites, and strong anchoring of metal species. This work offers a viable, scalable, and eco-friendly route to design durable ORR catalysts with performance on par with precious metals, making it highly promising for real-world applications in metal-air batteries and renewable energy systems.

—

**Scalable Green Synthesis of Bimetallic Fluoride Heterojunction Catalysts in Porous Carbon Nanofibers for Advanced Oxygen Reduction**

A scalable and environmentally benign synthesis strategy is reported for producing bimetallic fluoride heterojunction catalysts embedded in hierarchically porous carbon nanofibers for efficient oxygen reduction. The method relies on aqueous electrospinning using only deionized water as the solvent, avoiding toxic organic solvents typically used in carbon nanofiber fabrication. Poly(tetrafluoroethylene) (PTFE) nanoparticles (120 nm) are employed as both a structural template and an ion-anchoring agent. A homogeneous precursor solution is prepared by dissolving PVP, PTFE emulsion, copper(II) acetate, cobalt(II) acetate, and melamine in water, followed by ball-milling to enhance molecular mixing and form stable colloidal complexes.Mouse TUG Antibody custom synthesis The resulting sol is stable for up to 8 hours and ensures uniform dispersion of metal ions.JNK1 Antibody manufacturer After electrospinning, the as-spun fibers are oxidatively stabilized at 250 °C to eliminate internal stresses and prevent fiber fracture.PMID:35125711 Subsequent calcination at 800 °C under nitrogen leads to the decomposition of PTFE, forming a hierarchical pore structure—macropores from PTFE volatilization and abundant meso-/micropores from carbonization—while the metal precursors are transformed into CuCoF₂ heterojunctions embedded within the carbon matrix. The final CuCoF₂@PCNFs display a high surface area of 332.9 m²/g and a metal loading of 14.7 wt%. Characterization techniques such as HRTEM, XRD, and Raman spectroscopy confirm the amorphous nature of the carbon framework with enhanced disorder due to dopants. EDS mapping and XPS analyses verify the coexistence of Cu, Co, F, N, O, and C with uniform distribution. The catalyst achieves a half-wave potential of 0.84 V—surpassing Pt/C (0.83 V)—and a Tafel slope of 113 mV/dec, indicating fast ORR kinetics. Rotating disk electrode tests show a four-electron transfer mechanism (n = 3.94), confirming complete oxygen reduction. After 1000 CV cycles, the half-wave potential shifts by only 0.1 mV, demonstrating outstanding cycling stability. The unique combination of hierarchical porosity, defect enrichment, and bimetallic fluoride heterojunctions creates an ideal environment for efficient O₂ adsorption, charge transfer, and catalytic turnover. This work provides a practical, one-step, green fabrication route for next-generation ORR catalysts with performance matching or exceeding platinum-based systems, offering great potential for use in metal-air batteries and clean energy technologies.MedChemExpress (MCE) offers a wide range of high-quality research chemicals and biochemicals (novel life-science reagents, reference compounds and natural compounds) for scientific use. We have professionally experienced and friendly staff to meet your needs. We are a competent and trustworthy partner for your research and scientific projects.Related websites: https://www.medchemexpress.com

**Adsorption Performance and Mechanism of U(VI) on Amidoxime-Functionalized Fe3O4@TiO2 Core-Shell Microspheres**

The adsorption behavior of U(VI) onto amidoxime-functionalized Fe3O4@TiO₂ core-shell microspheres (Fe₃O₄@TiO₂-AO) was systematically investigated under varying aqueous conditions. Kinetic studies revealed that equilibrium was rapidly achieved within 1 hour at 298 K, indicating fast diffusion and reaction rates. The adsorption process followed a pseudo-second-order kinetic model with excellent correlation, suggesting that chemical adsorption via chelation is the rate-limiting step. The high dispersibility of the flower-like nanostructure facilitated rapid access to active sites, contributing to the swift uptake of uranium ions.

pH significantly influenced U(VI) adsorption. Maximum adsorption occurred at pH 6.0, where the amidoxime groups were predominantly deprotonated and capable of forming strong coordination bonds with UO₂²⁺ ions. Below pH 4.0, protonation of the amidoxime functional groups led to electrostatic repulsion with positively charged uranyl species, reducing adsorption efficiency. Above pH 6.0, hydrolysis of UO₂²⁺ into less reactive species such as (UO₂)₂(OH)₂²⁺ or (UO₂)₃(OH)₅⁺ decreased the availability of free uranyl ions for complexation. Ionic strength experiments showed minimal impact on adsorption capacity across NaCl concentrations of 0.001, 0.01, and 0.1 mol·L⁻¹, indicating that the mechanism is dominated by inner-sphere surface complexation rather than outer-sphere electrostatic attraction or ion exchange.

