Trimethoprim
Product: Telithromycin
Identifier : DBSNPE003627
Drug : DB00440 (Trimethoprim)
Interacting Gene/Enzyme : Glucose-6-phosphate 1-dehydrogenase
Gene Name : G6PD
UniProt ID : P11413
Allele Name : Villeurbanne
Genotype(s) : Not Available
Type(s) : ADR Inferred
Groups : G6PD deficiency
Description : Increased risk of dose-related hemolysis.
References :
- Bacdivim™[package insert]. Philadelphia, Pennysylvania: Mutual Pharmaceutical Company; 2013. [Link]
PMID: 20551326
Trimethoprim
Product: Iohexol
Identifier : DBSNPE003628
Drug : DB00440 (Trimethoprim)
Interacting Gene/Enzyme : Glucose-6-phosphate 1-dehydrogenase
Gene Name : G6PD
UniProt ID : P11413
Allele Name : Torun
Genotype(s) : Not Available
Type(s) : ADR Inferred
Groups : G6PD deficiency
Description : Increased risk of dose-related hemolysis.
References :
- Bacdivim™[package insert]. Philadelphia, Pennysylvania: Mutual Pharmaceutical Company; 2013. [Link]
PMID: 18308941
Trimethoprim
Product: Ceftazidime
Identifier : DBSNPE003629
Drug : DB00440 (Trimethoprim)
Interacting Gene/Enzyme : Glucose-6-phosphate 1-dehydrogenase
Gene Name : G6PD
UniProt ID : P11413
Allele Name : Sunderland
Genotype(s) : Not Available
Type(s) : ADR Inferred
Groups : G6PD deficiency
Description : Increased risk of dose-related hemolysis.
References :
- Bacdivim™[package insert]. Philadelphia, Pennysylvania: Mutual Pharmaceutical Company; 2013. [Link]
PMID: 1731751
Trimethoprim
Product: Trandolapril
Identifier : DBSNPE003631
Drug : DB00440 (Trimethoprim)
Interacting Gene/Enzyme : Glucose-6-phosphate 1-dehydrogenase
Gene Name : G6PD
UniProt ID : P11413
Allele Name : Serres
Genotype(s) : Not Available
Type(s) : ADR Inferred
Groups : G6PD deficiency
Description : Increased risk of dose-related hemolysis.
References :
- Bacdivim™[package insert]. Philadelphia, Pennysylvania: Mutual Pharmaceutical Company; 2013. [Link]
PMID: 20356772
Trimethoprim
Product: Cabergoline
Identifier : DBSNPE003632
Drug : DB00440 (Trimethoprim)
Interacting Gene/Enzyme : Glucose-6-phosphate 1-dehydrogenase
Gene Name : G6PD
UniProt ID : P11413
Defining Change(s) :
- 1084_1101delCTGAACGAGCGCAAGGCC
Allele Name : Tondela
Genotype(s) : Not Available
Type(s) : ADR Inferred
Groups : G6PD deficiency
Description : Increased risk of dose-related hemolysis.
References :
- Bacdivim™[package insert]. Philadelphia, Pennysylvania: Mutual Pharmaceutical Company; 2013. [Link]
PMID: 20735414
Trimethoprim
Product: Tetrabenazine
Identifier : DBSNPE003633
Drug : DB00440 (Trimethoprim)
Interacting Gene/Enzyme : Glucose-6-phosphate 1-dehydrogenase
Gene Name : G6PD
UniProt ID : P11413
Allele Name : Loma Linda
Genotype(s) : Not Available
Type(s) : ADR Inferred
Groups : G6PD deficiency
Description : Increased risk of dose-related hemolysis.
References :
- Bacdivim™[package insert]. Philadelphia, Pennysylvania: Mutual Pharmaceutical Company; 2013. [Link]
PMID: 19366702
Trimethoprim
Product: Cysteamine (Hydrochloride)
Identifier : DBSNPE003634
Drug : DB00440 (Trimethoprim)
Interacting Gene/Enzyme : Glucose-6-phosphate 1-dehydrogenase
Gene Name : G6PD
UniProt ID : P11413
Allele Name : Aachen
Genotype(s) : Not Available
Type(s) : ADR Inferred
Groups : G6PD deficiency
Description : Increased risk of dose-related hemolysis.
References :
- Bacdivim™[package insert]. Philadelphia, Pennysylvania: Mutual Pharmaceutical Company; 2013. [Link]
PMID: 19800804
Trimethoprim
Product: Cysteamine
Identifier : DBSNPE003635
Drug : DB00440 (Trimethoprim)
Interacting Gene/Enzyme : Glucose-6-phosphate 1-dehydrogenase
Gene Name : G6PD
UniProt ID : P11413
Allele Name : Tenri
Genotype(s) : Not Available
Type(s) : ADR Inferred
Groups : G6PD deficiency
Description : Increased risk of dose-related hemolysis.
References :
- Bacdivim™[package insert]. Philadelphia, Pennysylvania: Mutual Pharmaceutical Company; 2013. [Link]
PMID: 18467108
Trimethoprim
Product: Atorvastatin
Identifier : DBSNPE003636
Drug : DB00440 (Trimethoprim)
Interacting Gene/Enzyme : Glucose-6-phosphate 1-dehydrogenase
Gene Name : G6PD
UniProt ID : P11413
Allele Name : Montpellier
Genotype(s) : Not Available
Type(s) : ADR Inferred
Groups : G6PD deficiency
Description : Increased risk of dose-related hemolysis.
References :
- Bacdivim™[package insert]. Philadelphia, Pennysylvania: Mutual Pharmaceutical Company; 2013. [Link]
PMID: 26034042
Trimethoprim
Product: DDR1-IN-1
Identifier : DBSNPE003637
Drug : DB00440 (Trimethoprim)
Interacting Gene/Enzyme : Glucose-6-phosphate 1-dehydrogenase
Gene Name : G6PD
UniProt ID : P11413
Allele Name : Calvo Mackenna
Genotype(s) : Not Available
Type(s) : ADR Inferred
Groups : G6PD deficiency
Description : Increased risk of dose-related hemolysis.
References :
- Bacdivim™[package insert]. Philadelphia, Pennysylvania: Mutual Pharmaceutical Company; 2013. [Link]
PMID: 22863277
Trimethoprim
Product: LGK974
Identifier : DBSNPE003638
Drug : DB00440 (Trimethoprim)
Interacting Gene/Enzyme : Glucose-6-phosphate 1-dehydrogenase
Gene Name : G6PD
UniProt ID : P11413
Allele Name : Riley
Genotype(s) : Not Available
Type(s) : ADR Inferred
Groups : G6PD deficiency
Description : Increased risk of dose-related hemolysis.
References :
- Bacdivim™[package insert]. Philadelphia, Pennysylvania: Mutual Pharmaceutical Company; 2013. [Link]
PMID: 14660630
Trimethoprim
Product: TPT-260
Identifier : DBSNPE003639
Drug : DB00440 (Trimethoprim)
Interacting Gene/Enzyme : Glucose-6-phosphate 1-dehydrogenase
Gene Name : G6PD
UniProt ID : P11413
Allele Name : Olomouc
Genotype(s) : Not Available
Type(s) : ADR Inferred
Groups : G6PD deficiency
Description : Increased risk of dose-related hemolysis.
References :
- Bacdivim™[package insert]. Philadelphia, Pennysylvania: Mutual Pharmaceutical Company; 2013. [Link]
PMID: 14500756
Trimethoprim
Product: TPT-260 (Dihydrochloride)
Identifier : DBSNPE003640
Drug : DB00440 (Trimethoprim)
Interacting Gene/Enzyme : Glucose-6-phosphate 1-dehydrogenase
Gene Name : G6PD
UniProt ID : P11413
Allele Name : Tomah
Genotype(s) : Not Available
Type(s) : ADR Inferred
Groups : G6PD deficiency
Description : Increased risk of dose-related hemolysis.
References :
- Bacdivim™[package insert]. Philadelphia, Pennysylvania: Mutual Pharmaceutical Company; 2013. [Link]
PMID: 22894757
Trimethoprim
Product: Eribulin (mesylate)
Identifier : DBSNPE003641
Drug : DB00440 (Trimethoprim)
Interacting Gene/Enzyme : Glucose-6-phosphate 1-dehydrogenase
Gene Name : G6PD
UniProt ID : P11413
Allele Name : Lynwood
Genotype(s) : Not Available
Type(s) : ADR Inferred
Groups : G6PD deficiency
Description : Increased risk of dose-related hemolysis.
References :
- Bacdivim™[package insert]. Philadelphia, Pennysylvania: Mutual Pharmaceutical Company; 2013. [Link]
PMID: 22801643
Trimethoprim
Product: Eribulin
Identifier : DBSNPE003642
Drug : DB00440 (Trimethoprim)
Interacting Gene/Enzyme : Glucose-6-phosphate 1-dehydrogenase
Gene Name : G6PD
UniProt ID : P11413
Allele Name : Madrid
Genotype(s) : Not Available
Type(s) : ADR Inferred
Groups : G6PD deficiency
Description : Increased risk of dose-related hemolysis.
References :
- Bacdivim™[package insert]. Philadelphia, Pennysylvania: Mutual Pharmaceutical Company; 2013. [Link]
PMID: 23596204
Trimethoprim
Product: Arctigenin
Identifier : DBSNPE003643
Drug : DB00440 (Trimethoprim)
Interacting Gene/Enzyme : Glucose-6-phosphate 1-dehydrogenase
Gene Name : G6PD
UniProt ID : P11413
Allele Name : Iowa, Walter Reed, Springfield
Genotype(s) : Not Available
Type(s) : ADR Inferred
Groups : G6PD deficiency
Description : Increased risk of dose-related hemolysis.
References :
- Bacdivim™[package insert]. Philadelphia, Pennysylvania: Mutual Pharmaceutical Company; 2013. [Link]
PMID: 18794796
Trimethoprim
Product: GNF179
Identifier : DBSNPE003644
Drug : DB00440 (Trimethoprim)
Interacting Gene/Enzyme : Glucose-6-phosphate 1-dehydrogenase
Gene Name : G6PD
UniProt ID : P11413
Allele Name : Beverly Hills, Genova, Iwate, Niigata, Yamaguchi
Genotype(s) : Not Available
Type(s) : ADR Inferred
Groups : G6PD deficiency
Description : Increased risk of dose-related hemolysis.
References :
- Bacdivim™[package insert]. Philadelphia, Pennysylvania: Mutual Pharmaceutical Company; 2013. [Link]
PMID: 12444544
Trimethoprim
Product: GNF179 (Metabolite)
Identifier : DBSNPE003645
Drug : DB00440 (Trimethoprim)
Interacting Gene/Enzyme : Glucose-6-phosphate 1-dehydrogenase
Gene Name : G6PD
UniProt ID : P11413
Allele Name : Hartford
Genotype(s) : Not Available
Type(s) : ADR Inferred
Groups : G6PD deficiency
Description : Increased risk of dose-related hemolysis.
References :
- Bacdivim™[package insert]. Philadelphia, Pennysylvania: Mutual Pharmaceutical Company; 2013. [Link]
PMID: 16373705
Trimethoprim
Product: Betulinaldehyde
Identifier : DBSNPE003646
Drug : DB00440 (Trimethoprim)
Interacting Gene/Enzyme : Glucose-6-phosphate 1-dehydrogenase
Gene Name : G6PD
UniProt ID : P11413
Allele Name : Praha
Genotype(s) : Not Available
Type(s) : ADR Inferred
Groups : G6PD deficiency
Description : Increased risk of dose-related hemolysis.
References :
- Bacdivim™[package insert]. Philadelphia, Pennysylvania: Mutual Pharmaceutical Company; 2013. [Link]
PMID: 15585638
Trimethoprim
Product: Eperezolid
Identifier : DBSNPE003647
Drug : DB00440 (Trimethoprim)
Interacting Gene/Enzyme : Glucose-6-phosphate 1-dehydrogenase
Gene Name : G6PD
UniProt ID : P11413
Allele Name : Krakow
Genotype(s) : Not Available
Type(s) : ADR Inferred
Groups : G6PD deficiency
Description : Increased risk of dose-related hemolysis.
References :
- Bacdivim™[package insert]. Philadelphia, Pennysylvania: Mutual Pharmaceutical Company; 2013. [Link]
PMID: 22594480
Trimethoprim
Product: Actinomycin D
Identifier : DBSNPE003649
Drug : DB00440 (Trimethoprim)
Interacting Gene/Enzyme : Glucose-6-phosphate 1-dehydrogenase
Gene Name : G6PD
UniProt ID : P11413
Allele Name : Nashville, Anaheim, Portici
Genotype(s) : Not Available
Type(s) : ADR Inferred
Groups : G6PD deficiency
Description : Increased risk of dose-related hemolysis.
