Trimethoprim

Product: Telithromycin

Identifier : DBSNPE003627
Drug : DB00440 (Trimethoprim)
Interacting Gene/Enzyme : Glucose-6-phosphate 1-dehydrogenase
Gene Name : G6PD
UniProt ID : P11413
Defining Change(s) :

  • 1000_1002delACC

Allele Name : Villeurbanne
Genotype(s) : Not Available
Type(s) : ADR Inferred
Groups : G6PD deficiency
Description : Increased risk of dose-related hemolysis.
References :

  1. Bacdivim™[package insert]. Philadelphia, Pennysylvania: Mutual Pharmaceutical Company; 2013. [Link]

PMID: 20551326

Trimethoprim

Product: Iohexol

Identifier : DBSNPE003628
Drug : DB00440 (Trimethoprim)
Interacting Gene/Enzyme : Glucose-6-phosphate 1-dehydrogenase
Gene Name : G6PD
UniProt ID : P11413
Defining Change(s) :

  • 1006A->G

Allele Name : Torun
Genotype(s) : Not Available
Type(s) : ADR Inferred
Groups : G6PD deficiency
Description : Increased risk of dose-related hemolysis.
References :

  1. Bacdivim™[package insert]. Philadelphia, Pennysylvania: Mutual Pharmaceutical Company; 2013. [Link]

PMID: 18308941

Trimethoprim

Product: Ceftazidime

Identifier : DBSNPE003629
Drug : DB00440 (Trimethoprim)
Interacting Gene/Enzyme : Glucose-6-phosphate 1-dehydrogenase
Gene Name : G6PD
UniProt ID : P11413
Defining Change(s) :

  • 105_107delCAT

Allele Name : Sunderland
Genotype(s) : Not Available
Type(s) : ADR Inferred
Groups : G6PD deficiency
Description : Increased risk of dose-related hemolysis.
References :

  1. Bacdivim™[package insert]. Philadelphia, Pennysylvania: Mutual Pharmaceutical Company; 2013. [Link]

PMID: 1731751

Trimethoprim

Product: Trandolapril

Identifier : DBSNPE003631
Drug : DB00440 (Trimethoprim)
Interacting Gene/Enzyme : Glucose-6-phosphate 1-dehydrogenase
Gene Name : G6PD
UniProt ID : P11413
Defining Change(s) :

  • 1082C->T

Allele Name : Serres
Genotype(s) : Not Available
Type(s) : ADR Inferred
Groups : G6PD deficiency
Description : Increased risk of dose-related hemolysis.
References :

  1. Bacdivim™[package insert]. Philadelphia, Pennysylvania: Mutual Pharmaceutical Company; 2013. [Link]

PMID: 20356772

Trimethoprim

Product: Cabergoline

Identifier : DBSNPE003632
Drug : DB00440 (Trimethoprim)
Interacting Gene/Enzyme : Glucose-6-phosphate 1-dehydrogenase
Gene Name : G6PD
UniProt ID : P11413
Defining Change(s) :

  • 1084_1101delCTGAACGAGCGCAAGGCC

Allele Name : Tondela
Genotype(s) : Not Available
Type(s) : ADR Inferred
Groups : G6PD deficiency
Description : Increased risk of dose-related hemolysis.
References :

  1. Bacdivim™[package insert]. Philadelphia, Pennysylvania: Mutual Pharmaceutical Company; 2013. [Link]

PMID: 20735414

Trimethoprim

Product: Tetrabenazine

Identifier : DBSNPE003633
Drug : DB00440 (Trimethoprim)
Interacting Gene/Enzyme : Glucose-6-phosphate 1-dehydrogenase
Gene Name : G6PD
UniProt ID : P11413
Defining Change(s) :

  • 1089C->A

Allele Name : Loma Linda
Genotype(s) : Not Available
Type(s) : ADR Inferred
Groups : G6PD deficiency
Description : Increased risk of dose-related hemolysis.
References :

  1. Bacdivim™[package insert]. Philadelphia, Pennysylvania: Mutual Pharmaceutical Company; 2013. [Link]

PMID: 19366702

Trimethoprim

Product: Cysteamine (Hydrochloride)

Identifier : DBSNPE003634
Drug : DB00440 (Trimethoprim)
Interacting Gene/Enzyme : Glucose-6-phosphate 1-dehydrogenase
Gene Name : G6PD
UniProt ID : P11413
Defining Change(s) :

  • 1089C->G

Allele Name : Aachen
Genotype(s) : Not Available
Type(s) : ADR Inferred
Groups : G6PD deficiency
Description : Increased risk of dose-related hemolysis.
References :

  1. Bacdivim™[package insert]. Philadelphia, Pennysylvania: Mutual Pharmaceutical Company; 2013. [Link]

PMID: 19800804

Trimethoprim

Product: Cysteamine

Identifier : DBSNPE003635
Drug : DB00440 (Trimethoprim)
Interacting Gene/Enzyme : Glucose-6-phosphate 1-dehydrogenase
Gene Name : G6PD
UniProt ID : P11413
Defining Change(s) :

  • 1096A->G

Allele Name : Tenri
Genotype(s) : Not Available
Type(s) : ADR Inferred
Groups : G6PD deficiency
Description : Increased risk of dose-related hemolysis.
References :

  1. Bacdivim™[package insert]. Philadelphia, Pennysylvania: Mutual Pharmaceutical Company; 2013. [Link]

PMID: 18467108

Trimethoprim

Product: Atorvastatin

Identifier : DBSNPE003636
Drug : DB00440 (Trimethoprim)
Interacting Gene/Enzyme : Glucose-6-phosphate 1-dehydrogenase
Gene Name : G6PD
UniProt ID : P11413
Defining Change(s) :

  • 1132G>A

Allele Name : Montpellier
Genotype(s) : Not Available
Type(s) : ADR Inferred
Groups : G6PD deficiency
Description : Increased risk of dose-related hemolysis.
References :

  1. Bacdivim™[package insert]. Philadelphia, Pennysylvania: Mutual Pharmaceutical Company; 2013. [Link]

PMID: 26034042

Trimethoprim

Product: DDR1-IN-1

Identifier : DBSNPE003637
Drug : DB00440 (Trimethoprim)
Interacting Gene/Enzyme : Glucose-6-phosphate 1-dehydrogenase
Gene Name : G6PD
UniProt ID : P11413
Defining Change(s) :

  • 1138A->G

Allele Name : Calvo Mackenna
Genotype(s) : Not Available
Type(s) : ADR Inferred
Groups : G6PD deficiency
Description : Increased risk of dose-related hemolysis.
References :