Thermodynamic analysis demonstrated that U(VI) adsorption is endothermic, with increasing capacity observed at higher temperatures (298, 318, and 333 K). The Langmuir isotherm model fitted the experimental data better than Freundlich, confirming monolayer adsorption. The maximum adsorption capacity reached 313.6 mg·g⁻¹ at pH 6.0, which is among the highest reported values for magnetic adsorbents. This exceptional performance stems from the synergistic combination of high surface area from the flower-like TiO₂ nanosheets and the strong chelating ability of grafted amidoxime groups.

X-ray photoelectron spectroscopy (XPS) confirmed the presence of N 1s peaks at 400.34 eV after amidoxime modification, and post-adsorption spectra revealed new U 4f peaks at 381.85 eV (U 4f₇/₂) and 392.69 eV (U 4f₅/₂), confirming the incorporation of U(VI). Shifts in C 1s, N 1s, and O 1s binding energies indicated electron transfer between amidoxime ligands and U(VI), supporting chemical interaction.GPA33 Proteinmanufacturer Extended X-ray absorption fine structure (EXAFS) analysis further elucidated the coordination environment: two axial oxygen atoms at 1.Biotin-conjugated Donkey Anti-Goat IgG H&L custom synthesis 79 Å corresponded to the uranyl moiety (O=U=O), while six equatorial oxygen atoms at 2.PMID:34532813 20 Å and two nitrogen atoms at 2.47 Å confirmed bidentate chelation with amidoxime groups. A fourth shell at 2.38 Å was attributed to coordinated water molecules. These results collectively confirm that U(VI) binds to the amidoxime-functionalized surface through a stable hexagonal bipyramidal complex, providing molecular-level insight into the adsorption mechanism.MedChemExpress (MCE) offers a wide range of high-quality research chemicals and biochemicals (novel life-science reagents, reference compounds and natural compounds) for scientific use. We have professionally experienced and friendly staff to meet your needs. We are a competent and trustworthy partner for your research and scientific projects.Related websites: https://www.medchemexpress.com

High-Throughput Applications of Ultrafast Chromatography in Pharmaceutical and Biomedical Research

Ultrafast liquid chromatography has become a cornerstone of modern pharmaceutical development, where rapid analysis is essential for high-throughput screening, quality control, and metabolite identification. The ability to complete analyses in under 30 seconds enables the evaluation of hundreds of compounds per hour, dramatically accelerating drug discovery pipelines. In early-stage research, ultrafast methods are used to assess compound purity, solubility, and stability—critical parameters in lead optimization. For example, sub-second separations of nucleosides and plant hormones have enabled real-time monitoring of metabolic pathways in plant extracts, supporting natural product discovery. In chiral drug development, ultrafast enantioselective LC has allowed for the rapid determination of enantiomeric excess (ee) in synthetic intermediates, ensuring stereochemical integrity without delaying synthesis cycles. Recent studies demonstrate the separation of over 100 peaks in less than a minute using 2.7 μm superficially porous particles, with peak area recovery exceeding 60% through advanced signal processing. This capability is particularly valuable in pharmacokinetic studies, where multiple analytes must be quantified simultaneously in complex biological matrices such as plasma or urine. The integration of ultrafast LC with tandem mass spectrometry (LC-MS/MS) allows for the detection of trace-level metabolites and drug-drug interactions at unprecedented speed and sensitivity.