References :
- Bacdivim™[package insert]. Philadelphia, Pennysylvania: Mutual Pharmaceutical Company; 2013. [Link]
PMID: 27302163
Trimethoprim
Product: GS-9973
Identifier : DBSNPE003650
Drug : DB00440 (Trimethoprim)
Interacting Gene/Enzyme : Glucose-6-phosphate 1-dehydrogenase
Gene Name : G6PD
UniProt ID : P11413
Allele Name : Alhambra
Genotype(s) : Not Available
Type(s) : ADR Inferred
Groups : G6PD deficiency
Description : Increased risk of dose-related hemolysis.
References :
- Bacdivim™[package insert]. Philadelphia, Pennysylvania: Mutual Pharmaceutical Company; 2013. [Link]
PMID: 21855335
Trimethoprim
Product: GSK269962A
Identifier : DBSNPE003651
Drug : DB00440 (Trimethoprim)
Interacting Gene/Enzyme : Glucose-6-phosphate 1-dehydrogenase
Gene Name : G6PD
UniProt ID : P11413
Allele Name : Bari
Genotype(s) : Not Available
Type(s) : ADR Inferred
Groups : G6PD deficiency
Description : Increased risk of dose-related hemolysis.
References :
- Bacdivim™[package insert]. Philadelphia, Pennysylvania: Mutual Pharmaceutical Company; 2013. [Link]
PMID: 12475982
Trimethoprim
Product: Brinzolamide
Identifier : DBSNPE003652
Drug : DB00440 (Trimethoprim)
Interacting Gene/Enzyme : Glucose-6-phosphate 1-dehydrogenase
Gene Name : G6PD
UniProt ID : P11413
Allele Name : Puerto Limon
Genotype(s) : Not Available
Type(s) : ADR Inferred
Groups : G6PD deficiency
Description : Increased risk of dose-related hemolysis.
References :
- Bacdivim™[package insert]. Philadelphia, Pennysylvania: Mutual Pharmaceutical Company; 2013. [Link]
PMID: 11861385
Trimethoprim
Product: Guanfacine
Identifier : DBSNPE003653
Drug : DB00440 (Trimethoprim)
Interacting Gene/Enzyme : Glucose-6-phosphate 1-dehydrogenase
Gene Name : G6PD
UniProt ID : P11413
Allele Name : Covao do Lobo
Genotype(s) : Not Available
Type(s) : ADR Inferred
Groups : G6PD deficiency
Description : Increased risk of dose-related hemolysis.
References :
- Bacdivim™[package insert]. Philadelphia, Pennysylvania: Mutual Pharmaceutical Company; 2013. [Link]
PMID: 10467133
Trimethoprim
Product: AMD 3465
Identifier : DBSNPE003654
Drug : DB00440 (Trimethoprim)
Interacting Gene/Enzyme : Glucose-6-phosphate 1-dehydrogenase
Gene Name : G6PD
UniProt ID : P11413
Allele Name : Clinic
Genotype(s) : Not Available
Type(s) : ADR Inferred
Groups : G6PD deficiency
Description : Increased risk of dose-related hemolysis.
References :
- Bacdivim™[package insert]. Philadelphia, Pennysylvania: Mutual Pharmaceutical Company; 2013. [Link]
PMID: 8557675
Trimethoprim
Product: Rucaparib
Identifier : DBSNPE003655
Drug : DB00440 (Trimethoprim)
Interacting Gene/Enzyme : Glucose-6-phosphate 1-dehydrogenase
Gene Name : G6PD
UniProt ID : P11413
Allele Name : Udivecht
Genotype(s) : Not Available
Type(s) : ADR Inferred
Groups : G6PD deficiency
Description : Increased risk of dose-related hemolysis.
References :
- Bacdivim™[package insert]. Philadelphia, Pennysylvania: Mutual Pharmaceutical Company; 2013. [Link]
PMID: 22889981
Trimethoprim
Product: AMD 3465 (hexahydrobromide)
Identifier : DBSNPE003656
Drug : DB00440 (Trimethoprim)
Interacting Gene/Enzyme : Glucose-6-phosphate 1-dehydrogenase
Gene Name : G6PD
UniProt ID : P11413
Allele Name : Suwalki
Genotype(s) : Not Available
Type(s) : ADR Inferred
Groups : G6PD deficiency
Description : Increased risk of dose-related hemolysis.
References :
- Bacdivim™[package insert]. Philadelphia, Pennysylvania: Mutual Pharmaceutical Company; 2013. [Link]
PMID: 19141530
Trimethoprim
Product: Tirasemtiv
Identifier : DBSNPE003657
Drug : DB00440 (Trimethoprim)
Interacting Gene/Enzyme : Glucose-6-phosphate 1-dehydrogenase
Gene Name : G6PD
UniProt ID : P11413
Allele Name : Riverside
Genotype(s) : Not Available
Type(s) : ADR Inferred
Groups : G6PD deficiency
Description : Increased risk of dose-related hemolysis.
References :
- Bacdivim™[package insert]. Philadelphia, Pennysylvania: Mutual Pharmaceutical Company; 2013. [Link]
PMID: 17585111
Trimethoprim
Product: CNX-2006
Identifier : DBSNPE003658
Drug : DB00440 (Trimethoprim)
Interacting Gene/Enzyme : Glucose-6-phosphate 1-dehydrogenase
Gene Name : G6PD
UniProt ID : P11413
Allele Name : Japan, Shinagawa
Genotype(s) : Not Available
Type(s) : ADR Inferred
Groups : G6PD deficiency
Description : Increased risk of dose-related hemolysis.
References :
- Bacdivim™[package insert]. Philadelphia, Pennysylvania: Mutual Pharmaceutical Company; 2013. [Link]
PMID: 17200208
Trimethoprim
Product: Tirapazamine
Identifier : DBSNPE003659
Drug : DB00440 (Trimethoprim)
Interacting Gene/Enzyme : Glucose-6-phosphate 1-dehydrogenase
Gene Name : G6PD
UniProt ID : P11413
Allele Name : Kawasaki
Genotype(s) : Not Available
Type(s) : ADR Inferred
Groups : G6PD deficiency
Description : Increased risk of dose-related hemolysis.
References :
- Bacdivim™[package insert]. Philadelphia, Pennysylvania: Mutual Pharmaceutical Company; 2013. [Link]
PMID: 10890901
Trimethoprim
Product: Rucaparib (phosphate)
Identifier : DBSNPE003660
Drug : DB00440 (Trimethoprim)
Interacting Gene/Enzyme : Glucose-6-phosphate 1-dehydrogenase
Gene Name : G6PD
UniProt ID : P11413
Allele Name : Munich
Genotype(s) : Not Available
Type(s) : ADR Inferred
Groups : G6PD deficiency
Description : Increased risk of dose-related hemolysis.
References :
- Bacdivim™[package insert]. Philadelphia, Pennysylvania: Mutual Pharmaceutical Company; 2013. [Link]
PMID: 9578319
Trimethoprim
Product: CGP 57380
Identifier : DBSNPE003661
Drug : DB00440 (Trimethoprim)
Interacting Gene/Enzyme : Glucose-6-phosphate 1-dehydrogenase
Gene Name : G6PD
UniProt ID : P11413
Allele Name : Georgia
Genotype(s) : Not Available
Type(s) : ADR Inferred
Groups : G6PD deficiency
Description : Increased risk of dose-related hemolysis.
References :
- Bacdivim™[package insert]. Philadelphia, Pennysylvania: Mutual Pharmaceutical Company; 2013. [Link]
PMID: 25132267
Trimethoprim
Product: Amifampridine
Identifier : DBSNPE003662
Drug : DB00440 (Trimethoprim)
Interacting Gene/Enzyme : Glucose-6-phosphate 1-dehydrogenase
Gene Name : G6PD
UniProt ID : P11413
Allele Name : Sumare
Genotype(s) : Not Available
Type(s) : ADR Inferred
Groups : G6PD deficiency
Description : Increased risk of dose-related hemolysis.
References :
- Bacdivim™[package insert]. Philadelphia, Pennysylvania: Mutual Pharmaceutical Company; 2013. [Link]
PMID: 26158764
Trimethoprim
Product: Miglustat (hydrochloride)
Identifier : DBSNPE003663
Drug : DB00440 (Trimethoprim)
Interacting Gene/Enzyme : Glucose-6-phosphate 1-dehydrogenase
Gene Name : G6PD
UniProt ID : P11413
Allele Name : Telti/Kobe
Genotype(s) : Not Available
Type(s) : ADR Inferred
Groups : G6PD deficiency
Description : Increased risk of dose-related hemolysis.
References :
- Bacdivim™[package insert]. Philadelphia, Pennysylvania: Mutual Pharmaceutical Company; 2013. [Link]
PMID: 26578881
Trimethoprim
Product: Miglustat
Identifier : DBSNPE003664
Drug : DB00440 (Trimethoprim)
Interacting Gene/Enzyme : Glucose-6-phosphate 1-dehydrogenase
Gene Name : G6PD
UniProt ID : P11413
Allele Name : Santiago de Cuba, Morioka
Genotype(s) : Not Available
Type(s) : ADR Inferred
Groups : G6PD deficiency
Description : Increased risk of dose-related hemolysis.
References :
- Bacdivim™[package insert]. Philadelphia, Pennysylvania: Mutual Pharmaceutical Company; 2013. [Link]
PMID: 24843732
Trimethoprim
Product: Piracetam
Identifier : DBSNPE003665
Drug : DB00440 (Trimethoprim)
Interacting Gene/Enzyme : Glucose-6-phosphate 1-dehydrogenase
Gene Name : G6PD
UniProt ID : P11413
Allele Name : Harima
Genotype(s) : Not Available
Type(s) : ADR Inferred
Groups : G6PD deficiency
Description : Increased risk of dose-related hemolysis.
References :
- Bacdivim™[package insert]. Philadelphia, Pennysylvania: Mutual Pharmaceutical Company; 2013. [Link]
PMID: 24430869
Trimethoprim
Product: Methylcobalamin
Identifier : DBSNPE003666
Drug : DB00440 (Trimethoprim)
Interacting Gene/Enzyme : Glucose-6-phosphate 1-dehydrogenase
Gene Name : G6PD
UniProt ID : P11413
Allele Name : Figuera da Foz
Genotype(s) : Not Available
Type(s) : ADR Inferred
Groups : G6PD deficiency
Description : Increased risk of dose-related hemolysis.
References :
- Bacdivim™[package insert]. Philadelphia, Pennysylvania: Mutual Pharmaceutical Company; 2013. [Link]
PMID: 23161610
Trimethoprim
Product: Travoprost
Identifier : DBSNPE003667
Drug : DB00440 (Trimethoprim)
Interacting Gene/Enzyme : Glucose-6-phosphate 1-dehydrogenase
Gene Name : G6PD
UniProt ID : P11413
Allele Name : Amiens
Genotype(s) : Not Available
Type(s) : ADR Inferred
Groups : G6PD deficiency
Description : Increased risk of dose-related hemolysis.
References :
- Bacdivim™[package insert]. Philadelphia, Pennysylvania: Mutual Pharmaceutical Company; 2013. [Link]
PMID: 23342115
Trimethoprim
Product: Nedaplatin
Identifier : DBSNPE003668
Drug : DB00440 (Trimethoprim)
Interacting Gene/Enzyme : Glucose-6-phosphate 1-dehydrogenase
Gene Name : G6PD
UniProt ID : P11413
Allele Name : Bangkok Noi
Genotype(s) : Not Available
Type(s) : ADR Inferred
Groups : G6PD deficiency
Description : Increased risk of dose-related hemolysis.
References :
- Bacdivim™[package insert]. Philadelphia, Pennysylvania: Mutual Pharmaceutical Company; 2013. [Link]
PMID: 23661004
Trimethoprim
Product: Reboxetine (mesylate)
Identifier : DBSNPE003669
Drug : DB00440 (Trimethoprim)
Interacting Gene/Enzyme : Glucose-6-phosphate 1-dehydrogenase
Gene Name : G6PD
UniProt ID : P11413
Allele Name : Fukaya
Genotype(s) : Not Available
Type(s) : ADR Inferred
Groups : G6PD deficiency
Description : Increased risk of dose-related hemolysis.
References :
- Bacdivim™[package insert]. Philadelphia, Pennysylvania: Mutual Pharmaceutical Company; 2013. [Link]
PMID: 21570948
Trimethoprim
Product: Dexrazoxane
Identifier : DBSNPE003670
Drug : DB00440 (Trimethoprim)
Interacting Gene/Enzyme : Glucose-6-phosphate 1-dehydrogenase
Gene Name : G6PD
UniProt ID : P11413
Allele Name : Campinas
Genotype(s) : Not Available
Type(s) : ADR Inferred
Groups : G6PD deficiency
Description : Increased risk of dose-related hemolysis.