  1. Bacdivim™[package insert]. Philadelphia, Pennysylvania: Mutual Pharmaceutical Company; 2013. [Link]

PMID: 22863277

Trimethoprim

Product: LGK974

Identifier : DBSNPE003638
Drug : DB00440 (Trimethoprim)
Interacting Gene/Enzyme : Glucose-6-phosphate 1-dehydrogenase
Gene Name : G6PD
UniProt ID : P11413
Defining Change(s) :

  • 1139T->C

Allele Name : Riley
Genotype(s) : Not Available
Type(s) : ADR Inferred
Groups : G6PD deficiency
Description : Increased risk of dose-related hemolysis.
References :

  1. Bacdivim™[package insert]. Philadelphia, Pennysylvania: Mutual Pharmaceutical Company; 2013. [Link]

PMID: 14660630

Trimethoprim

Product: TPT-260

Identifier : DBSNPE003639
Drug : DB00440 (Trimethoprim)
Interacting Gene/Enzyme : Glucose-6-phosphate 1-dehydrogenase
Gene Name : G6PD
UniProt ID : P11413
Defining Change(s) :

  • 1141T->C

Allele Name : Olomouc
Genotype(s) : Not Available
Type(s) : ADR Inferred
Groups : G6PD deficiency
Description : Increased risk of dose-related hemolysis.
References :

  1. Bacdivim™[package insert]. Philadelphia, Pennysylvania: Mutual Pharmaceutical Company; 2013. [Link]

PMID: 14500756

Trimethoprim

Product: TPT-260 (Dihydrochloride)

Identifier : DBSNPE003640
Drug : DB00440 (Trimethoprim)
Interacting Gene/Enzyme : Glucose-6-phosphate 1-dehydrogenase
Gene Name : G6PD
UniProt ID : P11413
Defining Change(s) :

  • 1153T->C

Allele Name : Tomah
Genotype(s) : Not Available
Type(s) : ADR Inferred
Groups : G6PD deficiency
Description : Increased risk of dose-related hemolysis.
References :

  1. Bacdivim™[package insert]. Philadelphia, Pennysylvania: Mutual Pharmaceutical Company; 2013. [Link]

PMID: 22894757

Trimethoprim

Product: Eribulin (mesylate)

Identifier : DBSNPE003641
Drug : DB00440 (Trimethoprim)
Interacting Gene/Enzyme : Glucose-6-phosphate 1-dehydrogenase
Gene Name : G6PD
UniProt ID : P11413
Defining Change(s) :

  • 1154G->T

Allele Name : Lynwood
Genotype(s) : Not Available
Type(s) : ADR Inferred
Groups : G6PD deficiency
Description : Increased risk of dose-related hemolysis.
References :

  1. Bacdivim™[package insert]. Philadelphia, Pennysylvania: Mutual Pharmaceutical Company; 2013. [Link]

PMID: 22801643

Trimethoprim

Product: Eribulin

Identifier : DBSNPE003642
Drug : DB00440 (Trimethoprim)
Interacting Gene/Enzyme : Glucose-6-phosphate 1-dehydrogenase
Gene Name : G6PD
UniProt ID : P11413
Defining Change(s) :

  • 1155C->G

Allele Name : Madrid
Genotype(s) : Not Available
Type(s) : ADR Inferred
Groups : G6PD deficiency
Description : Increased risk of dose-related hemolysis.
References :

  1. Bacdivim™[package insert]. Philadelphia, Pennysylvania: Mutual Pharmaceutical Company; 2013. [Link]

PMID: 23596204

Trimethoprim

Product: Arctigenin

Identifier : DBSNPE003643
Drug : DB00440 (Trimethoprim)
Interacting Gene/Enzyme : Glucose-6-phosphate 1-dehydrogenase
Gene Name : G6PD
UniProt ID : P11413
Defining Change(s) :

  • 1156A->G

Allele Name : Iowa, Walter Reed, Springfield
Genotype(s) : Not Available
Type(s) : ADR Inferred
Groups : G6PD deficiency
Description : Increased risk of dose-related hemolysis.
References :

  1. Bacdivim™[package insert]. Philadelphia, Pennysylvania: Mutual Pharmaceutical Company; 2013. [Link]

PMID: 18794796

Trimethoprim

Product: GNF179

Identifier : DBSNPE003644
Drug : DB00440 (Trimethoprim)
Interacting Gene/Enzyme : Glucose-6-phosphate 1-dehydrogenase
Gene Name : G6PD
UniProt ID : P11413
Defining Change(s) :

  • 1160G->A

Allele Name : Beverly Hills, Genova, Iwate, Niigata, Yamaguchi
Genotype(s) : Not Available
Type(s) : ADR Inferred
Groups : G6PD deficiency
Description : Increased risk of dose-related hemolysis.
References :

  1. Bacdivim™[package insert]. Philadelphia, Pennysylvania: Mutual Pharmaceutical Company; 2013. [Link]

PMID: 12444544

Trimethoprim

Product: GNF179 (Metabolite)

Identifier : DBSNPE003645
Drug : DB00440 (Trimethoprim)
Interacting Gene/Enzyme : Glucose-6-phosphate 1-dehydrogenase
Gene Name : G6PD
UniProt ID : P11413
Defining Change(s) :

  • 1162A->G

Allele Name : Hartford
Genotype(s) : Not Available
Type(s) : ADR Inferred
Groups : G6PD deficiency
Description : Increased risk of dose-related hemolysis.
References :

  1. Bacdivim™[package insert]. Philadelphia, Pennysylvania: Mutual Pharmaceutical Company; 2013. [Link]

PMID: 16373705

Trimethoprim

Product: Betulinaldehyde

Identifier : DBSNPE003646
Drug : DB00440 (Trimethoprim)
Interacting Gene/Enzyme : Glucose-6-phosphate 1-dehydrogenase
Gene Name : G6PD
UniProt ID : P11413
Defining Change(s) :

  • 1166A->G

Allele Name : Praha
Genotype(s) : Not Available
Type(s) : ADR Inferred
Groups : G6PD deficiency
Description : Increased risk of dose-related hemolysis.
References :

  1. Bacdivim™[package insert]. Philadelphia, Pennysylvania: Mutual Pharmaceutical Company; 2013. [Link]

PMID: 15585638

Trimethoprim

Product: Eperezolid

Identifier : DBSNPE003647
Drug : DB00440 (Trimethoprim)
Interacting Gene/Enzyme : Glucose-6-phosphate 1-dehydrogenase
Gene Name : G6PD
UniProt ID : P11413
Defining Change(s) :

  • 1175T>C

Allele Name : Krakow
Genotype(s) : Not Available
Type(s) : ADR Inferred
Groups : G6PD deficiency
Description : Increased risk of dose-related hemolysis.
References :