In clinical and forensic applications, ultrafast chromatography supports rapid diagnostics and toxicology testing. Emergency medical laboratories require fast turnaround times for detecting drugs of abuse, poisons, and therapeutic agents. Ultrafast SFC and UFLC systems can identify up to ten analytes—including benzodiazepines, opioids, and stimulants—in under 10 seconds, providing actionable results within minutes. These methods are also being adapted for point-of-care testing, where miniaturized, portable instruments enable on-site analysis in field settings. In environmental monitoring, ultrafast LC has been employed to detect microplastics, pesticides, and endocrine disruptors in water and soil samples, with sample throughput increasing by more than 500% compared to conventional methods. The reduction in solvent consumption—often by over 90%—also aligns with green chemistry principles, minimizing environmental impact. Furthermore, the use of short columns with low extra-column volume makes these systems ideal for coupling with online sample preparation techniques such as solid-phase extraction (SPE) and filtration, further streamlining workflows. As regulatory agencies increasingly demand faster and more comprehensive analytical data, ultrafast chromatography offers a scalable, reliable solution that meets the demands of modern biomedical research and industrial quality assurance.

Emerging Challenges and Future Directions in Ultrafast Separation Science

Despite significant progress, several challenges persist in the widespread adoption of ultrafast chromatography. One major limitation is the trade-off between speed and resolution: while shorter run times increase throughput, they often result in partial peak overlap, especially in complex mixtures. Although digital signal processing techniques can mitigate this issue, their effectiveness depends heavily on accurate modeling and sufficient data quality.ITGAM Antibody Technical Information Another critical challenge is frictional heating, which becomes pronounced in short, high-flow columns due to viscous dissipation.LYVE1 Antibody Biological Activity Temperature gradients across the column can alter retention behavior, reduce efficiency, and compromise reproducibility—particularly in chiral separations where small changes in thermodynamics affect selectivity.PMID:34183508 While thermostating is a potential solution, it introduces additional extra-column volume and may not be feasible for all configurations. Instrumental limitations also remain: commercial UFLC systems still struggle with precise gradient formation at high flow rates, leading many researchers to rely on isocratic elution. Additionally, detector response times and sampling frequencies must be carefully matched to the chromatographic speed; otherwise, data undersampling or noise amplification occurs. Looking ahead, future developments will focus on integrating smart instrumentation with adaptive algorithms that automatically optimize flow rate, temperature, and gradient profiles based on real-time feedback. Advances in microfluidic chip platforms, 3D-printed column hardware, and AI-driven method development promise to further reduce analysis time while maintaining robustness. Ultimately, the next generation of ultrafast chromatography will not only be faster but smarter, more sustainable, and seamlessly integrated into automated analytical workflows across science and industry.MedChemExpress (MCE) offers a wide range of high-quality research chemicals and biochemicals (novel life-science reagents, reference compounds and natural compounds) for scientific use. We have professionally experienced and friendly staff to meet your needs. We are a competent and trustworthy partner for your research and scientific projects.Related websites: https://www.medchemexpress.com

Mechanistic Insights into the Stabilization of High-Voltage Cathode Interfaces by Aromatic Anhydride Additives

The operational stability of high-voltage lithium-ion batteries is critically dependent on the integrity of the cathode-electrolyte interphase (CEI), particularly for materials like LiNi₀.₅Mn₁.₅O₄ (LNMO) that operate above 4.5 V. At such voltages, conventional carbonate-based electrolytes undergo extensive oxidative decomposition, leading to thick, inhomogeneous CEI layers that fail to protect the cathode surface. This results in accelerated transition metal dissolution, electrolyte consumption, and irreversible capacity fade. To overcome these limitations, functional additives capable of forming stable, protective interphases are essential.

This study presents a detailed mechanistic analysis of cis-1,2,3,6-tetrahydrophthalic anhydride (CTA), a novel aromatic anhydride additive, in enhancing CEI stability. CTA combines two key structural features: a reactive acid anhydride moiety and a conjugated unsaturated aromatic ring system. The dual functionality enables both efficient oxidation initiation and electronic modulation of the resulting interphase. Density functional theory (DFT) calculations confirm that CTA possesses a higher highest occupied molecular orbital (HOMO) energy than propionic anhydride (PA) and standard carbonate solvents, indicating greater susceptibility to oxidation. This preferential oxidation ensures early formation of the CEI layer before significant electrolyte decomposition occurs.