References :
- Bacdivim™[package insert]. Philadelphia, Pennysylvania: Mutual Pharmaceutical Company; 2013. [Link]
PMID: 21486282
Trimethoprim
Product: Ruxolitinib (S enantiomer)
Identifier : DBSNPE003671
Drug : DB00440 (Trimethoprim)
Interacting Gene/Enzyme : Glucose-6-phosphate 1-dehydrogenase
Gene Name : G6PD
UniProt ID : P11413
Allele Name : Buenos Aires
Genotype(s) : Not Available
Type(s) : ADR Inferred
Groups : G6PD deficiency
Description : Increased risk of dose-related hemolysis.
References :
- Bacdivim™[package insert]. Philadelphia, Pennysylvania: Mutual Pharmaceutical Company; 2013. [Link]
PMID: 20085748
Trimethoprim
Product: Oprozomib
Identifier : DBSNPE003672
Drug : DB00440 (Trimethoprim)
Interacting Gene/Enzyme : Glucose-6-phosphate 1-dehydrogenase
Gene Name : G6PD
UniProt ID : P11413
Allele Name : Arakawa
Genotype(s) : Not Available
Type(s) : ADR Inferred
Groups : G6PD deficiency
Description : Increased risk of dose-related hemolysis.
References :
- Bacdivim™[package insert]. Philadelphia, Pennysylvania: Mutual Pharmaceutical Company; 2013. [Link]
PMID: 8135747
Trimethoprim
Product: VX-765
Identifier : DBSNPE003673
Drug : DB00440 (Trimethoprim)
Interacting Gene/Enzyme : Glucose-6-phosphate 1-dehydrogenase
Gene Name : G6PD
UniProt ID : P11413
Allele Name : Brighton
Genotype(s) : Not Available
Type(s) : ADR Inferred
Groups : G6PD deficiency
Description : Increased risk of dose-related hemolysis.
References :
- Bacdivim™[package insert]. Philadelphia, Pennysylvania: Mutual Pharmaceutical Company; 2013. [Link]
PMID: 1720546
Trimethoprim
Product: Vardenafil (hydrochloride)
Identifier : DBSNPE003674
Drug : DB00440 (Trimethoprim)
Interacting Gene/Enzyme : Glucose-6-phosphate 1-dehydrogenase
Gene Name : G6PD
UniProt ID : P11413
Allele Name : Kozukata
Genotype(s) : Not Available
Type(s) : ADR Inferred
Groups : G6PD deficiency
Description : Increased risk of dose-related hemolysis.
References :
- Bacdivim™[package insert]. Philadelphia, Pennysylvania: Mutual Pharmaceutical Company; 2013. [Link]
PMID: 18278858
Trimethoprim
Product: Ketorolac
Identifier : DBSNPE003675
Drug : DB00440 (Trimethoprim)
Interacting Gene/Enzyme : Glucose-6-phosphate 1-dehydrogenase
Gene Name : G6PD
UniProt ID : P11413
Allele Name : Amsterdam
Genotype(s) : Not Available
Type(s) : ADR Inferred
Groups : G6PD deficiency
Description : Increased risk of dose-related hemolysis.
References :
- Bacdivim™[package insert]. Philadelphia, Pennysylvania: Mutual Pharmaceutical Company; 2013. [Link]
PMID: 24650640
Trimethoprim
Product: Cyclosporin A
Identifier : DBSNPE003676
Drug : DB00440 (Trimethoprim)
Interacting Gene/Enzyme : Glucose-6-phosphate 1-dehydrogenase
Gene Name : G6PD
UniProt ID : P11413
Defining Change(s) :
- 202G->A, 376A->G, 1264C>G
Allele Name : No name
Genotype(s) : Not Available
Type(s) : ADR Inferred
Groups : G6PD deficiency
Description : Increased risk of dose-related hemolysis.
References :
- Bacdivim™[package insert]. Philadelphia, Pennysylvania: Mutual Pharmaceutical Company; 2013. [Link]
PMID: 22431203
Trimethoprim
Product: Loxoprofen
Identifier : DBSNPE003677
Drug : DB00440 (Trimethoprim)
Interacting Gene/Enzyme : Glucose-6-phosphate 1-dehydrogenase
Gene Name : G6PD
UniProt ID : P11413
Allele Name : Swansea
Genotype(s) : Not Available
Type(s) : ADR Inferred
Groups : G6PD deficiency
Description : Increased risk of dose-related hemolysis.
References :
- Bacdivim™[package insert]. Philadelphia, Pennysylvania: Mutual Pharmaceutical Company; 2013. [Link]
PMID: 22473614
Trimethoprim
Product: Latanoprost
Identifier : DBSNPE003678
Drug : DB00440 (Trimethoprim)
Interacting Gene/Enzyme : Glucose-6-phosphate 1-dehydrogenase
Gene Name : G6PD
UniProt ID : P11413
Allele Name : Urayasu
Genotype(s) : Not Available
Type(s) : ADR Inferred
Groups : G6PD deficiency
Description : Increased risk of dose-related hemolysis.
References :
- Bacdivim™[package insert]. Philadelphia, Pennysylvania: Mutual Pharmaceutical Company; 2013. [Link]
PMID: 9599239
Trimethoprim
Product: Catharanthine
Identifier : DBSNPE003679
Drug : DB00440 (Trimethoprim)
Interacting Gene/Enzyme : Glucose-6-phosphate 1-dehydrogenase
Gene Name : G6PD
UniProt ID : P11413
Allele Name : Vancouver
Genotype(s) : Not Available
Type(s) : ADR Inferred
Groups : G6PD deficiency
Description : Increased risk of dose-related hemolysis.
References :
- Bacdivim™[package insert]. Philadelphia, Pennysylvania: Mutual Pharmaceutical Company; 2013. [Link]
PMID: 9174343
Trimethoprim
Product: Trifluoperazine (dihydrochloride)
Identifier : DBSNPE003680
Drug : DB00440 (Trimethoprim)
Interacting Gene/Enzyme : Glucose-6-phosphate 1-dehydrogenase
Gene Name : G6PD
UniProt ID : P11413
Allele Name : Mt Sinai
Genotype(s) : Not Available
Type(s) : ADR Inferred
Groups : G6PD deficiency
Description : Increased risk of dose-related hemolysis.
References :
- Bacdivim™[package insert]. Philadelphia, Pennysylvania: Mutual Pharmaceutical Company; 2013. [Link]
PMID: 12217360
Trimethoprim
Product: Triflusal
Identifier : DBSNPE003681
Drug : DB00440 (Trimethoprim)
Interacting Gene/Enzyme : Glucose-6-phosphate 1-dehydrogenase
Gene Name : G6PD
UniProt ID : P11413
Allele Name : Plymouth
Genotype(s) : Not Available
Type(s) : ADR Inferred
Groups : G6PD deficiency
Description : Increased risk of dose-related hemolysis.
References :
- Bacdivim™[package insert]. Philadelphia, Pennysylvania: Mutual Pharmaceutical Company; 2013. [Link]
PMID: 7527393
Trimethoprim
Product: Azacyclonol
Identifier : DBSNPE003682
Drug : DB00440 (Trimethoprim)
Interacting Gene/Enzyme : Glucose-6-phosphate 1-dehydrogenase
Gene Name : G6PD
UniProt ID : P11413
Allele Name : Volendam
Genotype(s) : Not Available
Type(s) : ADR Inferred
Groups : G6PD deficiency
Description : Increased risk of dose-related hemolysis.
References :
- Bacdivim™[package insert]. Philadelphia, Pennysylvania: Mutual Pharmaceutical Company; 2013. [Link]
PMID: 25248068
Trimethoprim
Product: Azlocillin (sodium salt)
Identifier : DBSNPE003683
Drug : DB00440 (Trimethoprim)
Interacting Gene/Enzyme : Glucose-6-phosphate 1-dehydrogenase
Gene Name : G6PD
UniProt ID : P11413
Allele Name : Shinshu
Genotype(s) : Not Available
Type(s) : ADR Inferred
Groups : G6PD deficiency
Description : Increased risk of dose-related hemolysis.
References :
- Bacdivim™[package insert]. Philadelphia, Pennysylvania: Mutual Pharmaceutical Company; 2013. [Link]
PMID: 1422595
Trimethoprim
Product: Octopamine (hydrochloride)
Identifier : DBSNPE003684
Drug : DB00440 (Trimethoprim)
Interacting Gene/Enzyme : Glucose-6-phosphate 1-dehydrogenase
Gene Name : G6PD
UniProt ID : P11413
Allele Name : Chikugo
Genotype(s) : Not Available
Type(s) : ADR Inferred
Groups : G6PD deficiency
Description : Increased risk of dose-related hemolysis.
References :
- Bacdivim™[package insert]. Philadelphia, Pennysylvania: Mutual Pharmaceutical Company; 2013. [Link]
PMID: 2019998
Trimethoprim
Product: Amitriptyline (hydrochloride)
Identifier : DBSNPE003685
Drug : DB00440 (Trimethoprim)
Interacting Gene/Enzyme : Glucose-6-phosphate 1-dehydrogenase
Gene Name : G6PD
UniProt ID : P11413
Allele Name : Tsukui
Genotype(s) : Not Available
Type(s) : ADR Inferred
Groups : G6PD deficiency
Description : Increased risk of dose-related hemolysis.
References :
- Bacdivim™[package insert]. Philadelphia, Pennysylvania: Mutual Pharmaceutical Company; 2013. [Link]
PMID: 1963596
Trimethoprim
Product: Flumequine
Identifier : DBSNPE003686
Drug : DB00440 (Trimethoprim)
Interacting Gene/Enzyme : Glucose-6-phosphate 1-dehydrogenase
Gene Name : G6PD
UniProt ID : P11413
Allele Name : Pedoplis-Ckaro
Genotype(s) : Not Available
Type(s) : ADR Inferred
Groups : G6PD deficiency
Description : Increased risk of dose-related hemolysis.
References :
- Bacdivim™[package insert]. Philadelphia, Pennysylvania: Mutual Pharmaceutical Company; 2013. [Link]
PMID: 11341365
Trimethoprim
Product: Carbenicillin
Identifier : DBSNPE003687
Drug : DB00440 (Trimethoprim)
Interacting Gene/Enzyme : Glucose-6-phosphate 1-dehydrogenase
Gene Name : G6PD
UniProt ID : P11413
Allele Name : Santiago
Genotype(s) : Not Available
Type(s) : ADR Inferred
Groups : G6PD deficiency
Description : Increased risk of dose-related hemolysis.
References :
- Bacdivim™[package insert]. Philadelphia, Pennysylvania: Mutual Pharmaceutical Company; 2013. [Link]
PMID: 8981565
Trimethoprim
Product: Betahistine (dihydrochloride)
Identifier : DBSNPE003688
Drug : DB00440 (Trimethoprim)
Interacting Gene/Enzyme : Glucose-6-phosphate 1-dehydrogenase
Gene Name : G6PD
UniProt ID : P11413
Allele Name : Minnesota, Marion, Gastonia, LeJeune
Genotype(s) : Not Available
Type(s) : ADR Inferred
Groups : G6PD deficiency
Description : Increased risk of dose-related hemolysis.
References :
- Bacdivim™[package insert]. Philadelphia, Pennysylvania: Mutual Pharmaceutical Company; 2013. [Link]
PMID: 1691785
Trimethoprim
Product: Anagrelide (hydrochloride)
Identifier : DBSNPE003689
Drug : DB00440 (Trimethoprim)
Interacting Gene/Enzyme : Glucose-6-phosphate 1-dehydrogenase
Gene Name : G6PD
UniProt ID : P11413
Allele Name : Cincinnati
Genotype(s) : Not Available
Type(s) : ADR Inferred
Groups : G6PD deficiency
Description : Increased risk of dose-related hemolysis.
References :
- Bacdivim™[package insert]. Philadelphia, Pennysylvania: Mutual Pharmaceutical Company; 2013. [Link]
PMID: 19168056
Trimethoprim
Product: Ampicillin (sodium)
Identifier : DBSNPE003690
Drug : DB00440 (Trimethoprim)
Interacting Gene/Enzyme : Glucose-6-phosphate 1-dehydrogenase
Gene Name : G6PD
UniProt ID : P11413
Allele Name : Harilaou
Genotype(s) : Not Available
Type(s) : ADR Inferred
Groups : G6PD deficiency
Description : Increased risk of dose-related hemolysis.