  1. Bacdivim™[package insert]. Philadelphia, Pennysylvania: Mutual Pharmaceutical Company; 2013. [Link]

PMID: 22594480

Trimethoprim

Product: Actinomycin D

Identifier : DBSNPE003649
Drug : DB00440 (Trimethoprim)
Interacting Gene/Enzyme : Glucose-6-phosphate 1-dehydrogenase
Gene Name : G6PD
UniProt ID : P11413
Defining Change(s) :

  • 1178G->A

Allele Name : Nashville, Anaheim, Portici
Genotype(s) : Not Available
Type(s) : ADR Inferred
Groups : G6PD deficiency
Description : Increased risk of dose-related hemolysis.
References :

  1. Bacdivim™[package insert]. Philadelphia, Pennysylvania: Mutual Pharmaceutical Company; 2013. [Link]

PMID: 27302163

Trimethoprim

Product: GS-9973

Identifier : DBSNPE003650
Drug : DB00440 (Trimethoprim)
Interacting Gene/Enzyme : Glucose-6-phosphate 1-dehydrogenase
Gene Name : G6PD
UniProt ID : P11413
Defining Change(s) :

  • 1180G->C

Allele Name : Alhambra
Genotype(s) : Not Available
Type(s) : ADR Inferred
Groups : G6PD deficiency
Description : Increased risk of dose-related hemolysis.
References :

  1. Bacdivim™[package insert]. Philadelphia, Pennysylvania: Mutual Pharmaceutical Company; 2013. [Link]

PMID: 21855335

Trimethoprim

Product: GSK269962A

Identifier : DBSNPE003651
Drug : DB00440 (Trimethoprim)
Interacting Gene/Enzyme : Glucose-6-phosphate 1-dehydrogenase
Gene Name : G6PD
UniProt ID : P11413
Defining Change(s) :

  • 1187C->T

Allele Name : Bari
Genotype(s) : Not Available
Type(s) : ADR Inferred
Groups : G6PD deficiency
Description : Increased risk of dose-related hemolysis.
References :

  1. Bacdivim™[package insert]. Philadelphia, Pennysylvania: Mutual Pharmaceutical Company; 2013. [Link]

PMID: 12475982

Trimethoprim

Product: Brinzolamide

Identifier : DBSNPE003652
Drug : DB00440 (Trimethoprim)
Interacting Gene/Enzyme : Glucose-6-phosphate 1-dehydrogenase
Gene Name : G6PD
UniProt ID : P11413
Defining Change(s) :

  • 1192G->A

Allele Name : Puerto Limon
Genotype(s) : Not Available
Type(s) : ADR Inferred
Groups : G6PD deficiency
Description : Increased risk of dose-related hemolysis.
References :

  1. Bacdivim™[package insert]. Philadelphia, Pennysylvania: Mutual Pharmaceutical Company; 2013. [Link]

PMID: 11861385

Trimethoprim

Product: Guanfacine

Identifier : DBSNPE003653
Drug : DB00440 (Trimethoprim)
Interacting Gene/Enzyme : Glucose-6-phosphate 1-dehydrogenase
Gene Name : G6PD
UniProt ID : P11413
Defining Change(s) :

  • 1205C>A

Allele Name : Covao do Lobo
Genotype(s) : Not Available
Type(s) : ADR Inferred
Groups : G6PD deficiency
Description : Increased risk of dose-related hemolysis.
References :

  1. Bacdivim™[package insert]. Philadelphia, Pennysylvania: Mutual Pharmaceutical Company; 2013. [Link]

PMID: 10467133

Trimethoprim

Product: AMD 3465

Identifier : DBSNPE003654
Drug : DB00440 (Trimethoprim)
Interacting Gene/Enzyme : Glucose-6-phosphate 1-dehydrogenase
Gene Name : G6PD
UniProt ID : P11413
Defining Change(s) :

  • 1215G->A

Allele Name : Clinic
Genotype(s) : Not Available
Type(s) : ADR Inferred
Groups : G6PD deficiency
Description : Increased risk of dose-related hemolysis.
References :

  1. Bacdivim™[package insert]. Philadelphia, Pennysylvania: Mutual Pharmaceutical Company; 2013. [Link]

PMID: 8557675

Trimethoprim

Product: Rucaparib

Identifier : DBSNPE003655
Drug : DB00440 (Trimethoprim)
Interacting Gene/Enzyme : Glucose-6-phosphate 1-dehydrogenase
Gene Name : G6PD
UniProt ID : P11413
Defining Change(s) :

  • 1225C->T

Allele Name : Udivecht
Genotype(s) : Not Available
Type(s) : ADR Inferred
Groups : G6PD deficiency
Description : Increased risk of dose-related hemolysis.
References :

  1. Bacdivim™[package insert]. Philadelphia, Pennysylvania: Mutual Pharmaceutical Company; 2013. [Link]

PMID: 22889981

Trimethoprim

Product: AMD 3465 (hexahydrobromide)

Identifier : DBSNPE003656
Drug : DB00440 (Trimethoprim)
Interacting Gene/Enzyme : Glucose-6-phosphate 1-dehydrogenase
Gene Name : G6PD
UniProt ID : P11413
Defining Change(s) :

  • 1226C->G

Allele Name : Suwalki
Genotype(s) : Not Available
Type(s) : ADR Inferred
Groups : G6PD deficiency
Description : Increased risk of dose-related hemolysis.
References :

  1. Bacdivim™[package insert]. Philadelphia, Pennysylvania: Mutual Pharmaceutical Company; 2013. [Link]

PMID: 19141530

Trimethoprim

Product: Tirasemtiv

Identifier : DBSNPE003657
Drug : DB00440 (Trimethoprim)
Interacting Gene/Enzyme : Glucose-6-phosphate 1-dehydrogenase
Gene Name : G6PD
UniProt ID : P11413
Defining Change(s) :

  • 1228G->T

Allele Name : Riverside
Genotype(s) : Not Available
Type(s) : ADR Inferred
Groups : G6PD deficiency
Description : Increased risk of dose-related hemolysis.
References :

  1. Bacdivim™[package insert]. Philadelphia, Pennysylvania: Mutual Pharmaceutical Company; 2013. [Link]

PMID: 17585111

Trimethoprim

Product: CNX-2006

Identifier : DBSNPE003658
Drug : DB00440 (Trimethoprim)
Interacting Gene/Enzyme : Glucose-6-phosphate 1-dehydrogenase
Gene Name : G6PD
UniProt ID : P11413
Defining Change(s) :

  • 1229G->A

Allele Name : Japan, Shinagawa
Genotype(s) : Not Available
Type(s) : ADR Inferred
Groups : G6PD deficiency
Description : Increased risk of dose-related hemolysis.
References :

  1. Bacdivim™[package insert]. Philadelphia, Pennysylvania: Mutual Pharmaceutical Company; 2013. [Link]

PMID: 17200208

Trimethoprim

Product: Tirapazamine

Identifier : DBSNPE003659
Drug : DB00440 (Trimethoprim)
Interacting Gene/Enzyme : Glucose-6-phosphate 1-dehydrogenase
Gene Name : G6PD
UniProt ID : P11413
Defining Change(s) :