Experimental validation through linear sweep voltammetry (LSV) reveals that CTA oxidizes at ~4.87 V, preceding PA (~4.84 V) and the baseline electrolyte (~4.68 V). The LSV curve for CTA also exhibits a prolonged flat region post-oxidation, suggesting the formation of a passivating film that inhibits further electrochemical degradation. Electrochemical impedance spectroscopy (EIS) measurements show a significant reduction in charge transfer resistance (Rct) and interfacial resistance (Rsf) over cycling when CTA is used. After 50 cycles, Rct decreases from 289 Ω (BE) to just 29.4 Ω (CTA), while Rsf drops from 402 Ω to 178 Ω, reflecting the development of a more conductive and stable interface.

High-resolution transmission electron microscopy (HRTEM) and fast Fourier transform (FFT) analyses reveal that the CEI formed with CTA maintains well-defined lattice fringes even after extended cycling, indicating minimal structural disorder. In contrast, CEI films from PA and BE exhibit amorphous or disordered regions, consistent with poor mechanical and chemical stability. X-ray photoelectron spectroscopy (XPS) confirms the presence of carbon-rich organic species (e.g., ROCO₂Li, polyesters) and phosphorus-containing compounds (LixPOyFz) within the CTA-derived CEI, confirming its composition as a polymerized, cross-linked network derived from CTA oxidation.

Crucially, the aromatic ring in CTA induces a field-effect that lowers the local electron density at the CEI surface, rendering it more resistant to oxidative attack. This effect is demonstrated by the significantly reduced intensity of CO₃²⁻ and OCO peaks in the O 1s spectrum compared to control samples, indicating suppressed electrolyte decomposition. Moreover, the Mn 2p spectra show only Mn⁴⁺ signals in CTA-treated cells, whereas BE samples display multiple oxidation states (Mn²⁺, Mn³⁺), confirming effective suppression of Mn redox activity and dissolution.

The synergy between rapid film formation and intrinsic antioxidative strength leads to a stabilized CEI that acts as a selective barrier—allowing lithium-ion transport while blocking electrons and reactive species.IKK gamma Antibody Biological Activity This dual function reduces parasitic reactions, preserves active lithium inventory, and protects the LNMO crystal structure.GATA-5 Antibody Autophagy As a result, cells with CTA achieve 83.PMID:34824020 3% capacity retention after 500 cycles at 1 C, outperforming PA (46.5%) and BE (13.6%).

These findings highlight that the design of high-performance electrolyte additives must go beyond simple film-forming ability. The integration of electronic engineering—such as using aromatic systems to modulate interfacial reactivity—offers a powerful route to achieving durable, high-voltage battery operation. CTA exemplifies this principle, providing not only a robust physical barrier but also a chemically inert, electron-deficient interface that resists degradation under extreme conditions. This work advances the fundamental understanding of interphase stabilization and paves the way for next-generation additive strategies in advanced lithium-ion batteries.MedChemExpress (MCE) offers a wide range of high-quality research chemicals and biochemicals (novel life-science reagents, reference compounds and natural compounds) for scientific use. We have professionally experienced and friendly staff to meet your needs. We are a competent and trustworthy partner for your research and scientific projects.Related websites: https://www.medchemexpress.com

Oxygen-Independent Nitric Oxide Release via Photogenerated Holes for Effective Hypoxic Tumor Therapy

Nitric oxide (NO) is a versatile signaling molecule with significant potential in cancer therapy due to its ability to induce mitochondrial dysfunction, inhibit proliferation, and trigger apoptosis in tumor cells. However, the clinical translation of NO-based therapies is hampered by the hypoxic nature of solid tumors, where traditional NO delivery systems—dependent on oxygen or hydrogen peroxide—fail to function efficiently. To overcome this limitation, we developed a novel phototherapeutic strategy that harnesses photogenerated holes to drive NO production independently of the tumor microenvironment. The system is based on poly-L-arginine-modified carbon-dot-doped graphitic carbon nitride (ArgCCN), which generates strong oxidizing holes upon red light irradiation (660 nm).