References :
- Bacdivim™[package insert]. Philadelphia, Pennysylvania: Mutual Pharmaceutical Company; 2013. [Link]
PMID: 18481916
Trimethoprim
Product: Ampicillin
Identifier : DBSNPE003691
Drug : DB00440 (Trimethoprim)
Interacting Gene/Enzyme : Glucose-6-phosphate 1-dehydrogenase
Gene Name : G6PD
UniProt ID : P11413
Allele Name : North Dallas
Genotype(s) : Not Available
Type(s) : ADR Inferred
Groups : G6PD deficiency
Description : Increased risk of dose-related hemolysis.
References :
- Bacdivim™[package insert]. Philadelphia, Pennysylvania: Mutual Pharmaceutical Company; 2013. [Link]
PMID: 10069534
Trimethoprim
Product: Altrenogest
Identifier : DBSNPE003692
Drug : DB00440 (Trimethoprim)
Interacting Gene/Enzyme : Glucose-6-phosphate 1-dehydrogenase
Gene Name : G6PD
UniProt ID : P11413
Allele Name : Asahikawa
Genotype(s) : Not Available
Type(s) : ADR Inferred
Groups : G6PD deficiency
Description : Increased risk of dose-related hemolysis.
References :
- Bacdivim™[package insert]. Philadelphia, Pennysylvania: Mutual Pharmaceutical Company; 2013. [Link]
PMID: 1346637
Trimethoprim
Product: Galanthaminone
Identifier : DBSNPE003693
Drug : DB00440 (Trimethoprim)
Interacting Gene/Enzyme : Glucose-6-phosphate 1-dehydrogenase
Gene Name : G6PD
UniProt ID : P11413
Allele Name : Durham
Genotype(s) : Not Available
Type(s) : ADR Inferred
Groups : G6PD deficiency
Description : Increased risk of dose-related hemolysis.
References :
- Bacdivim™[package insert]. Philadelphia, Pennysylvania: Mutual Pharmaceutical Company; 2013. [Link]
PMID: 8449241
Trimethoprim
Product: Benztropine (mesylate)
Identifier : DBSNPE003694
Drug : DB00440 (Trimethoprim)
Interacting Gene/Enzyme : Glucose-6-phosphate 1-dehydrogenase
Gene Name : G6PD
UniProt ID : P11413
Allele Name : Stonybrook
Genotype(s) : Not Available
Type(s) : ADR Inferred
Groups : G6PD deficiency
Description : Increased risk of dose-related hemolysis.
References :
- Bacdivim™[package insert]. Philadelphia, Pennysylvania: Mutual Pharmaceutical Company; 2013. [Link]
PMID: 1920350
Trimethoprim
Product: Tylosin (tartrate)
Identifier : DBSNPE003695
Drug : DB00440 (Trimethoprim)
Interacting Gene/Enzyme : Glucose-6-phosphate 1-dehydrogenase
Gene Name : G6PD
UniProt ID : P11413
Allele Name : Wayne
Genotype(s) : Not Available
Type(s) : ADR Inferred
Groups : G6PD deficiency
Description : Increased risk of dose-related hemolysis.
References :
- Bacdivim™[package insert]. Philadelphia, Pennysylvania: Mutual Pharmaceutical Company; 2013. [Link]
PMID: 10205015
Trimethoprim
Product: Solifenacin (hydrochloride)
Identifier : DBSNPE003696
Drug : DB00440 (Trimethoprim)
Interacting Gene/Enzyme : Glucose-6-phosphate 1-dehydrogenase
Gene Name : G6PD
UniProt ID : P11413
Allele Name : Aveiro
Genotype(s) : Not Available
Type(s) : ADR Inferred
Groups : G6PD deficiency
Description : Increased risk of dose-related hemolysis.
References :
- Bacdivim™[package insert]. Philadelphia, Pennysylvania: Mutual Pharmaceutical Company; 2013. [Link]
PMID: 8200421
Trimethoprim
Product: Desloratadine
Identifier : DBSNPE003697
Drug : DB00440 (Trimethoprim)
Interacting Gene/Enzyme : Glucose-6-phosphate 1-dehydrogenase
Gene Name : G6PD
UniProt ID : P11413
Allele Name : Cleveland Corum
Genotype(s) : Not Available
Type(s) : ADR Inferred
Groups : G6PD deficiency
Description : Increased risk of dose-related hemolysis.
References :
- Bacdivim™[package insert]. Philadelphia, Pennysylvania: Mutual Pharmaceutical Company; 2013. [Link]
PMID: 7350532
Trimethoprim
Product: Pemirolast (potassium)
Identifier : DBSNPE003698
Drug : DB00440 (Trimethoprim)
Interacting Gene/Enzyme : Glucose-6-phosphate 1-dehydrogenase
Gene Name : G6PD
UniProt ID : P11413
Allele Name : Lille
Genotype(s) : Not Available
Type(s) : ADR Inferred
Groups : G6PD deficiency
Description : Increased risk of dose-related hemolysis.
References :
- Bacdivim™[package insert]. Philadelphia, Pennysylvania: Mutual Pharmaceutical Company; 2013. [Link]
PMID: 27080256
Trimethoprim
Product: Pentamidine (dihydrochloride)
Identifier : DBSNPE003699
Drug : DB00440 (Trimethoprim)
Interacting Gene/Enzyme : Glucose-6-phosphate 1-dehydrogenase
Gene Name : G6PD
UniProt ID : P11413
Allele Name : Bangkok
Genotype(s) : Not Available
Type(s) : ADR Inferred
Groups : G6PD deficiency
Description : Increased risk of dose-related hemolysis.
References :
- Bacdivim™[package insert]. Philadelphia, Pennysylvania: Mutual Pharmaceutical Company; 2013. [Link]
PMID: 25482946
Trimethoprim
Product: Pentamidine
Identifier : DBSNPE003700
Drug : DB00440 (Trimethoprim)
Interacting Gene/Enzyme : Glucose-6-phosphate 1-dehydrogenase
Gene Name : G6PD
UniProt ID : P11413
Allele Name : Sugao
Genotype(s) : Not Available
Type(s) : ADR Inferred
Groups : G6PD deficiency
Description : Increased risk of dose-related hemolysis.
References :
- Bacdivim™[package insert]. Philadelphia, Pennysylvania: Mutual Pharmaceutical Company; 2013. [Link]
PMID: 1868879
Trimethoprim
Product: Clinafloxacin
Identifier : DBSNPE003701
Drug : DB00440 (Trimethoprim)
Interacting Gene/Enzyme : Glucose-6-phosphate 1-dehydrogenase
Gene Name : G6PD
UniProt ID : P11413
Allele Name : La Jolla
Genotype(s) : Not Available
Type(s) : ADR Inferred
Groups : G6PD deficiency
Description : Increased risk of dose-related hemolysis.
References :
- Bacdivim™[package insert]. Philadelphia, Pennysylvania: Mutual Pharmaceutical Company; 2013. [Link]
PMID: 2776837
Trimethoprim
Product: Ethambutol (dihydrochloride)
Identifier : DBSNPE003702
Drug : DB00440 (Trimethoprim)
Interacting Gene/Enzyme : Glucose-6-phosphate 1-dehydrogenase
Gene Name : G6PD
UniProt ID : P11413
Allele Name : Wexham
Genotype(s) : Not Available
Type(s) : ADR Inferred
Groups : G6PD deficiency
Description : Increased risk of dose-related hemolysis.
References :
- Bacdivim™[package insert]. Philadelphia, Pennysylvania: Mutual Pharmaceutical Company; 2013. [Link]
PMID: 4029260
Trimethoprim
Product: Ethambutol
Identifier : DBSNPE003704
Drug : DB00440 (Trimethoprim)
Interacting Gene/Enzyme : Glucose-6-phosphate 1-dehydrogenase
Gene Name : G6PD
UniProt ID : P11413
Allele Name : West Virginia
Genotype(s) : Not Available
Type(s) : ADR Inferred
Groups : G6PD deficiency
Description : Increased risk of dose-related hemolysis.
References :
- Bacdivim™[package insert]. Philadelphia, Pennysylvania: Mutual Pharmaceutical Company; 2013. [Link]
PMID: 19407080
Trimethoprim
Product: Moclobemide
Identifier : DBSNPE003705
Drug : DB00440 (Trimethoprim)
Interacting Gene/Enzyme : Glucose-6-phosphate 1-dehydrogenase
Gene Name : G6PD
UniProt ID : P11413
Allele Name : Omiya
Genotype(s) : Not Available
Type(s) : ADR Inferred
Groups : G6PD deficiency
Description : Increased risk of dose-related hemolysis.
References :
- Bacdivim™[package insert]. Philadelphia, Pennysylvania: Mutual Pharmaceutical Company; 2013. [Link]
PMID: 25452146
Trimethoprim
Product: Amidopyrine
Identifier : DBSNPE003706
Drug : DB00440 (Trimethoprim)
Interacting Gene/Enzyme : Glucose-6-phosphate 1-dehydrogenase
Gene Name : G6PD
UniProt ID : P11413
Defining Change(s) :
- 953_976delCCACCAAAGGGTACCTGGAC GACC
Allele Name : Nara
Genotype(s) : Not Available
Type(s) : ADR Inferred
Groups : G6PD deficiency
Description : Increased risk of dose-related hemolysis.
References :
- Bacdivim™[package insert]. Philadelphia, Pennysylvania: Mutual Pharmaceutical Company; 2013. [Link]
PMID: 20156687
Trimethoprim
Product: R-(-)-Deprenyl (hydrochloride)
Identifier : DBSNPE003707
Drug : DB00440 (Trimethoprim)
Interacting Gene/Enzyme : Glucose-6-phosphate 1-dehydrogenase
Gene Name : G6PD
UniProt ID : P11413
Allele Name : Manhattan
Genotype(s) : Not Available
Type(s) : ADR Inferred
Groups : G6PD deficiency
Description : Increased risk of dose-related hemolysis.
References :
- Bacdivim™[package insert]. Philadelphia, Pennysylvania: Mutual Pharmaceutical Company; 2013. [Link]
PMID: 26862589
Trimethoprim
Product: Doxorubicin
Identifier : DBSNPE003708
Drug : DB00440 (Trimethoprim)
Interacting Gene/Enzyme : Glucose-6-phosphate 1-dehydrogenase
Gene Name : G6PD
UniProt ID : P11413
Allele Name : Rehevot
Genotype(s) : Not Available
Type(s) : ADR Inferred
Groups : G6PD deficiency
Description : Increased risk of dose-related hemolysis.
References :
- Bacdivim™[package insert]. Philadelphia, Pennysylvania: Mutual Pharmaceutical Company; 2013. [Link]
PMID: 2924082
Trimethoprim
Product: Vigabatrin (Hydrochloride)
Identifier : DBSNPE003709
Drug : DB00440 (Trimethoprim)
Interacting Gene/Enzyme : Glucose-6-phosphate 1-dehydrogenase
Gene Name : G6PD
UniProt ID : P11413
Allele Name : Honiara
Genotype(s) : Not Available
Type(s) : ADR Inferred
Groups : G6PD deficiency
Description : Increased risk of dose-related hemolysis.
References :
- Bacdivim™[package insert]. Philadelphia, Pennysylvania: Mutual Pharmaceutical Company; 2013. [Link]
PMID: 3896364
Trimethoprim
Product: U-73122
Identifier : DBSNPE003710
Drug : DB00440 (Trimethoprim)
Interacting Gene/Enzyme : Glucose-6-phosphate 1-dehydrogenase
Gene Name : G6PD
UniProt ID : P11413
Allele Name : Tokyo, Fukushima
Genotype(s) : Not Available
Type(s) : ADR Inferred
Groups : G6PD deficiency
Description : Increased risk of dose-related hemolysis.
References :
- Bacdivim™[package insert]. Philadelphia, Pennysylvania: Mutual Pharmaceutical Company; 2013. [Link]
PMID: 15723094
Trimethoprim
Product: SB-334867 (free base)
Identifier : DBSNPE003711
Drug : DB00440 (Trimethoprim)
Interacting Gene/Enzyme : Glucose-6-phosphate 1-dehydrogenase
Gene Name : G6PD
UniProt ID : P11413
Allele Name : Chatham
Genotype(s) : Not Available
Type(s) : ADR Inferred
Groups : G6PD deficiency
Description : Increased risk of dose-related hemolysis.
References :
- Bacdivim™[package insert]. Philadelphia, Pennysylvania: Mutual Pharmaceutical Company; 2013. [Link]
PMID: 7714776
Trimethoprim
Product: Mc-MMAE
Identifier : DBSNPE003712
Drug : DB00440 (Trimethoprim)
Interacting Gene/Enzyme : Glucose-6-phosphate 1-dehydrogenase
Gene Name : G6PD
UniProt ID : P11413
Allele Name : Fushan
Genotype(s) : Not Available
Type(s) : ADR Inferred
Groups : G6PD deficiency
Description : Increased risk of dose-related hemolysis.