  • 1229G->C

Allele Name : Kawasaki
Genotype(s) : Not Available
Type(s) : ADR Inferred
Groups : G6PD deficiency
Description : Increased risk of dose-related hemolysis.
References :

  1. Bacdivim™[package insert]. Philadelphia, Pennysylvania: Mutual Pharmaceutical Company; 2013. [Link]

PMID: 10890901

Trimethoprim

Product: Rucaparib (phosphate)

Identifier : DBSNPE003660
Drug : DB00440 (Trimethoprim)
Interacting Gene/Enzyme : Glucose-6-phosphate 1-dehydrogenase
Gene Name : G6PD
UniProt ID : P11413
Defining Change(s) :

  • 1231A->G

Allele Name : Munich
Genotype(s) : Not Available
Type(s) : ADR Inferred
Groups : G6PD deficiency
Description : Increased risk of dose-related hemolysis.
References :

  1. Bacdivim™[package insert]. Philadelphia, Pennysylvania: Mutual Pharmaceutical Company; 2013. [Link]

PMID: 9578319

Trimethoprim

Product: CGP 57380

Identifier : DBSNPE003661
Drug : DB00440 (Trimethoprim)
Interacting Gene/Enzyme : Glucose-6-phosphate 1-dehydrogenase
Gene Name : G6PD
UniProt ID : P11413
Defining Change(s) :

  • 1284C->A

Allele Name : Georgia
Genotype(s) : Not Available
Type(s) : ADR Inferred
Groups : G6PD deficiency
Description : Increased risk of dose-related hemolysis.
References :

  1. Bacdivim™[package insert]. Philadelphia, Pennysylvania: Mutual Pharmaceutical Company; 2013. [Link]

PMID: 25132267

Trimethoprim

Product: Amifampridine

Identifier : DBSNPE003662
Drug : DB00440 (Trimethoprim)
Interacting Gene/Enzyme : Glucose-6-phosphate 1-dehydrogenase
Gene Name : G6PD
UniProt ID : P11413
Defining Change(s) :

  • 1292T->G

Allele Name : Sumare
Genotype(s) : Not Available
Type(s) : ADR Inferred
Groups : G6PD deficiency
Description : Increased risk of dose-related hemolysis.
References :

  1. Bacdivim™[package insert]. Philadelphia, Pennysylvania: Mutual Pharmaceutical Company; 2013. [Link]

PMID: 26158764

Trimethoprim

Product: Miglustat (hydrochloride)

Identifier : DBSNPE003663
Drug : DB00440 (Trimethoprim)
Interacting Gene/Enzyme : Glucose-6-phosphate 1-dehydrogenase
Gene Name : G6PD
UniProt ID : P11413
Defining Change(s) :

  • 1318C->T

Allele Name : Telti/Kobe
Genotype(s) : Not Available
Type(s) : ADR Inferred
Groups : G6PD deficiency
Description : Increased risk of dose-related hemolysis.
References :

  1. Bacdivim™[package insert]. Philadelphia, Pennysylvania: Mutual Pharmaceutical Company; 2013. [Link]

PMID: 26578881

Trimethoprim

Product: Miglustat

Identifier : DBSNPE003664
Drug : DB00440 (Trimethoprim)
Interacting Gene/Enzyme : Glucose-6-phosphate 1-dehydrogenase
Gene Name : G6PD
UniProt ID : P11413
Defining Change(s) :

  • 1339G->A

Allele Name : Santiago de Cuba, Morioka
Genotype(s) : Not Available
Type(s) : ADR Inferred
Groups : G6PD deficiency
Description : Increased risk of dose-related hemolysis.
References :

  1. Bacdivim™[package insert]. Philadelphia, Pennysylvania: Mutual Pharmaceutical Company; 2013. [Link]

PMID: 24843732

Trimethoprim

Product: Piracetam

Identifier : DBSNPE003665
Drug : DB00440 (Trimethoprim)
Interacting Gene/Enzyme : Glucose-6-phosphate 1-dehydrogenase
Gene Name : G6PD
UniProt ID : P11413
Defining Change(s) :

  • 1358T->A

Allele Name : Harima
Genotype(s) : Not Available
Type(s) : ADR Inferred
Groups : G6PD deficiency
Description : Increased risk of dose-related hemolysis.
References :

  1. Bacdivim™[package insert]. Philadelphia, Pennysylvania: Mutual Pharmaceutical Company; 2013. [Link]

PMID: 24430869

Trimethoprim

Product: Methylcobalamin

Identifier : DBSNPE003666
Drug : DB00440 (Trimethoprim)
Interacting Gene/Enzyme : Glucose-6-phosphate 1-dehydrogenase
Gene Name : G6PD
UniProt ID : P11413
Defining Change(s) :

  • 1366G->C

Allele Name : Figuera da Foz
Genotype(s) : Not Available
Type(s) : ADR Inferred
Groups : G6PD deficiency
Description : Increased risk of dose-related hemolysis.
References :

  1. Bacdivim™[package insert]. Philadelphia, Pennysylvania: Mutual Pharmaceutical Company; 2013. [Link]

PMID: 23161610

Trimethoprim

Product: Travoprost

Identifier : DBSNPE003667
Drug : DB00440 (Trimethoprim)
Interacting Gene/Enzyme : Glucose-6-phosphate 1-dehydrogenase
Gene Name : G6PD
UniProt ID : P11413
Defining Change(s) :

  • 1367A>T

Allele Name : Amiens
Genotype(s) : Not Available
Type(s) : ADR Inferred
Groups : G6PD deficiency
Description : Increased risk of dose-related hemolysis.
References :

  1. Bacdivim™[package insert]. Philadelphia, Pennysylvania: Mutual Pharmaceutical Company; 2013. [Link]

PMID: 23342115

Trimethoprim

Product: Nedaplatin

Identifier : DBSNPE003668
Drug : DB00440 (Trimethoprim)
Interacting Gene/Enzyme : Glucose-6-phosphate 1-dehydrogenase
Gene Name : G6PD
UniProt ID : P11413
Defining Change(s) :

  • 1376G->T, 1502T->G

Allele Name : Bangkok Noi
Genotype(s) : Not Available
Type(s) : ADR Inferred
Groups : G6PD deficiency
Description : Increased risk of dose-related hemolysis.
References :

  1. Bacdivim™[package insert]. Philadelphia, Pennysylvania: Mutual Pharmaceutical Company; 2013. [Link]

PMID: 23661004

Trimethoprim

Product: Reboxetine (mesylate)