The synthesis of ArgCCN begins with the preparation of carbon-dot-doped g-C₃N₄ (CCN), which exhibits a narrowed bandgap and enhanced valence band energy compared to pristine g-C₃N₄. This modification enables efficient activation under visible light, particularly in the red region. Poly-L-arginine is then conjugated to the surface carboxyl groups of CCN via EDC/NHS coupling, resulting in ArgCCN. Characterization using TEM, DLS, and AFM confirms a hydrodynamic size of approximately 120 nm, ideal for tumor accumulation through the enhanced permeability and retention (EPR) effect. UV-vis spectroscopy reveals broad absorption extending into the red light range, while XRD analysis shows preserved crystallinity with reduced peak intensity, suggesting structural exfoliation induced by polymer conjugation.

Under 660 nm laser irradiation, ArgCCN generates photogenerated holes that oxidize water molecules to produce H₂O₂. This reaction is confirmed by colorimetric assays showing a dose-dependent increase in H₂O₂ concentration. Subsequently, the generated H₂O₂ oxidizes the arginine residues on the conjugated poly-L-arginine chain, leading to the release of NO. Notably, no NO is detected in control groups lacking either the laser or the arginine component. In contrast, the ArgCCN + laser group produces up to 16 μM of NO within 30 minutes, demonstrating high efficiency and specificity.

Electron spin resonance (ESR) analysis reveals minimal generation of reactive oxygen species (ROS), including singlet oxygen, hydroxyl radicals, and superoxide anions, even in the presence of oxygen. More importantly, under hypoxic conditions, substantial NO production continues unabated, confirming the process is entirely independent of molecular oxygen. This O₂-independence is a critical advantage over conventional photodynamic therapy.

In vitro studies using MCF-7 cells show efficient cellular uptake of ArgCCN, primarily via clathrin-mediated endocytosis.THOC1 Antibody manufacturer Fluorescence imaging with DAF-FM DA confirms robust intracellular NO release after laser irradiation, with no decline observed under hypoxia.2089288-03-7 Biological Activity Furthermore, no significant change in intracellular O₂ levels is detected, indicating that the system does not consume oxygen during NO production.

Cytotoxicity assays demonstrate that ArgCCN + laser induces over 55% cell death in both normoxic and hypoxic environments, effectively triggering apoptosis.PMID:34740865 In vivo evaluation in MCF-7 tumor-bearing mice shows significant suppression of tumor growth following treatment with ArgCCN + laser. TUNEL staining reveals extensive DNA fragmentation in treated tumors, while H&E staining displays clear signs of apoptotic cell death, including nuclear condensation and loss of cellular integrity. Histological examination of vital organs shows no major damage, and body weight remains stable throughout the treatment period, indicating excellent safety and biocompatibility.

This study establishes a new framework for cancer therapy by leveraging photogenerated holes as the primary oxidative agent. By enabling NO production without oxygen consumption, ArgCCN effectively circumvents the therapeutic barrier posed by tumor hypoxia. Future developments will focus on extending the light response into the near-infrared window and integrating active targeting moieties to enhance tumor-specific delivery. These advances position hole-mediated NO release as a transformative strategy for next-generation cancer therapeutics.MedChemExpress (MCE) offers a wide range of high-quality research chemicals and biochemicals (novel life-science reagents, reference compounds and natural compounds) for scientific use. We have professionally experienced and friendly staff to meet your needs. We are a competent and trustworthy partner for your research and scientific projects.Related websites: https://www.medchemexpress.com

**Robust Free-Breathing Kidney DW-MRI via Dual-Echo EPI and Dynamic Slice-to-Volume Registration**

Diffusion-weighted MRI (DW-MRI) of the kidneys is a powerful tool for assessing renal microstructure without ionizing radiation or nephrotoxic contrast agents, making it especially valuable in pediatric and chronic kidney disease populations. However, free-breathing acquisitions are severely compromised by two major challenges: large geometric distortions due to B0 field inhomogeneities during echo-planar imaging (EPI), and motion-induced misalignment across slices caused by respiration, bowel motility, and patient movement. These artifacts degrade image quality, compromise quantitative accuracy, and limit clinical translation.