References :
- Bacdivim™[package insert]. Philadelphia, Pennysylvania: Mutual Pharmaceutical Company; 2013. [Link]
PMID: 3754610
Trimethoprim
Product: Y-320
Identifier : DBSNPE003713
Drug : DB00440 (Trimethoprim)
Interacting Gene/Enzyme : Glucose-6-phosphate 1-dehydrogenase
Gene Name : G6PD
UniProt ID : P11413
Allele Name : Partenope
Genotype(s) : Not Available
Type(s) : ADR Inferred
Groups : G6PD deficiency
Description : Increased risk of dose-related hemolysis.
References :
- Bacdivim™[package insert]. Philadelphia, Pennysylvania: Mutual Pharmaceutical Company; 2013. [Link]
PMID: 24377382
Trimethoprim
Product: VGX-1027
Identifier : DBSNPE003714
Drug : DB00440 (Trimethoprim)
Interacting Gene/Enzyme : Glucose-6-phosphate 1-dehydrogenase
Gene Name : G6PD
UniProt ID : P11413
Allele Name : Ierapediva
Genotype(s) : Not Available
Type(s) : ADR Inferred
Groups : G6PD deficiency
Description : Increased risk of dose-related hemolysis.
References :
- Bacdivim™[package insert]. Philadelphia, Pennysylvania: Mutual Pharmaceutical Company; 2013. [Link]
PMID: 19429792
Trimethoprim
Product: WP1066
Identifier : DBSNPE003715
Drug : DB00440 (Trimethoprim)
Interacting Gene/Enzyme : Glucose-6-phosphate 1-dehydrogenase
Gene Name : G6PD
UniProt ID : P11413
Allele Name : Anadia
Genotype(s) : Not Available
Type(s) : ADR Inferred
Groups : G6PD deficiency
Description : Increased risk of dose-related hemolysis.
References :
- Bacdivim™[package insert]. Philadelphia, Pennysylvania: Mutual Pharmaceutical Company; 2013. [Link]
PMID: 19111597
Trimethoprim
Product: SGI-1027
Identifier : DBSNPE003716
Drug : DB00440 (Trimethoprim)
Interacting Gene/Enzyme : Glucose-6-phosphate 1-dehydrogenase
Gene Name : G6PD
UniProt ID : P11413
Allele Name : Abeno
Genotype(s) : Not Available
Type(s) : ADR Inferred
Groups : G6PD deficiency
Description : Increased risk of dose-related hemolysis.
References :
- Bacdivim™[package insert]. Philadelphia, Pennysylvania: Mutual Pharmaceutical Company; 2013. [Link]
PMID: 7616446
Trimethoprim
Product: Naftifine (hydrochloride)
Identifier : DBSNPE003717
Drug : DB00440 (Trimethoprim)
Interacting Gene/Enzyme : Glucose-6-phosphate 1-dehydrogenase
Gene Name : G6PD
UniProt ID : P11413
Allele Name : Surabaya
Genotype(s) : Not Available
Type(s) : ADR Inferred
Groups : G6PD deficiency
Description : Increased risk of dose-related hemolysis.
References :
- Bacdivim™[package insert]. Philadelphia, Pennysylvania: Mutual Pharmaceutical Company; 2013. [Link]
PMID: 1941609
Trimethoprim
Product: Mepivacaine (hydrochloride)
Identifier : DBSNPE003718
Drug : DB00440 (Trimethoprim)
Interacting Gene/Enzyme : Glucose-6-phosphate 1-dehydrogenase
Gene Name : G6PD
UniProt ID : P11413
Allele Name : Pawnee
Genotype(s) : Not Available
Type(s) : ADR Inferred
Groups : G6PD deficiency
Description : Increased risk of dose-related hemolysis.
References :
- Bacdivim™[package insert]. Philadelphia, Pennysylvania: Mutual Pharmaceutical Company; 2013. [Link]
PMID: 2040358
Trimethoprim
Product: Articaine (hydrochloride)
Identifier : DBSNPE003719
Drug : DB00440 (Trimethoprim)
Interacting Gene/Enzyme : Glucose-6-phosphate 1-dehydrogenase
Gene Name : G6PD
UniProt ID : P11413
Allele Name : S. Antioco
Genotype(s) : Not Available
Type(s) : ADR Inferred
Groups : G6PD deficiency
Description : Increased risk of dose-related hemolysis.
References :
- Bacdivim™[package insert]. Philadelphia, Pennysylvania: Mutual Pharmaceutical Company; 2013. [Link]
PMID: 1994002
Trimethoprim
Product: Ibandronate (Sodium)
Identifier : DBSNPE003720
Drug : DB00440 (Trimethoprim)
Interacting Gene/Enzyme : Glucose-6-phosphate 1-dehydrogenase
Gene Name : G6PD
UniProt ID : P11413
Allele Name : Cassano
Genotype(s) : Not Available
Type(s) : ADR Inferred
Groups : G6PD deficiency
Description : Increased risk of dose-related hemolysis.
References :
- Bacdivim™[package insert]. Philadelphia, Pennysylvania: Mutual Pharmaceutical Company; 2013. [Link]
PMID: 2806372
Trimethoprim
Product: Ibandronic acid
Identifier : DBSNPE003721
Drug : DB00440 (Trimethoprim)
Interacting Gene/Enzyme : Glucose-6-phosphate 1-dehydrogenase
Gene Name : G6PD
UniProt ID : P11413
Allele Name : Hermoupolis
Genotype(s) : Not Available
Type(s) : ADR Inferred
Groups : G6PD deficiency
Description : Increased risk of dose-related hemolysis.
References :
- Bacdivim™[package insert]. Philadelphia, Pennysylvania: Mutual Pharmaceutical Company; 2013. [Link]
PMID: 3814912
Trimethoprim
Product: Ibandronate (Sodium Monohydrate)
Identifier : DBSNPE003722
Drug : DB00440 (Trimethoprim)
Interacting Gene/Enzyme : Glucose-6-phosphate 1-dehydrogenase
Gene Name : G6PD
UniProt ID : P11413
Allele Name : Union,Maewo, Chinese-2, Kalo
Genotype(s) : Not Available
Type(s) : ADR Inferred
Groups : G6PD deficiency
Description : Increased risk of dose-related hemolysis.
References :
- Bacdivim™[package insert]. Philadelphia, Pennysylvania: Mutual Pharmaceutical Company; 2013. [Link]
PMID: 14993104
Trimethoprim
Product: Hexamethylenetetramine
Identifier : DBSNPE003723
Drug : DB00440 (Trimethoprim)
Interacting Gene/Enzyme : Glucose-6-phosphate 1-dehydrogenase
Gene Name : G6PD
UniProt ID : P11413
Allele Name : Andalus
Genotype(s) : Not Available
Type(s) : ADR Inferred
Groups : G6PD deficiency
Description : Increased risk of dose-related hemolysis.
References :
- Bacdivim™[package insert]. Philadelphia, Pennysylvania: Mutual Pharmaceutical Company; 2013. [Link]
PMID: 12540494
Trimethoprim
Product: Methylthiouracil
Identifier : DBSNPE003724
Drug : DB00440 (Trimethoprim)
Interacting Gene/Enzyme : Glucose-6-phosphate 1-dehydrogenase
Gene Name : G6PD
UniProt ID : P11413
Allele Name : Cosenza
Genotype(s) : Not Available
Type(s) : ADR Inferred
Groups : G6PD deficiency
Description : Increased risk of dose-related hemolysis.
References :
- Bacdivim™[package insert]. Philadelphia, Pennysylvania: Mutual Pharmaceutical Company; 2013. [Link]
PMID: 8112383
Trimethoprim
Product: Sulfamerazine (sodium salt)
Identifier : DBSNPE003725
Drug : DB00440 (Trimethoprim)
Interacting Gene/Enzyme : Glucose-6-phosphate 1-dehydrogenase
Gene Name : G6PD
UniProt ID : P11413
Allele Name : Canton, Taiwan- Hakka, Gifu-like, Agrigento-like
Genotype(s) : Not Available
Type(s) : ADR Inferred
Groups : G6PD deficiency
Description : Increased risk of dose-related hemolysis.
References :
- Bacdivim™[package insert]. Philadelphia, Pennysylvania: Mutual Pharmaceutical Company; 2013. [Link]
PMID: 8112384
Trimethoprim
Product: Sulfamerazine
Identifier : DBSNPE003726
Drug : DB00440 (Trimethoprim)
Interacting Gene/Enzyme : Glucose-6-phosphate 1-dehydrogenase
Gene Name : G6PD
UniProt ID : P11413
Allele Name : Flores
Genotype(s) : Not Available
Type(s) : ADR Inferred
Groups : G6PD deficiency
Description : Increased risk of dose-related hemolysis.
References :
- Bacdivim™[package insert]. Philadelphia, Pennysylvania: Mutual Pharmaceutical Company; 2013. [Link]
PMID: 10819171
Trimethoprim
Product: Biotin
Identifier : DBSNPE003727
Drug : DB00440 (Trimethoprim)
Interacting Gene/Enzyme : Glucose-6-phosphate 1-dehydrogenase
Gene Name : G6PD
UniProt ID : P11413
Allele Name : Kaiping, Anant, Dhon, Sapporo-like, Wosera
Genotype(s) : Not Available
Type(s) : ADR Inferred
Groups : G6PD deficiency
Description : Increased risk of dose-related hemolysis.
References :
- Bacdivim™[package insert]. Philadelphia, Pennysylvania: Mutual Pharmaceutical Company; 2013. [Link]
PMID: 10632066
Trimethoprim
Product: Trimethoprim
Identifier : DBSNPE003728
Drug : DB00440 (Trimethoprim)
Interacting Gene/Enzyme : Glucose-6-phosphate 1-dehydrogenase
Gene Name : G6PD
UniProt ID : P11413
Allele Name : Kamogawa
Genotype(s) : Not Available
Type(s) : ADR Inferred
Groups : G6PD deficiency
Description : Increased risk of dose-related hemolysis.
References :
- Bacdivim™[package insert]. Philadelphia, Pennysylvania: Mutual Pharmaceutical Company; 2013. [Link]
PMID: 12359634
Trimethoprim
Product: Ornidazole
Identifier : DBSNPE003729
Drug : DB00440 (Trimethoprim)
Interacting Gene/Enzyme : Glucose-6-phosphate 1-dehydrogenase
Gene Name : G6PD
UniProt ID : P11413
Allele Name : Costanzo
Genotype(s) : Not Available
Type(s) : ADR Inferred
Groups : G6PD deficiency
Description : Increased risk of dose-related hemolysis.
References :
- Bacdivim™[package insert]. Philadelphia, Pennysylvania: Mutual Pharmaceutical Company; 2013. [Link]
PMID: 10188786
Trimethoprim
Product: Sulfathiazole (sodium)
Identifier : DBSNPE003730
Drug : DB00440 (Trimethoprim)
Interacting Gene/Enzyme : Glucose-6-phosphate 1-dehydrogenase
Gene Name : G6PD
UniProt ID : P11413
Allele Name : Amazonia
Genotype(s) : Not Available
Type(s) : ADR Inferred
Groups : G6PD deficiency
Description : Increased risk of dose-related hemolysis.
References :
- Bacdivim™[package insert]. Philadelphia, Pennysylvania: Mutual Pharmaceutical Company; 2013. [Link]
PMID: 8566131
Trimethoprim
Product: Sulfathiazole
Identifier : DBSNPE003731
Drug : DB00440 (Trimethoprim)
Interacting Gene/Enzyme : Glucose-6-phosphate 1-dehydrogenase
Gene Name : G6PD
UniProt ID : P11413
Allele Name : Songklanagarind
Genotype(s) : Not Available
Type(s) : ADR Inferred
Groups : G6PD deficiency
Description : Increased risk of dose-related hemolysis.
References :
- Bacdivim™[package insert]. Philadelphia, Pennysylvania: Mutual Pharmaceutical Company; 2013. [Link]
PMID: 12086495
Trimethoprim
Product: Nadifloxacin
Identifier : DBSNPE003732
Drug : DB00440 (Trimethoprim)
Interacting Gene/Enzyme : Glucose-6-phosphate 1-dehydrogenase
Gene Name : G6PD
UniProt ID : P11413
Allele Name : Hechi
Genotype(s) : Not Available
Type(s) : ADR Inferred
Groups : G6PD deficiency
Description : Increased risk of dose-related hemolysis.