Identifier : DBSNPE003669
Drug : DB00440 (Trimethoprim)
Interacting Gene/Enzyme : Glucose-6-phosphate 1-dehydrogenase
Gene Name : G6PD
UniProt ID : P11413
Defining Change(s) :

  • 1462G->A

Allele Name : Fukaya
Genotype(s) : Not Available
Type(s) : ADR Inferred
Groups : G6PD deficiency
Description : Increased risk of dose-related hemolysis.
References :

  1. Bacdivim™[package insert]. Philadelphia, Pennysylvania: Mutual Pharmaceutical Company; 2013. [Link]

PMID: 21570948

Trimethoprim

Product: Dexrazoxane

Identifier : DBSNPE003670
Drug : DB00440 (Trimethoprim)
Interacting Gene/Enzyme : Glucose-6-phosphate 1-dehydrogenase
Gene Name : G6PD
UniProt ID : P11413
Defining Change(s) :

  • 1463G->T

Allele Name : Campinas
Genotype(s) : Not Available
Type(s) : ADR Inferred
Groups : G6PD deficiency
Description : Increased risk of dose-related hemolysis.
References :

  1. Bacdivim™[package insert]. Philadelphia, Pennysylvania: Mutual Pharmaceutical Company; 2013. [Link]

PMID: 21486282

Trimethoprim

Product: Ruxolitinib (S enantiomer)

Identifier : DBSNPE003671
Drug : DB00440 (Trimethoprim)
Interacting Gene/Enzyme : Glucose-6-phosphate 1-dehydrogenase
Gene Name : G6PD
UniProt ID : P11413
Defining Change(s) :

  • 1465C>T

Allele Name : Buenos Aires
Genotype(s) : Not Available
Type(s) : ADR Inferred
Groups : G6PD deficiency
Description : Increased risk of dose-related hemolysis.
References :

  1. Bacdivim™[package insert]. Philadelphia, Pennysylvania: Mutual Pharmaceutical Company; 2013. [Link]

PMID: 20085748

Trimethoprim

Product: Oprozomib

Identifier : DBSNPE003672
Drug : DB00440 (Trimethoprim)
Interacting Gene/Enzyme : Glucose-6-phosphate 1-dehydrogenase
Gene Name : G6PD
UniProt ID : P11413
Defining Change(s) :

  • 1466C->T

Allele Name : Arakawa
Genotype(s) : Not Available
Type(s) : ADR Inferred
Groups : G6PD deficiency
Description : Increased risk of dose-related hemolysis.
References :

  1. Bacdivim™[package insert]. Philadelphia, Pennysylvania: Mutual Pharmaceutical Company; 2013. [Link]

PMID: 8135747

Trimethoprim

Product: VX-765

Identifier : DBSNPE003673
Drug : DB00440 (Trimethoprim)
Interacting Gene/Enzyme : Glucose-6-phosphate 1-dehydrogenase
Gene Name : G6PD
UniProt ID : P11413
Defining Change(s) :

  • 1488_1490delGAA

Allele Name : Brighton
Genotype(s) : Not Available
Type(s) : ADR Inferred
Groups : G6PD deficiency
Description : Increased risk of dose-related hemolysis.
References :

  1. Bacdivim™[package insert]. Philadelphia, Pennysylvania: Mutual Pharmaceutical Company; 2013. [Link]

PMID: 1720546

Trimethoprim

Product: Vardenafil (hydrochloride)

Identifier : DBSNPE003674
Drug : DB00440 (Trimethoprim)
Interacting Gene/Enzyme : Glucose-6-phosphate 1-dehydrogenase
Gene Name : G6PD
UniProt ID : P11413
Defining Change(s) :

  • 159G->C

Allele Name : Kozukata
Genotype(s) : Not Available
Type(s) : ADR Inferred
Groups : G6PD deficiency
Description : Increased risk of dose-related hemolysis.
References :

  1. Bacdivim™[package insert]. Philadelphia, Pennysylvania: Mutual Pharmaceutical Company; 2013. [Link]

PMID: 18278858

Trimethoprim

Product: Ketorolac

Identifier : DBSNPE003675
Drug : DB00440 (Trimethoprim)
Interacting Gene/Enzyme : Glucose-6-phosphate 1-dehydrogenase
Gene Name : G6PD
UniProt ID : P11413
Defining Change(s) :

  • 180_182delTCT

Allele Name : Amsterdam
Genotype(s) : Not Available
Type(s) : ADR Inferred
Groups : G6PD deficiency
Description : Increased risk of dose-related hemolysis.
References :

  1. Bacdivim™[package insert]. Philadelphia, Pennysylvania: Mutual Pharmaceutical Company; 2013. [Link]

PMID: 24650640

Trimethoprim

Product: Cyclosporin A

Identifier : DBSNPE003676
Drug : DB00440 (Trimethoprim)
Interacting Gene/Enzyme : Glucose-6-phosphate 1-dehydrogenase
Gene Name : G6PD
UniProt ID : P11413
Defining Change(s) :

  • 202G->A, 376A->G, 1264C>G

Allele Name : No name
Genotype(s) : Not Available
Type(s) : ADR Inferred
Groups : G6PD deficiency
Description : Increased risk of dose-related hemolysis.
References :

  1. Bacdivim™[package insert]. Philadelphia, Pennysylvania: Mutual Pharmaceutical Company; 2013. [Link]

PMID: 22431203

Trimethoprim

Product: Loxoprofen

Identifier : DBSNPE003677
Drug : DB00440 (Trimethoprim)
Interacting Gene/Enzyme : Glucose-6-phosphate 1-dehydrogenase
Gene Name : G6PD
UniProt ID : P11413
Defining Change(s) :

  • 224T->C

Allele Name : Swansea
Genotype(s) : Not Available
Type(s) : ADR Inferred
Groups : G6PD deficiency
Description : Increased risk of dose-related hemolysis.
References :

  1. Bacdivim™[package insert]. Philadelphia, Pennysylvania: Mutual Pharmaceutical Company; 2013. [Link]

PMID: 22473614

Trimethoprim

Product: Latanoprost

Identifier : DBSNPE003678
Drug : DB00440 (Trimethoprim)
Interacting Gene/Enzyme : Glucose-6-phosphate 1-dehydrogenase
Gene Name : G6PD
UniProt ID : P11413
Defining Change(s) :

  • 281_283delAGA

Allele Name : Urayasu
Genotype(s) : Not Available
Type(s) : ADR Inferred
Groups : G6PD deficiency
Description : Increased risk of dose-related hemolysis.
References :

  1. Bacdivim™[package insert]. Philadelphia, Pennysylvania: Mutual Pharmaceutical Company; 2013. [Link]

PMID: 9599239

Trimethoprim

Product: Catharanthine

Identifier : DBSNPE003679
Drug : DB00440 (Trimethoprim)
Interacting Gene/Enzyme : Glucose-6-phosphate 1-dehydrogenase
Gene Name : G6PD
UniProt ID : P11413
Defining Change(s) :