This study presents a novel retrospective correction method—Di + MoCo—that combines dual-echo EPI acquisition with a dynamic 3D slice-to-volume registration framework to simultaneously address both distortion and motion in free-breathing kidney DW-MRI at 3T. The dual-echo sequence acquires two EPI readouts per slice with opposite phase-encoding directions, separated by only ~50 ms. This short interval ensures that organ position remains effectively static between echoes, allowing reliable estimation of local distortion fields even when breathing causes shifts in anatomy. Preprocessing steps—including histogram equalization and median filtering—are applied to balance signal intensity and mitigate SNR loss due to T2 decay in the second echo before using TOPUP to estimate distortion maps. These maps are then used to correct the original images, and sum-of-squares combination yields a single, distortion-corrected DW volume.

To correct inter-slice motion, a 3D slice-to-volume registration algorithm is employed. A dynamic template volume is generated from previously registered slices at each b-value, ensuring consistent contrast and anatomical fidelity. Each slice is rigidly aligned to this evolving template using mutual information maximization within ITK. Crucially, the estimated transformation parameters (rotation and translation) are smoothed over time using a Kalman filter, enforcing smooth, physically plausible motion patterns consistent with respiratory dynamics. This regularization enables accurate compensation for out-of-plane motion, which traditional 2D registration methods cannot handle.

The method was evaluated in ten healthy volunteers (ages 29–38, four females). Radiological assessment revealed a significant improvement in image quality, with mean Likert scores increasing from 2.6 ± 1.0 to 3.7 ± 1.0 (P < 0.05). Normalized cross-correlation (NCC) with a T2-HASTE reference image improved from 0.40 ± 0.10 to 0.53 ± 0.08 (P < 0.05), confirming better anatomical alignment. Model fitting performance also enhanced: IVIM and DTI models showed reduced nRMSE by 0.13 ± 0.03 and 0.23 ± 0.06, respectively (P < 0.05). Coefficient of variation (CV%) decreased significantly for key parameters—mean diffusivity (3.Prostein Antibody medchemexpress 22 ± 0.MRP1 Antibody Autophagy 55%, P < 0.PMID:34910238 05) and fractional anisotropy (2.42 ± 1.15%, P < 0.05)—indicating greater precision and reproducibility. These findings demonstrate that Di + MoCo enables high-quality, free-breathing kidney DW-MRI without breath-holds or respiratory gating. By integrating dynamic distortion correction with motion-robust 3D registration, the method delivers superior image fidelity and parameter reliability. It supports robust quantification of renal tissue properties essential for diagnosing conditions like fibrosis, obstruction, and transplant rejection. The approach is particularly advantageous in pediatric imaging, where cooperation is limited and scan duration must be minimized. Future work will extend validation to patient populations and incorporate simultaneous multi-slice acquisition to further accelerate scanning.MedChemExpress (MCE) offers a wide range of high-quality research chemicals and biochemicals (novel life-science reagents, reference compounds and natural compounds) for scientific use. We have professionally experienced and friendly staff to meet your needs. We are a competent and trustworthy partner for your research and scientific projects.Related websites: https://www.medchemexpress.com

**Engineering High-Performance Microbial α-Amylase for Industrial Biotechnology**

The demand for high-performance microbial α-amylase continues to grow across industries, driven by the need for efficient, sustainable, and cost-effective biocatalysts. While naturally occurring enzymes offer valuable functionality, their limitations in stability, specificity, and tolerance to industrial conditions necessitate advanced engineering strategies. Recent breakthroughs in molecular biology, structural biology, and synthetic biology have enabled the rational design and optimization of α-amylase variants with enhanced properties. This article explores cutting-edge approaches in enzyme engineering, including site-directed mutagenesis, directed evolution, and computational modeling, highlighting how these techniques are transforming α-amylase into a next-generation biocatalyst.