References :
- Bacdivim™[package insert]. Philadelphia, Pennysylvania: Mutual Pharmaceutical Company; 2013. [Link]
PMID: 10556681
Trimethoprim
Product: Moguisteine
Identifier : DBSNPE003733
Drug : DB00440 (Trimethoprim)
Interacting Gene/Enzyme : Glucose-6-phosphate 1-dehydrogenase
Gene Name : G6PD
UniProt ID : P11413
Allele Name : Namouru
Genotype(s) : Not Available
Type(s) : ADR Inferred
Groups : G6PD deficiency
Description : Increased risk of dose-related hemolysis.
References :
- Bacdivim™[package insert]. Philadelphia, Pennysylvania: Mutual Pharmaceutical Company; 2013. [Link]
PMID: 9873472
Trimethoprim
Product: Creatinine
Identifier : DBSNPE003735
Drug : DB00440 (Trimethoprim)
Interacting Gene/Enzyme : Glucose-6-phosphate 1-dehydrogenase
Gene Name : G6PD
UniProt ID : P11413
Defining Change(s) :
- 375G->T, 379G->T383T->C384C>T
Allele Name : Crispim
Genotype(s) : Not Available
Type(s) : ADR Inferred
Groups : G6PD deficiency
Description : Increased risk of dose-related hemolysis.
References :
- Bacdivim™[package insert]. Philadelphia, Pennysylvania: Mutual Pharmaceutical Company; 2013. [Link]
PMID: 7905771
Trimethoprim
Product: 2-Thiouracil
Identifier : DBSNPE003736
Drug : DB00440 (Trimethoprim)
Interacting Gene/Enzyme : Glucose-6-phosphate 1-dehydrogenase
Gene Name : G6PD
UniProt ID : P11413
Allele Name : Acrokorinthos
Genotype(s) : Not Available
Type(s) : ADR Inferred
Groups : G6PD deficiency
Description : Increased risk of dose-related hemolysis.
References :
- Bacdivim™[package insert]. Philadelphia, Pennysylvania: Mutual Pharmaceutical Company; 2013. [Link]
PMID: 2250662
Trimethoprim
Product: Enrofloxacin
Identifier : DBSNPE003737
Drug : DB00440 (Trimethoprim)
Interacting Gene/Enzyme : Glucose-6-phosphate 1-dehydrogenase
Gene Name : G6PD
UniProt ID : P11413
Allele Name : Santa Maria
Genotype(s) : Not Available
Type(s) : ADR Inferred
Groups : G6PD deficiency
Description : Increased risk of dose-related hemolysis.
References :
- Bacdivim™[package insert]. Philadelphia, Pennysylvania: Mutual Pharmaceutical Company; 2013. [Link]
PMID: 23092925
Trimethoprim
Product: Danofloxacin (mesylate)
Identifier : DBSNPE003738
Drug : DB00440 (Trimethoprim)
Interacting Gene/Enzyme : Glucose-6-phosphate 1-dehydrogenase
Gene Name : G6PD
UniProt ID : P11413
Allele Name : Ananindeua
Genotype(s) : Not Available
Type(s) : ADR Inferred
Groups : G6PD deficiency
Description : Increased risk of dose-related hemolysis.
References :
- Bacdivim™[package insert]. Philadelphia, Pennysylvania: Mutual Pharmaceutical Company; 2013. [Link]
PMID: 18059262
Trimethoprim
Product: Alverine (citrate)
Identifier : DBSNPE003739
Drug : DB00440 (Trimethoprim)
Interacting Gene/Enzyme : Glucose-6-phosphate 1-dehydrogenase
Gene Name : G6PD
UniProt ID : P11413
Allele Name : Vanua Lava
Genotype(s) : Not Available
Type(s) : ADR Inferred
Groups : G6PD deficiency
Description : Increased risk of dose-related hemolysis.
References :
- Bacdivim™[package insert]. Philadelphia, Pennysylvania: Mutual Pharmaceutical Company; 2013. [Link]
PMID: 18772318
Trimethoprim
Product: Otilonium (bromide)
Identifier : DBSNPE003740
Drug : DB00440 (Trimethoprim)
Interacting Gene/Enzyme : Glucose-6-phosphate 1-dehydrogenase
Gene Name : G6PD
UniProt ID : P11413
Allele Name : Valladolid
Genotype(s) : Not Available
Type(s) : ADR Inferred
Groups : G6PD deficiency
Description : Increased risk of dose-related hemolysis.
References :
- Bacdivim™[package insert]. Philadelphia, Pennysylvania: Mutual Pharmaceutical Company; 2013. [Link]
PMID: 19438238
Trimethoprim
Product: Bismuth Subsalicylate
Identifier : DBSNPE003741
Drug : DB00440 (Trimethoprim)
Interacting Gene/Enzyme : Glucose-6-phosphate 1-dehydrogenase
Gene Name : G6PD
UniProt ID : P11413
Allele Name : Belem
Genotype(s) : Not Available
Type(s) : ADR Inferred
Groups : G6PD deficiency
Description : Increased risk of dose-related hemolysis.
References :
- Bacdivim™[package insert]. Philadelphia, Pennysylvania: Mutual Pharmaceutical Company; 2013. [Link]
PMID: 20004578
Trimethoprim
Product: Flavoxate (hydrochloride)
Identifier : DBSNPE003742
Drug : DB00440 (Trimethoprim)
Interacting Gene/Enzyme : Glucose-6-phosphate 1-dehydrogenase
Gene Name : G6PD
UniProt ID : P11413
Allele Name : Liuzhou
Genotype(s) : Not Available
Type(s) : ADR Inferred
Groups : G6PD deficiency
Description : Increased risk of dose-related hemolysis.
References :
- Bacdivim™[package insert]. Philadelphia, Pennysylvania: Mutual Pharmaceutical Company; 2013. [Link]
PMID: 20801651
Trimethoprim
Product: Hydroxyzine (dihydrochloride)
Identifier : DBSNPE003743
Drug : DB00440 (Trimethoprim)
Interacting Gene/Enzyme : Glucose-6-phosphate 1-dehydrogenase
Gene Name : G6PD
UniProt ID : P11413
Allele Name : Shenzen
Genotype(s) : Not Available
Type(s) : ADR Inferred
Groups : G6PD deficiency
Description : Increased risk of dose-related hemolysis.
References :
- Bacdivim™[package insert]. Philadelphia, Pennysylvania: Mutual Pharmaceutical Company; 2013. [Link]
PMID: 24368842
Trimethoprim
Product: Hydroxyzine
Identifier : DBSNPE003744
Drug : DB00440 (Trimethoprim)
Interacting Gene/Enzyme : Glucose-6-phosphate 1-dehydrogenase
Gene Name : G6PD
UniProt ID : P11413
Allele Name : Taipei “Chinese- 3”
Genotype(s) : Not Available
Type(s) : ADR Inferred
Groups : G6PD deficiency
Description : Increased risk of dose-related hemolysis.
References :
- Bacdivim™[package insert]. Philadelphia, Pennysylvania: Mutual Pharmaceutical Company; 2013. [Link]
PMID: 23521796
Trimethoprim
Product: Homatropine (Bromide)
Identifier : DBSNPE003745
Drug : DB00440 (Trimethoprim)
Interacting Gene/Enzyme : Glucose-6-phosphate 1-dehydrogenase
Gene Name : G6PD
UniProt ID : P11413
Allele Name : Toledo
Genotype(s) : Not Available
Type(s) : ADR Inferred
Groups : G6PD deficiency
Description : Increased risk of dose-related hemolysis.
References :
- Bacdivim™[package insert]. Philadelphia, Pennysylvania: Mutual Pharmaceutical Company; 2013. [Link]
PMID: 22542104
Trimethoprim
Product: Procaine (hydrochloride)
Identifier : DBSNPE003746
Drug : DB00440 (Trimethoprim)
Interacting Gene/Enzyme : Glucose-6-phosphate 1-dehydrogenase
Gene Name : G6PD
UniProt ID : P11413
Allele Name : Naone
Genotype(s) : Not Available
Type(s) : ADR Inferred
Groups : G6PD deficiency
Description : Increased risk of dose-related hemolysis.
References :
- Bacdivim™[package insert]. Philadelphia, Pennysylvania: Mutual Pharmaceutical Company; 2013. [Link]
PMID: 23412396
Trimethoprim
Product: Procaine
Identifier : DBSNPE003747
Drug : DB00440 (Trimethoprim)
Interacting Gene/Enzyme : Glucose-6-phosphate 1-dehydrogenase
Gene Name : G6PD
UniProt ID : P11413
Allele Name : Nankang
Genotype(s) : Not Available
Type(s) : ADR Inferred
Groups : G6PD deficiency
Description : Increased risk of dose-related hemolysis.
References :
- Bacdivim™[package insert]. Philadelphia, Pennysylvania: Mutual Pharmaceutical Company; 2013. [Link]
PMID: 22937213
Trimethoprim
Product: Probenecid
Identifier : DBSNPE003749
Drug : DB00440 (Trimethoprim)
Interacting Gene/Enzyme : Glucose-6-phosphate 1-dehydrogenase
Gene Name : G6PD
UniProt ID : P11413
Allele Name : Mediterranean, Dallas, Panama‚ Sassari, Cagliari, Birmingham
Genotype(s) : Not Available
Type(s) : ADR Inferred
Groups : G6PD deficiency
Description : Increased risk of dose-related hemolysis.
References :
- Bacdivim™[package insert]. Philadelphia, Pennysylvania: Mutual Pharmaceutical Company; 2013. [Link]
PMID: 19029917
Trimethoprim
Product: Sodium Picosulfate
Identifier : DBSNPE003750
Drug : DB00440 (Trimethoprim)
Interacting Gene/Enzyme : Glucose-6-phosphate 1-dehydrogenase
Gene Name : G6PD
UniProt ID : P11413
Allele Name : Coimbra Shunde
Genotype(s) : Not Available
Type(s) : ADR Inferred
Groups : G6PD deficiency
Description : Increased risk of dose-related hemolysis.
References :
- Bacdivim™[package insert]. Philadelphia, Pennysylvania: Mutual Pharmaceutical Company; 2013. [Link]
PMID: 19666749
Trimethoprim
Product: Allylthiourea
Identifier : DBSNPE003751
Drug : DB00440 (Trimethoprim)
Interacting Gene/Enzyme : Glucose-6-phosphate 1-dehydrogenase
Gene Name : G6PD
UniProt ID : P11413
Allele Name : Nilgiri
Genotype(s) : Not Available
Type(s) : ADR Inferred
Groups : G6PD deficiency
Description : Increased risk of dose-related hemolysis.
References :
- Bacdivim™[package insert]. Philadelphia, Pennysylvania: Mutual Pharmaceutical Company; 2013. [Link]
PMID: 25752982
Trimethoprim
Product: Ouabain (Octahydrate)
Identifier : DBSNPE003752
Drug : DB00440 (Trimethoprim)
Interacting Gene/Enzyme : Glucose-6-phosphate 1-dehydrogenase
Gene Name : G6PD
UniProt ID : P11413
Allele Name : Radlowo
Genotype(s) : Not Available
Type(s) : ADR Inferred
Groups : G6PD deficiency
Description : Increased risk of dose-related hemolysis.
References :
- Bacdivim™[package insert]. Philadelphia, Pennysylvania: Mutual Pharmaceutical Company; 2013. [Link]
PMID: 22633404
Trimethoprim
Product: Cyclamic acid
Identifier : DBSNPE003753
Drug : DB00440 (Trimethoprim)
Interacting Gene/Enzyme : Glucose-6-phosphate 1-dehydrogenase
Gene Name : G6PD
UniProt ID : P11413
Allele Name : Roubaix
Genotype(s) : Not Available
Type(s) : ADR Inferred
Groups : G6PD deficiency
Description : Increased risk of dose-related hemolysis.
References :
- Bacdivim™[package insert]. Philadelphia, Pennysylvania: Mutual Pharmaceutical Company; 2013. [Link]
PMID: 16116451
Trimethoprim
Product: Bindarit
Identifier : DBSNPE003754
Drug : DB00440 (Trimethoprim)
Interacting Gene/Enzyme : Glucose-6-phosphate 1-dehydrogenase
Gene Name : G6PD
UniProt ID : P11413
Allele Name : Haikou
Genotype(s) : Not Available
Type(s) : ADR Inferred
Groups : G6PD deficiency
Description : Increased risk of dose-related hemolysis.
References :
- Bacdivim™[package insert]. Philadelphia, Pennysylvania: Mutual Pharmaceutical Company; 2013. [Link]
PMID: 20237073
Trimethoprim
Product: Niclosamide (monohydrate)
Identifier : DBSNPE003755
Drug : DB00440 (Trimethoprim)
Interacting Gene/Enzyme : Glucose-6-phosphate 1-dehydrogenase
Gene Name : G6PD
UniProt ID : P11413
Allele Name : Chinese-1
Genotype(s) : Not Available
Type(s) : ADR Inferred
Groups : G6PD deficiency
Description : Increased risk of dose-related hemolysis.