  • 317C->G544C->T592C->T

Allele Name : Vancouver
Genotype(s) : Not Available
Type(s) : ADR Inferred
Groups : G6PD deficiency
Description : Increased risk of dose-related hemolysis.
References :

  1. Bacdivim™[package insert]. Philadelphia, Pennysylvania: Mutual Pharmaceutical Company; 2013. [Link]

PMID: 9174343

Trimethoprim

Product: Trifluoperazine (dihydrochloride)

Identifier : DBSNPE003680
Drug : DB00440 (Trimethoprim)
Interacting Gene/Enzyme : Glucose-6-phosphate 1-dehydrogenase
Gene Name : G6PD
UniProt ID : P11413
Defining Change(s) :

  • 376A->G, 1159C->T

Allele Name : Mt Sinai
Genotype(s) : Not Available
Type(s) : ADR Inferred
Groups : G6PD deficiency
Description : Increased risk of dose-related hemolysis.
References :

  1. Bacdivim™[package insert]. Philadelphia, Pennysylvania: Mutual Pharmaceutical Company; 2013. [Link]

PMID: 12217360

Trimethoprim

Product: Triflusal

Identifier : DBSNPE003681
Drug : DB00440 (Trimethoprim)
Interacting Gene/Enzyme : Glucose-6-phosphate 1-dehydrogenase
Gene Name : G6PD
UniProt ID : P11413
Defining Change(s) :

  • 488G->A

Allele Name : Plymouth
Genotype(s) : Not Available
Type(s) : ADR Inferred
Groups : G6PD deficiency
Description : Increased risk of dose-related hemolysis.
References :

  1. Bacdivim™[package insert]. Philadelphia, Pennysylvania: Mutual Pharmaceutical Company; 2013. [Link]

PMID: 7527393

Trimethoprim

Product: Azacyclonol

Identifier : DBSNPE003682
Drug : DB00440 (Trimethoprim)
Interacting Gene/Enzyme : Glucose-6-phosphate 1-dehydrogenase
Gene Name : G6PD
UniProt ID : P11413
Defining Change(s) :

  • 514C->T

Allele Name : Volendam
Genotype(s) : Not Available
Type(s) : ADR Inferred
Groups : G6PD deficiency
Description : Increased risk of dose-related hemolysis.
References :

  1. Bacdivim™[package insert]. Philadelphia, Pennysylvania: Mutual Pharmaceutical Company; 2013. [Link]

PMID: 25248068

Trimethoprim

Product: Azlocillin (sodium salt)

Identifier : DBSNPE003683
Drug : DB00440 (Trimethoprim)
Interacting Gene/Enzyme : Glucose-6-phosphate 1-dehydrogenase
Gene Name : G6PD
UniProt ID : P11413
Defining Change(s) :

  • 527A->G

Allele Name : Shinshu
Genotype(s) : Not Available
Type(s) : ADR Inferred
Groups : G6PD deficiency
Description : Increased risk of dose-related hemolysis.
References :

  1. Bacdivim™[package insert]. Philadelphia, Pennysylvania: Mutual Pharmaceutical Company; 2013. [Link]

PMID: 1422595

Trimethoprim

Product: Octopamine (hydrochloride)

Identifier : DBSNPE003684
Drug : DB00440 (Trimethoprim)
Interacting Gene/Enzyme : Glucose-6-phosphate 1-dehydrogenase
Gene Name : G6PD
UniProt ID : P11413
Defining Change(s) :

  • 535A->T

Allele Name : Chikugo
Genotype(s) : Not Available
Type(s) : ADR Inferred
Groups : G6PD deficiency
Description : Increased risk of dose-related hemolysis.
References :

  1. Bacdivim™[package insert]. Philadelphia, Pennysylvania: Mutual Pharmaceutical Company; 2013. [Link]

PMID: 2019998

Trimethoprim

Product: Amitriptyline (hydrochloride)

Identifier : DBSNPE003685
Drug : DB00440 (Trimethoprim)
Interacting Gene/Enzyme : Glucose-6-phosphate 1-dehydrogenase
Gene Name : G6PD
UniProt ID : P11413
Defining Change(s) :

  • 561_563delCTC

Allele Name : Tsukui
Genotype(s) : Not Available
Type(s) : ADR Inferred
Groups : G6PD deficiency
Description : Increased risk of dose-related hemolysis.
References :

  1. Bacdivim™[package insert]. Philadelphia, Pennysylvania: Mutual Pharmaceutical Company; 2013. [Link]

PMID: 1963596

Trimethoprim

Product: Flumequine

Identifier : DBSNPE003686
Drug : DB00440 (Trimethoprim)
Interacting Gene/Enzyme : Glucose-6-phosphate 1-dehydrogenase
Gene Name : G6PD
UniProt ID : P11413
Defining Change(s) :

  • 573C>G

Allele Name : Pedoplis-Ckaro
Genotype(s) : Not Available
Type(s) : ADR Inferred
Groups : G6PD deficiency
Description : Increased risk of dose-related hemolysis.
References :

  1. Bacdivim™[package insert]. Philadelphia, Pennysylvania: Mutual Pharmaceutical Company; 2013. [Link]

PMID: 11341365

Trimethoprim

Product: Carbenicillin

Identifier : DBSNPE003687
Drug : DB00440 (Trimethoprim)
Interacting Gene/Enzyme : Glucose-6-phosphate 1-dehydrogenase
Gene Name : G6PD
UniProt ID : P11413
Defining Change(s) :

  • 593G->C

Allele Name : Santiago
Genotype(s) : Not Available
Type(s) : ADR Inferred
Groups : G6PD deficiency
Description : Increased risk of dose-related hemolysis.
References :

  1. Bacdivim™[package insert]. Philadelphia, Pennysylvania: Mutual Pharmaceutical Company; 2013. [Link]

PMID: 8981565

Trimethoprim

Product: Betahistine (dihydrochloride)

Identifier : DBSNPE003688
Drug : DB00440 (Trimethoprim)
Interacting Gene/Enzyme : Glucose-6-phosphate 1-dehydrogenase
Gene Name : G6PD
UniProt ID : P11413
Defining Change(s) :

  • 637G->T

Allele Name : Minnesota, Marion, Gastonia, LeJeune
Genotype(s) : Not Available
Type(s) : ADR Inferred
Groups : G6PD deficiency
Description : Increased risk of dose-related hemolysis.
References :

  1. Bacdivim™[package insert]. Philadelphia, Pennysylvania: Mutual Pharmaceutical Company; 2013. [Link]

PMID: 1691785

Trimethoprim

Product: Anagrelide (hydrochloride)