—

**Rational Design through Site-Directed Mutagenesis**

Site-directed mutagenesis allows precise modification of amino acid residues at functionally critical positions. By targeting catalytic triads, calcium-binding sites, or surface loops, researchers can fine-tune enzyme performance. For example, replacing histidine residues (His222, His275, His293, His310) in *Bacillus subtilis* α-amylase with aspartate enhances acid stability and catalytic efficiency under low pH. Similarly, mutations in the B domain—such as M145L, M214L, and M247L—improve thermostability by reinforcing hydrophobic interactions within the TIM barrel. In *Thermotoga maritima*, methionine-to-alanine substitutions reduce oxidative damage, increasing enzyme half-life by over 50%. These targeted changes demonstrate that even minor structural alterations can yield dramatic improvements in functional robustness.

—

**Directed Evolution and Semi-Rational Design**

While rational design relies on known structural insights, directed evolution mimics natural selection by introducing random mutations followed by high-throughput screening. This approach has successfully generated α-amylases with unprecedented resilience. For instance, UV irradiation of *Bacillus licheniformis* led to a 1.4-fold increase in amylase yield and improved alkali tolerance. Chemical mutagens like ethyl methane sulfonate (EMS) have also produced hyperactive mutants capable of functioning at extreme temperatures (>80°C). Semi-rational design combines both strategies: using computational tools to identify promising mutation hotspots before applying mutagenesis. This hybrid method accelerates discovery while minimizing trial-and-error efforts. Machine learning models now predict beneficial mutations based on sequence conservation, solvent accessibility, and evolutionary pressure, further streamlining the process.

—

**Computational Modeling and Structural Insights**

Advances in bioinformatics and molecular dynamics simulations have revolutionized enzyme engineering. Homology modeling, based on PDB structures such as Bacillus amyloliquefaciens α-amylase (PDB ID: 3BH4), enables prediction of three-dimensional conformations and active site architecture. Tools like SWISS-MODEL and Rosetta facilitate accurate protein folding and interaction analysis. Molecular docking studies reveal how substrates bind and how inhibitors disrupt catalysis.HSP90B Antibody manufacturer Furthermore, free energy calculations estimate the impact of mutations on stability and activity, guiding experimental validation.SRA1 Antibody Purity & Documentation Such predictive power reduces the number of required experiments and increases success rates in developing superior enzyme variants.

—

**Novel Variants from Extremophiles and Metagenomics**

Extremophilic microorganisms thrive in harsh environments and produce enzymes inherently adapted to industrial stressors. α-Amylases isolated from thermophiles (*Bacillus stearothermophilus*, *Geobacillus* spp.), alkaliphiles (*Luteimonas abyssi*), and halophiles (*Haloarcula hispanica*) exhibit exceptional thermal, pH, and salt tolerance. Metagenomic screening of environmental DNA samples has uncovered novel α-amylase genes from unculturable microbes, expanding the genetic pool available for engineering. For example, a newly identified GH13_42 subfamily from *Microbacterium aurum* displays unique multi-domain organization and raw-starch hydrolysis capability. These discoveries provide blueprints for designing enzymes tailored to specific industrial processes, such as high-temperature starch liquefaction or detergent formulations.PMID:34687147

—

**Functional Integration and Multi-Enzyme Systems**

Beyond single-enzyme enhancement, future applications lie in integrating α-amylase into complex biocatalytic systems. Co-immobilization with other enzymes—such as glucoamylase or pullulanase—in nanostructured carriers enables sequential conversion of starch to glucose in a single reactor. Magnetic combi-CLEAs, where α-amylase is covalently linked to maltogenic amylase on Fe₃O₄ nanoparticles, allow easy recovery and reuse. These systems improve process efficiency, reduce capital costs, and minimize waste. Additionally, engineered α-amylases are being incorporated into biosensors, diagnostic kits, and smart drug delivery platforms, showcasing their versatility beyond traditional industrial roles.

—

**Challenges and Future Directions**

Despite remarkable progress, challenges remain. Off-target effects from mutagenesis, instability during purification, and scalability issues persist. Moreover, regulatory hurdles exist for genetically modified enzymes in food and pharmaceutical applications. To overcome these, researchers are exploring chassis-free expression systems, cell-free protein synthesis, and non-antibiotic selection markers. The development of standardized testing protocols and international guidelines will support broader adoption. Looking ahead, the convergence of synthetic biology, AI-driven design, and green chemistry will enable the creation of intelligent, self-optimizing enzyme systems capable of adapting to dynamic industrial environments.