References :
- Bacdivim™[package insert]. Philadelphia, Pennysylvania: Mutual Pharmaceutical Company; 2013. [Link]
PMID: 26017782
Trimethoprim
Product: Niclosamide
Identifier : DBSNPE003756
Drug : DB00440 (Trimethoprim)
Interacting Gene/Enzyme : Glucose-6-phosphate 1-dehydrogenase
Gene Name : G6PD
UniProt ID : P11413
Allele Name : Mizushima
Genotype(s) : Not Available
Type(s) : ADR Inferred
Groups : G6PD deficiency
Description : Increased risk of dose-related hemolysis.
References :
- Bacdivim™[package insert]. Philadelphia, Pennysylvania: Mutual Pharmaceutical Company; 2013. [Link]
PMID: 15362850
Trimethoprim
Product: PMSF
Identifier : DBSNPE003757
Drug : DB00440 (Trimethoprim)
Interacting Gene/Enzyme : Glucose-6-phosphate 1-dehydrogenase
Gene Name : G6PD
UniProt ID : P11413
Allele Name : Osaka
Genotype(s) : Not Available
Type(s) : ADR Inferred
Groups : G6PD deficiency
Description : Increased risk of dose-related hemolysis.
References :
- Bacdivim™[package insert]. Philadelphia, Pennysylvania: Mutual Pharmaceutical Company; 2013. [Link]
PMID: 25522140
Trimethoprim
Product: Lamotrigine
Identifier : DBSNPE003758
Drug : DB00440 (Trimethoprim)
Interacting Gene/Enzyme : Glucose-6-phosphate 1-dehydrogenase
Gene Name : G6PD
UniProt ID : P11413
Allele Name : Viangchan, Jammu
Genotype(s) : Not Available
Type(s) : ADR Inferred
Groups : G6PD deficiency
Description : Increased risk of dose-related hemolysis.
References :
- Bacdivim™[package insert]. Philadelphia, Pennysylvania: Mutual Pharmaceutical Company; 2013. [Link]
PMID: 15804433
Trimethoprim
Product: Bufexamac
Identifier : DBSNPE003759
Drug : DB00440 (Trimethoprim)
Interacting Gene/Enzyme : Glucose-6-phosphate 1-dehydrogenase
Gene Name : G6PD
UniProt ID : P11413
Allele Name : Seoul
Genotype(s) : Not Available
Type(s) : ADR Inferred
Groups : G6PD deficiency
Description : Increased risk of dose-related hemolysis.
References :
- Bacdivim™[package insert]. Philadelphia, Pennysylvania: Mutual Pharmaceutical Company; 2013. [Link]
PMID: 7850477
Trimethoprim
Product: Niflumic acid
Identifier : DBSNPE003760
Drug : DB00440 (Trimethoprim)
Interacting Gene/Enzyme : Glucose-6-phosphate 1-dehydrogenase
Gene Name : G6PD
UniProt ID : P11413
Allele Name : Ludhiana
Genotype(s) : Not Available
Type(s) : ADR Inferred
Groups : G6PD deficiency
Description : Increased risk of dose-related hemolysis.
References :
- Bacdivim™[package insert]. Philadelphia, Pennysylvania: Mutual Pharmaceutical Company; 2013. [Link]
PMID: 16483784
Trimethoprim
Product: Paroxetine (hydrochloride)
Identifier : DBSNPE003761
Drug : DB00440 (Trimethoprim)
Interacting Gene/Enzyme : Glucose-6-phosphate 1-dehydrogenase
Gene Name : G6PD
UniProt ID : P11413
Allele Name : Farroupilha
Genotype(s) : Not Available
Type(s) : ADR Inferred
Groups : G6PD deficiency
Description : Increased risk of dose-related hemolysis.
References :
- Bacdivim™[package insert]. Philadelphia, Pennysylvania: Mutual Pharmaceutical Company; 2013. [Link]
PMID: 15080939
Trimethoprim
Product: Carbazochrome (sodium sulfonate)
Identifier : DBSNPE003762
Drug : DB00440 (Trimethoprim)
Interacting Gene/Enzyme : Glucose-6-phosphate 1-dehydrogenase
Gene Name : G6PD
UniProt ID : P11413
Allele Name : Chinese-5
Genotype(s) : Not Available
Type(s) : ADR Inferred
Groups : G6PD deficiency
Description : Increased risk of dose-related hemolysis.
References :
- Bacdivim™[package insert]. Philadelphia, Pennysylvania: Mutual Pharmaceutical Company; 2013. [Link]
PMID: 22787427
Trimethoprim
Product: Hygromycin B
Identifier : DBSNPE003763
Drug : DB00440 (Trimethoprim)
Interacting Gene/Enzyme : Glucose-6-phosphate 1-dehydrogenase
Gene Name : G6PD
UniProt ID : P11413
Allele Name : Rignano
Genotype(s) : Not Available
Type(s) : ADR Inferred
Groups : G6PD deficiency
Description : Increased risk of dose-related hemolysis.
References :
- Bacdivim™[package insert]. Philadelphia, Pennysylvania: Mutual Pharmaceutical Company; 2013. [Link]
PMID: 20027628
Trimethoprim
Product: PF-04449913
Identifier : DBSNPE003764
Drug : DB00440 (Trimethoprim)
Interacting Gene/Enzyme : Glucose-6-phosphate 1-dehydrogenase
Gene Name : G6PD
UniProt ID : P11413
Allele Name : Orissa
Genotype(s) : Not Available
Type(s) : ADR Inferred
Groups : G6PD deficiency
Description : Increased risk of dose-related hemolysis.
References :
- Bacdivim™[package insert]. Philadelphia, Pennysylvania: Mutual Pharmaceutical Company; 2013. [Link]
PMID: 25589674
Trimethoprim
Product: Sulfamethazine
Identifier : DBSNPE003765
Drug : DB00440 (Trimethoprim)
Interacting Gene/Enzyme : Glucose-6-phosphate 1-dehydrogenase
Gene Name : G6PD
UniProt ID : P11413
Allele Name : G6PDNice
Genotype(s) : Not Available
Type(s) : ADR Inferred
Groups : G6PD deficiency
Description : Increased risk of dose-related hemolysis.
References :
- Bacdivim™[package insert]. Philadelphia, Pennysylvania: Mutual Pharmaceutical Company; 2013. [Link]
PMID: 23856325
Trimethoprim
Product: DBeQ
Identifier : DBSNPE003766
Drug : DB00440 (Trimethoprim)
Interacting Gene/Enzyme : Glucose-6-phosphate 1-dehydrogenase
Gene Name : G6PD
UniProt ID : P11413
Allele Name : Kamiube, Keelung
Genotype(s) : Not Available
Type(s) : ADR Inferred
Groups : G6PD deficiency
Description : Increased risk of dose-related hemolysis.
References :
- Bacdivim™[package insert]. Philadelphia, Pennysylvania: Mutual Pharmaceutical Company; 2013. [Link]
PMID: 7728753
Trimethoprim
Product: Staurosporine
Identifier : DBSNPE003767
Drug : DB00440 (Trimethoprim)
Interacting Gene/Enzyme : Glucose-6-phosphate 1-dehydrogenase
Gene Name : G6PD
UniProt ID : P11413
Allele Name : Neapolis
Genotype(s) : Not Available
Type(s) : ADR Inferred
Groups : G6PD deficiency
Description : Increased risk of dose-related hemolysis.
References :
- Bacdivim™[package insert]. Philadelphia, Pennysylvania: Mutual Pharmaceutical Company; 2013. [Link]
PMID: 8062271
Trimethoprim
Product: RO4987655
Identifier : DBSNPE003768
Drug : DB00440 (Trimethoprim)
Interacting Gene/Enzyme : Glucose-6-phosphate 1-dehydrogenase
Gene Name : G6PD
UniProt ID : P11413
Allele Name : Aures
Genotype(s) : Not Available
Type(s) : ADR Inferred
Groups : G6PD deficiency
Description : Increased risk of dose-related hemolysis.
References :
- Bacdivim™[package insert]. Philadelphia, Pennysylvania: Mutual Pharmaceutical Company; 2013. [Link]
PMID: 8347186
Trimethoprim
Product: Vanoxerine
Identifier : DBSNPE003769
Drug : DB00440 (Trimethoprim)
Interacting Gene/Enzyme : Glucose-6-phosphate 1-dehydrogenase
Gene Name : G6PD
UniProt ID : P11413
Allele Name : Split
Genotype(s) : Not Available
Type(s) : ADR Inferred
Groups : G6PD deficiency
Description : Increased risk of dose-related hemolysis.
References :
- Bacdivim™[package insert]. Philadelphia, Pennysylvania: Mutual Pharmaceutical Company; 2013. [Link]
PMID: 24973455
Trimethoprim
Product: Vanoxerine (dihydrochloride)
Identifier : DBSNPE003770
Drug : DB00440 (Trimethoprim)
Interacting Gene/Enzyme : Glucose-6-phosphate 1-dehydrogenase
Gene Name : G6PD
UniProt ID : P11413
Allele Name : Kambos
Genotype(s) : Not Available
Type(s) : ADR Inferred
Groups : G6PD deficiency
Description : Increased risk of dose-related hemolysis.
References :
- Bacdivim™[package insert]. Philadelphia, Pennysylvania: Mutual Pharmaceutical Company; 2013. [Link]
PMID: 25114113
Trimethoprim
Product: Indacaterol (maleate)
Identifier : DBSNPE003772
Drug : DB00440 (Trimethoprim)
Interacting Gene/Enzyme : Glucose-6-phosphate 1-dehydrogenase
Gene Name : G6PD
UniProt ID : P11413
Allele Name : Metaponto
Genotype(s) : Not Available
Type(s) : ADR Inferred
Groups : G6PD deficiency
Description : Increased risk of dose-related hemolysis.
References :
- Bacdivim™[package insert]. Philadelphia, Pennysylvania: Mutual Pharmaceutical Company; 2013. [Link]
PMID: 24662724
Trimethoprim
Product: Atovaquone
Identifier : DBSNPE003773
Drug : DB00440 (Trimethoprim)
Interacting Gene/Enzyme : Glucose-6-phosphate 1-dehydrogenase
Gene Name : G6PD
UniProt ID : P11413
Allele Name : Musashino
Genotype(s) : Not Available
Type(s) : ADR Inferred
Groups : G6PD deficiency
Description : Increased risk of dose-related hemolysis.
References :
- Bacdivim™[package insert]. Philadelphia, Pennysylvania: Mutual Pharmaceutical Company; 2013. [Link]
PMID: 24022491
Trimethoprim
Product: Diclofenac (diethylamine)
Identifier : DBSNPE003774
Drug : DB00440 (Trimethoprim)
Interacting Gene/Enzyme : Glucose-6-phosphate 1-dehydrogenase
Gene Name : G6PD
UniProt ID : P11413
Allele Name : Asahi
Genotype(s) : Not Available
Type(s) : ADR Inferred
Groups : G6PD deficiency
Description : Increased risk of dose-related hemolysis.
References :
- Bacdivim™[package insert]. Philadelphia, Pennysylvania: Mutual Pharmaceutical Company; 2013. [Link]
PMID: 23688423
Trimethoprim
Product: Medetomidine (hydrochloride)
Identifier : DBSNPE003775
Drug : DB00440 (Trimethoprim)
Interacting Gene/Enzyme : Glucose-6-phosphate 1-dehydrogenase
Gene Name : G6PD
UniProt ID : P11413
Allele Name : A- (202), Ferrara I
Genotype(s) : Not Available
Type(s) : ADR Inferred
Groups : G6PD deficiency
Description : Increased risk of dose-related hemolysis.
References :
- Bacdivim™[package insert]. Philadelphia, Pennysylvania: Mutual Pharmaceutical Company; 2013. [Link]
PMID: 22988345
Trimethoprim
Product: Kif15-IN-2
Identifier : DBSNPE003776
Drug : DB00440 (Trimethoprim)
Interacting Gene/Enzyme : Glucose-6-phosphate 1-dehydrogenase
Gene Name : G6PD
UniProt ID : P11413
Allele Name : Murcia Oristano
Genotype(s) : Not Available
Type(s) : ADR Inferred
Groups : G6PD deficiency
Description : Increased risk of dose-related hemolysis.
References :
- Bacdivim™[package insert]. Philadelphia, Pennysylvania: Mutual Pharmaceutical Company; 2013. [Link]
PMID: 22296847
Trimethoprim
Product: Kif15-IN-1
Identifier : DBSNPE003777
Drug : DB00440 (Trimethoprim)
Interacting Gene/Enzyme : Glucose-6-phosphate 1-dehydrogenase
Gene Name : G6PD
UniProt ID : P11413
Allele Name : Ube Konan
Genotype(s) : Not Available
Type(s) : ADR Inferred
Groups : G6PD deficiency
Description : Increased risk of dose-related hemolysis.