Identifier : DBSNPE003689
Drug : DB00440 (Trimethoprim)
Interacting Gene/Enzyme : Glucose-6-phosphate 1-dehydrogenase
Gene Name : G6PD
UniProt ID : P11413
Defining Change(s) :

  • 637G->T, 1037A->T

Allele Name : Cincinnati
Genotype(s) : Not Available
Type(s) : ADR Inferred
Groups : G6PD deficiency
Description : Increased risk of dose-related hemolysis.
References :

  1. Bacdivim™[package insert]. Philadelphia, Pennysylvania: Mutual Pharmaceutical Company; 2013. [Link]

PMID: 19168056

Trimethoprim

Product: Ampicillin (sodium)

Identifier : DBSNPE003690
Drug : DB00440 (Trimethoprim)
Interacting Gene/Enzyme : Glucose-6-phosphate 1-dehydrogenase
Gene Name : G6PD
UniProt ID : P11413
Defining Change(s) :

  • 648T->G

Allele Name : Harilaou
Genotype(s) : Not Available
Type(s) : ADR Inferred
Groups : G6PD deficiency
Description : Increased risk of dose-related hemolysis.
References :

  1. Bacdivim™[package insert]. Philadelphia, Pennysylvania: Mutual Pharmaceutical Company; 2013. [Link]

PMID: 18481916

Trimethoprim

Product: Ampicillin

Identifier : DBSNPE003691
Drug : DB00440 (Trimethoprim)
Interacting Gene/Enzyme : Glucose-6-phosphate 1-dehydrogenase
Gene Name : G6PD
UniProt ID : P11413
Defining Change(s) :

  • 683_685delACA

Allele Name : North Dallas
Genotype(s) : Not Available
Type(s) : ADR Inferred
Groups : G6PD deficiency
Description : Increased risk of dose-related hemolysis.
References :

  1. Bacdivim™[package insert]. Philadelphia, Pennysylvania: Mutual Pharmaceutical Company; 2013. [Link]

PMID: 10069534

Trimethoprim

Product: Altrenogest

Identifier : DBSNPE003692
Drug : DB00440 (Trimethoprim)
Interacting Gene/Enzyme : Glucose-6-phosphate 1-dehydrogenase
Gene Name : G6PD
UniProt ID : P11413
Defining Change(s) :

  • 695G->A

Allele Name : Asahikawa
Genotype(s) : Not Available
Type(s) : ADR Inferred
Groups : G6PD deficiency
Description : Increased risk of dose-related hemolysis.
References :

  1. Bacdivim™[package insert]. Philadelphia, Pennysylvania: Mutual Pharmaceutical Company; 2013. [Link]

PMID: 1346637

Trimethoprim

Product: Galanthaminone

Identifier : DBSNPE003693
Drug : DB00440 (Trimethoprim)
Interacting Gene/Enzyme : Glucose-6-phosphate 1-dehydrogenase
Gene Name : G6PD
UniProt ID : P11413
Defining Change(s) :

  • 713A->G

Allele Name : Durham
Genotype(s) : Not Available
Type(s) : ADR Inferred
Groups : G6PD deficiency
Description : Increased risk of dose-related hemolysis.
References :

  1. Bacdivim™[package insert]. Philadelphia, Pennysylvania: Mutual Pharmaceutical Company; 2013. [Link]

PMID: 8449241

Trimethoprim

Product: Benztropine (mesylate)

Identifier : DBSNPE003694
Drug : DB00440 (Trimethoprim)
Interacting Gene/Enzyme : Glucose-6-phosphate 1-dehydrogenase
Gene Name : G6PD
UniProt ID : P11413
Defining Change(s) :

  • 724_729delGGCACT

Allele Name : Stonybrook
Genotype(s) : Not Available
Type(s) : ADR Inferred
Groups : G6PD deficiency
Description : Increased risk of dose-related hemolysis.
References :

  1. Bacdivim™[package insert]. Philadelphia, Pennysylvania: Mutual Pharmaceutical Company; 2013. [Link]

PMID: 1920350

Trimethoprim

Product: Tylosin (tartrate)

Identifier : DBSNPE003695
Drug : DB00440 (Trimethoprim)
Interacting Gene/Enzyme : Glucose-6-phosphate 1-dehydrogenase
Gene Name : G6PD
UniProt ID : P11413
Defining Change(s) :

  • 769C->G

Allele Name : Wayne
Genotype(s) : Not Available
Type(s) : ADR Inferred
Groups : G6PD deficiency
Description : Increased risk of dose-related hemolysis.
References :

  1. Bacdivim™[package insert]. Philadelphia, Pennysylvania: Mutual Pharmaceutical Company; 2013. [Link]

PMID: 10205015

Trimethoprim

Product: Solifenacin (hydrochloride)

Identifier : DBSNPE003696
Drug : DB00440 (Trimethoprim)
Interacting Gene/Enzyme : Glucose-6-phosphate 1-dehydrogenase
Gene Name : G6PD
UniProt ID : P11413
Defining Change(s) :

  • 806G->A

Allele Name : Aveiro
Genotype(s) : Not Available
Type(s) : ADR Inferred
Groups : G6PD deficiency
Description : Increased risk of dose-related hemolysis.
References :

  1. Bacdivim™[package insert]. Philadelphia, Pennysylvania: Mutual Pharmaceutical Company; 2013. [Link]

PMID: 8200421

Trimethoprim

Product: Desloratadine

Identifier : DBSNPE003697
Drug : DB00440 (Trimethoprim)
Interacting Gene/Enzyme : Glucose-6-phosphate 1-dehydrogenase
Gene Name : G6PD
UniProt ID : P11413
Defining Change(s) :

  • 820G->A

Allele Name : Cleveland Corum
Genotype(s) : Not Available
Type(s) : ADR Inferred
Groups : G6PD deficiency
Description : Increased risk of dose-related hemolysis.
References :

  1. Bacdivim™[package insert]. Philadelphia, Pennysylvania: Mutual Pharmaceutical Company; 2013. [Link]

PMID: 7350532

Trimethoprim

Product: Pemirolast (potassium)

Identifier : DBSNPE003698
Drug : DB00440 (Trimethoprim)
Interacting Gene/Enzyme : Glucose-6-phosphate 1-dehydrogenase
Gene Name : G6PD
UniProt ID : P11413
Defining Change(s) :

  • 821A>T

Allele Name : Lille
Genotype(s) : Not Available
Type(s) : ADR Inferred
Groups : G6PD deficiency
Description : Increased risk of dose-related hemolysis.
References :

  1. Bacdivim™[package insert]. Philadelphia, Pennysylvania: Mutual Pharmaceutical Company; 2013. [Link]

PMID: 27080256

Trimethoprim

Product: Pentamidine (dihydrochloride)

Identifier : DBSNPE003699
Drug : DB00440 (Trimethoprim)
Interacting Gene/Enzyme : Glucose-6-phosphate 1-dehydrogenase
Gene Name : G6PD
UniProt ID : P11413
Defining Change(s) :