—

**Conclusion**

Engineered microbial α-amylase is no longer just a tool—it is a transformative force in industrial biotechnology. From rational mutations to metagenome-derived innovations, modern engineering has unlocked unprecedented levels of performance and adaptability. As industries seek cleaner, more efficient processes, α-amylase stands at the forefront of sustainable innovation. With continued investment in research and technology, the next generation of α-amylase will not only meet but exceed current industrial demands, paving the way for smarter, greener, and more resilient bioprocesses worldwide.MedChemExpress (MCE) offers a wide range of high-quality research chemicals and biochemicals (novel life-science reagents, reference compounds and natural compounds) for scientific use. We have professionally experienced and friendly staff to meet your needs. We are a competent and trustworthy partner for your research and scientific projects.Related websites: https://www.medchemexpress.com

Optimization of Cell Density and Media Supplementation for Enhanced Tubulogenesis in Porcine Testis Organoids

The successful formation of a biomimetic testis organoid hinges on precise control of culture conditions, particularly cell density and media composition. This study systematically investigated the impact of these parameters on tubulogenesis and overall organoid development using neonatal porcine testis cells. A range of cell densities—0.6 × 10⁶, 0.8 × 10⁶, and 1.0 × 10⁶ cells per organoid—were evaluated to determine the optimal seeding concentration for efficient tubular structure formation. Results revealed that a density of 0.8 × 10⁶ cells yielded the highest tubular relative area throughout the four-week culture period, indicating superior de novo tubulogenesis. Higher densities led to central necrosis due to impaired nutrient diffusion, while lower densities resulted in delayed or incomplete tubule development, underscoring the importance of a balanced initial cell load.

Media supplementation was equally critical. Four formulations were compared: 10% knockout serum replacement (KSR), 10% fetal bovine serum (FBS), and two combined regimens—10% KSR + 5% FBS and 5% KSR + 10% FBS. The combined supplementation of 5% KSR + 10% FBS consistently outperformed all other groups, resulting in significantly greater tubular relative area and larger organoid size. In contrast, the 10% FBS-only group exhibited poor tubulogenesis and widespread cellular disorganization, likely due to excessive proliferation of somatic cells such as Sertoli and peritubular myoid cells, which disrupted tissue architecture and compromised gaseous exchange. The synergistic effect of KSR and FBS suggests that KSR supports stem cell maintenance and differentiation, while FBS enhances somatic cell growth, creating an ideal microenvironment for coordinated tubulogenesis.

Importantly, germ cell viability remained stable across all media conditions, with no significant decline over time. Relative germ cell numbers were maintained at approximately 0.5–1.5%, consistent with early postnatal testis development in pigs.SENP8 Antibody manufacturer This stability, despite varying culture conditions, highlights the resilience of gonocytes within the self-organizing system. Furthermore, histological and immunohistochemical analyses confirmed the presence of key structural components: GATA4-positive Sertoli cells lining tubules, α-SMA-positive peritubular myoid cells, and CYP17A1-positive Leydig cells dispersed in the interstitium. The combination of optimized cell density and media formulation thus enables robust, reproducible organoid formation with high fidelity to native tissue architecture.FITC-conjugated Goat Anti-Human IgG Fc References

These findings provide clear guidelines for future studies aiming to generate functional testis organoids.PMID:34756868 By identifying 0.8 × 10⁶ cells per organoid and 5% KSR + 10% FBS as the optimal configuration, this work establishes a reliable protocol for maximizing tubulogenic efficiency. The model is now well-suited for applications requiring consistent, high-quality organoids, including drug screening, disease modeling, and fertility preservation research. Moreover, the ability to maintain germ cell integrity under suboptimal conditions suggests potential for adaptation in clinical or biobanking settings where fresh cell availability may be limited.MedChemExpress (MCE) offers a wide range of high-quality research chemicals and biochemicals (novel life-science reagents, reference compounds and natural compounds) for scientific use. We have professionally experienced and friendly staff to meet your needs. We are a competent and trustworthy partner for your research and scientific projects.Related websites: https://www.medchemexpress.com