References :
- Bacdivim™[package insert]. Philadelphia, Pennysylvania: Mutual Pharmaceutical Company; 2013. [Link]
PMID: 22496348
Trimethoprim
Product: Meisoindigo
Identifier : DBSNPE003778
Drug : DB00440 (Trimethoprim)
Interacting Gene/Enzyme : Glucose-6-phosphate 1-dehydrogenase
Gene Name : G6PD
UniProt ID : P11413
Allele Name : Lagosanto
Genotype(s) : Not Available
Type(s) : ADR Inferred
Groups : G6PD deficiency
Description : Increased risk of dose-related hemolysis.
References :
- Bacdivim™[package insert]. Philadelphia, Pennysylvania: Mutual Pharmaceutical Company; 2013. [Link]
PMID: 23112050
Trimethoprim
Product: RJR-2403 (hemioxalate)
Identifier : DBSNPE003779
Drug : DB00440 (Trimethoprim)
Interacting Gene/Enzyme : Glucose-6-phosphate 1-dehydrogenase
Gene Name : G6PD
UniProt ID : P11413
Allele Name : Guangzhou
Genotype(s) : Not Available
Type(s) : ADR Inferred
Groups : G6PD deficiency
Description : Increased risk of dose-related hemolysis.
References :
- Bacdivim™[package insert]. Philadelphia, Pennysylvania: Mutual Pharmaceutical Company; 2013. [Link]
PMID: 21454702
Trimethoprim
Product: Pimecrolimus
Identifier : DBSNPE003780
Drug : DB00440 (Trimethoprim)
Interacting Gene/Enzyme : Glucose-6-phosphate 1-dehydrogenase
Gene Name : G6PD
UniProt ID : P11413
Allele Name : Hammersmith
Genotype(s) : Not Available
Type(s) : ADR Inferred
Groups : G6PD deficiency
Description : Increased risk of dose-related hemolysis.
References :
- Bacdivim™[package insert]. Philadelphia, Pennysylvania: Mutual Pharmaceutical Company; 2013. [Link]
PMID: 21829200
Trimethoprim
Product: TCS JNK 5a
Identifier : DBSNPE003781
Drug : DB00440 (Trimethoprim)
Interacting Gene/Enzyme : Glucose-6-phosphate 1-dehydrogenase
Gene Name : G6PD
UniProt ID : P11413
Allele Name : Sinnai
Genotype(s) : Not Available
Type(s) : ADR Inferred
Groups : G6PD deficiency
Description : Increased risk of dose-related hemolysis.
References :
- Bacdivim™[package insert]. Philadelphia, Pennysylvania: Mutual Pharmaceutical Company; 2013. [Link]
PMID: 21660152
Trimethoprim
Product: b-AP15
Identifier : DBSNPE003782
Drug : DB00440 (Trimethoprim)
Interacting Gene/Enzyme : Glucose-6-phosphate 1-dehydrogenase
Gene Name : G6PD
UniProt ID : P11413
Allele Name : A- (680)
Genotype(s) : Not Available
Type(s) : ADR Inferred
Groups : G6PD deficiency
Description : Increased risk of dose-related hemolysis.
References :
- Bacdivim™[package insert]. Philadelphia, Pennysylvania: Mutual Pharmaceutical Company; 2013. [Link]
PMID: 21533148
Trimethoprim
Product: R788 (disodium hexahydrate)
Identifier : DBSNPE003783
Drug : DB00440 (Trimethoprim)
Interacting Gene/Enzyme : Glucose-6-phosphate 1-dehydrogenase
Gene Name : G6PD
UniProt ID : P11413
Allele Name : A- (968), Betica,Selma, Guantanamo
Genotype(s) : Not Available
Type(s) : ADR Inferred
Groups : G6PD deficiency
Description : Increased risk of dose-related hemolysis.
References :
- Bacdivim™[package insert]. Philadelphia, Pennysylvania: Mutual Pharmaceutical Company; 2013. [Link]
PMID: 21535875
Trimethoprim
Product: ACT-132577
Identifier : DBSNPE003784
Drug : DB00440 (Trimethoprim)
Interacting Gene/Enzyme : Glucose-6-phosphate 1-dehydrogenase
Gene Name : G6PD
UniProt ID : P11413
Allele Name : Salerno Pyrgos
Genotype(s) : Not Available
Type(s) : ADR Inferred
Groups : G6PD deficiency
Description : Increased risk of dose-related hemolysis.
References :
- Bacdivim™[package insert]. Philadelphia, Pennysylvania: Mutual Pharmaceutical Company; 2013. [Link]
PMID: 23298463
Trimethoprim
Product: MI-773
Identifier : DBSNPE003785
Drug : DB00440 (Trimethoprim)
Interacting Gene/Enzyme : Glucose-6-phosphate 1-dehydrogenase
Gene Name : G6PD
UniProt ID : P11413
Allele Name : Quing Yan
Genotype(s) : Not Available
Type(s) : ADR Inferred
Groups : G6PD deficiency
Description : Increased risk of dose-related hemolysis.
References :
- Bacdivim™[package insert]. Philadelphia, Pennysylvania: Mutual Pharmaceutical Company; 2013. [Link]
PMID: 17689559
Trimethoprim
Product: BQ-788 (sodium salt)
Identifier : DBSNPE003786
Drug : DB00440 (Trimethoprim)
Interacting Gene/Enzyme : Glucose-6-phosphate 1-dehydrogenase
Gene Name : G6PD
UniProt ID : P11413
Allele Name : Lages
Genotype(s) : Not Available
Type(s) : ADR Inferred
Groups : G6PD deficiency
Description : Increased risk of dose-related hemolysis.
References :
- Bacdivim™[package insert]. Philadelphia, Pennysylvania: Mutual Pharmaceutical Company; 2013. [Link]
PMID: 11839633
Trimethoprim
Product: CEP-37440
Identifier : DBSNPE003787
Drug : DB00440 (Trimethoprim)
Interacting Gene/Enzyme : Glucose-6-phosphate 1-dehydrogenase
Gene Name : G6PD
UniProt ID : P11413
Allele Name : Ilesha
Genotype(s) : Not Available
Type(s) : ADR Inferred
Groups : G6PD deficiency
Description : Increased risk of dose-related hemolysis.
References :
- Bacdivim™[package insert]. Philadelphia, Pennysylvania: Mutual Pharmaceutical Company; 2013. [Link]
PMID: 10368126
Trimethoprim
Product: Sulfacetamide (Sodium)
Identifier : DBSNPE003788
Drug : DB00440 (Trimethoprim)
Interacting Gene/Enzyme : Glucose-6-phosphate 1-dehydrogenase
Gene Name : G6PD
UniProt ID : P11413
Allele Name : Mahidol
Genotype(s) : Not Available
Type(s) : ADR Inferred
Groups : G6PD deficiency
Description : Increased risk of dose-related hemolysis.
References :
- Bacdivim™[package insert]. Philadelphia, Pennysylvania: Mutual Pharmaceutical Company; 2013. [Link]
PMID: 25611319
Trimethoprim
Product: Triamterene
Identifier : DBSNPE003789
Drug : DB00440 (Trimethoprim)
Interacting Gene/Enzyme : Glucose-6-phosphate 1-dehydrogenase
Gene Name : G6PD
UniProt ID : P11413
Allele Name : Malaga
Genotype(s) : Not Available
Type(s) : ADR Inferred
Groups : G6PD deficiency
Description : Increased risk of dose-related hemolysis.
References :
- Bacdivim™[package insert]. Philadelphia, Pennysylvania: Mutual Pharmaceutical Company; 2013. [Link]
PMID: 21602423
Trimethoprim
Product: Mefenamic acid
Identifier : DBSNPE003790
Drug : DB00440 (Trimethoprim)
Interacting Gene/Enzyme : Glucose-6-phosphate 1-dehydrogenase
Gene Name : G6PD
UniProt ID : P11413
Allele Name : Sibari
Genotype(s) : Not Available
Type(s) : ADR Inferred
Groups : G6PD deficiency
Description : Increased risk of dose-related hemolysis.
References :
- Bacdivim™[package insert]. Philadelphia, Pennysylvania: Mutual Pharmaceutical Company; 2013. [Link]
PMID: 17678888
Trimethoprim
Product: Propranolol (hydrochloride)
Identifier : DBSNPE003791
Drug : DB00440 (Trimethoprim)
Interacting Gene/Enzyme : Glucose-6-phosphate 1-dehydrogenase
Gene Name : G6PD
UniProt ID : P11413
Allele Name : Mexico City
Genotype(s) : Not Available
Type(s) : ADR Inferred
Groups : G6PD deficiency
Description : Increased risk of dose-related hemolysis.
References :
- Bacdivim™[package insert]. Philadelphia, Pennysylvania: Mutual Pharmaceutical Company; 2013. [Link]
PMID: 1322694
Trimethoprim
Product: Zinc Pyrithione
Identifier : DBSNPE003792
Drug : DB00440 (Trimethoprim)
Interacting Gene/Enzyme : Glucose-6-phosphate 1-dehydrogenase
Gene Name : G6PD
UniProt ID : P11413
Allele Name : Nanning
Genotype(s) : Not Available
Type(s) : ADR Inferred
Groups : G6PD deficiency
Description : Increased risk of dose-related hemolysis.
References :
- Bacdivim™[package insert]. Philadelphia, Pennysylvania: Mutual Pharmaceutical Company; 2013. [Link]
PMID: 26710229
Trimethoprim
Product: Decamethonium (Bromide)
Identifier : DBSNPE003793
Drug : DB00440 (Trimethoprim)
Interacting Gene/Enzyme : Glucose-6-phosphate 1-dehydrogenase
Gene Name : G6PD
UniProt ID : P11413
Allele Name : Seattle, Lodi, Modena, Ferrara II, Athens-like
Genotype(s) : Not Available
Type(s) : ADR Inferred
Groups : G6PD deficiency
Description : Increased risk of dose-related hemolysis.
References :
- Bacdivim™[package insert]. Philadelphia, Pennysylvania: Mutual Pharmaceutical Company; 2013. [Link]
PMID: 26520569
Trimethoprim
Product: Hexamethonium (Bromide)
Identifier : DBSNPE003794
Drug : DB00440 (Trimethoprim)
Interacting Gene/Enzyme : Glucose-6-phosphate 1-dehydrogenase
Gene Name : G6PD
UniProt ID : P11413
Allele Name : Bajo Maumere
Genotype(s) : Not Available
Type(s) : ADR Inferred
Groups : G6PD deficiency
Description : Increased risk of dose-related hemolysis.
References :
- Bacdivim™[package insert]. Philadelphia, Pennysylvania: Mutual Pharmaceutical Company; 2013. [Link]
PMID: 16083752
Trimethoprim
Product: Dequalinium (Chloride)
Identifier : DBSNPE003795
Drug : DB00440 (Trimethoprim)
Interacting Gene/Enzyme : Glucose-6-phosphate 1-dehydrogenase
Gene Name : G6PD
UniProt ID : P11413
Allele Name : Montalbano
Genotype(s) : Not Available
Type(s) : ADR Inferred
Groups : G6PD deficiency
Description : Increased risk of dose-related hemolysis.
References :
- Bacdivim™[package insert]. Philadelphia, Pennysylvania: Mutual Pharmaceutical Company; 2013. [Link]
PMID: 14524532
Trimethoprim
Product: Guanabenz (Acetate)
Identifier : DBSNPE003796
Drug : DB00440 (Trimethoprim)
Interacting Gene/Enzyme : Glucose-6-phosphate 1-dehydrogenase
Gene Name : G6PD
UniProt ID : P11413
Allele Name : Kalyan-Kerala, Jamnaga, Rohini
Genotype(s) : Not Available
Type(s) : ADR Inferred
Groups : G6PD deficiency
Description : Increased risk of dose-related hemolysis.
References :
- Bacdivim™[package insert]. Philadelphia, Pennysylvania: Mutual Pharmaceutical Company; 2013. [Link]
PMID: 9364582
Trimethoprim
Product: Ronidazole
Identifier : DBSNPE003797
Drug : DB00440 (Trimethoprim)
Interacting Gene/Enzyme : Glucose-6-phosphate 1-dehydrogenase
Gene Name : G6PD
UniProt ID : P11413
Allele Name : Gaohe
Genotype(s) : Not Available
Type(s) : ADR Inferred
Groups : G6PD deficiency
Description : Increased risk of dose-related hemolysis.
References :
- Bacdivim™[package insert]. Philadelphia, Pennysylvania: Mutual Pharmaceutical Company; 2013. [Link]
PMID: 25365206