  • 825G>C

Allele Name : Bangkok
Genotype(s) : Not Available
Type(s) : ADR Inferred
Groups : G6PD deficiency
Description : Increased risk of dose-related hemolysis.
References :

  1. Bacdivim™[package insert]. Philadelphia, Pennysylvania: Mutual Pharmaceutical Company; 2013. [Link]

PMID: 25482946

Trimethoprim

Product: Pentamidine

Identifier : DBSNPE003700
Drug : DB00440 (Trimethoprim)
Interacting Gene/Enzyme : Glucose-6-phosphate 1-dehydrogenase
Gene Name : G6PD
UniProt ID : P11413
Defining Change(s) :

  • 826C->T

Allele Name : Sugao
Genotype(s) : Not Available
Type(s) : ADR Inferred
Groups : G6PD deficiency
Description : Increased risk of dose-related hemolysis.
References :

  1. Bacdivim™[package insert]. Philadelphia, Pennysylvania: Mutual Pharmaceutical Company; 2013. [Link]

PMID: 1868879

Trimethoprim

Product: Clinafloxacin

Identifier : DBSNPE003701
Drug : DB00440 (Trimethoprim)
Interacting Gene/Enzyme : Glucose-6-phosphate 1-dehydrogenase
Gene Name : G6PD
UniProt ID : P11413
Defining Change(s) :

  • 832T->C

Allele Name : La Jolla
Genotype(s) : Not Available
Type(s) : ADR Inferred
Groups : G6PD deficiency
Description : Increased risk of dose-related hemolysis.
References :

  1. Bacdivim™[package insert]. Philadelphia, Pennysylvania: Mutual Pharmaceutical Company; 2013. [Link]

PMID: 2776837

Trimethoprim

Product: Ethambutol (dihydrochloride)

Identifier : DBSNPE003702
Drug : DB00440 (Trimethoprim)
Interacting Gene/Enzyme : Glucose-6-phosphate 1-dehydrogenase
Gene Name : G6PD
UniProt ID : P11413
Defining Change(s) :

  • 833C->T

Allele Name : Wexham
Genotype(s) : Not Available
Type(s) : ADR Inferred
Groups : G6PD deficiency
Description : Increased risk of dose-related hemolysis.
References :

  1. Bacdivim™[package insert]. Philadelphia, Pennysylvania: Mutual Pharmaceutical Company; 2013. [Link]

PMID: 4029260

Trimethoprim

Product: Ethambutol

Identifier : DBSNPE003704
Drug : DB00440 (Trimethoprim)
Interacting Gene/Enzyme : Glucose-6-phosphate 1-dehydrogenase
Gene Name : G6PD
UniProt ID : P11413
Defining Change(s) :

  • 910G->T

Allele Name : West Virginia
Genotype(s) : Not Available
Type(s) : ADR Inferred
Groups : G6PD deficiency
Description : Increased risk of dose-related hemolysis.
References :

  1. Bacdivim™[package insert]. Philadelphia, Pennysylvania: Mutual Pharmaceutical Company; 2013. [Link]

PMID: 19407080

Trimethoprim

Product: Moclobemide

Identifier : DBSNPE003705
Drug : DB00440 (Trimethoprim)
Interacting Gene/Enzyme : Glucose-6-phosphate 1-dehydrogenase
Gene Name : G6PD
UniProt ID : P11413
Defining Change(s) :

  • 921G->C

Allele Name : Omiya
Genotype(s) : Not Available
Type(s) : ADR Inferred
Groups : G6PD deficiency
Description : Increased risk of dose-related hemolysis.
References :

  1. Bacdivim™[package insert]. Philadelphia, Pennysylvania: Mutual Pharmaceutical Company; 2013. [Link]

PMID: 25452146

Trimethoprim

Product: Amidopyrine

Identifier : DBSNPE003706
Drug : DB00440 (Trimethoprim)
Interacting Gene/Enzyme : Glucose-6-phosphate 1-dehydrogenase
Gene Name : G6PD
UniProt ID : P11413
Defining Change(s) :

  • 953_976delCCACCAAAGGGTACCTGGAC GACC

Allele Name : Nara
Genotype(s) : Not Available
Type(s) : ADR Inferred
Groups : G6PD deficiency
Description : Increased risk of dose-related hemolysis.
References :

  1. Bacdivim™[package insert]. Philadelphia, Pennysylvania: Mutual Pharmaceutical Company; 2013. [Link]

PMID: 20156687

Trimethoprim

Product: R-(-)-Deprenyl (hydrochloride)

Identifier : DBSNPE003707
Drug : DB00440 (Trimethoprim)
Interacting Gene/Enzyme : Glucose-6-phosphate 1-dehydrogenase
Gene Name : G6PD
UniProt ID : P11413
Defining Change(s) :

  • 962G->A

Allele Name : Manhattan
Genotype(s) : Not Available
Type(s) : ADR Inferred
Groups : G6PD deficiency
Description : Increased risk of dose-related hemolysis.
References :

  1. Bacdivim™[package insert]. Philadelphia, Pennysylvania: Mutual Pharmaceutical Company; 2013. [Link]

PMID: 26862589

Trimethoprim

Product: Doxorubicin

Identifier : DBSNPE003708
Drug : DB00440 (Trimethoprim)
Interacting Gene/Enzyme : Glucose-6-phosphate 1-dehydrogenase
Gene Name : G6PD
UniProt ID : P11413
Defining Change(s) :

  • 964T->C

Allele Name : Rehevot
Genotype(s) : Not Available
Type(s) : ADR Inferred
Groups : G6PD deficiency
Description : Increased risk of dose-related hemolysis.
References :

  1. Bacdivim™[package insert]. Philadelphia, Pennysylvania: Mutual Pharmaceutical Company; 2013. [Link]

PMID: 2924082

Trimethoprim

Product: Vigabatrin (Hydrochloride)

Identifier : DBSNPE003709
Drug : DB00440 (Trimethoprim)
Interacting Gene/Enzyme : Glucose-6-phosphate 1-dehydrogenase
Gene Name : G6PD
UniProt ID : P11413
Defining Change(s) :

  • 99A->G
  • 1360C->T

Allele Name : Honiara
Genotype(s) : Not Available
Type(s) : ADR Inferred
Groups : G6PD deficiency
Description : Increased risk of dose-related hemolysis.
References :

  1. Bacdivim™[package insert]. Philadelphia, Pennysylvania: Mutual Pharmaceutical Company; 2013. [Link]

PMID: 3896364

Trimethoprim

Product: U-73122

Identifier : DBSNPE003710
Drug : DB00440 (Trimethoprim)
Interacting Gene/Enzyme : Glucose-6-phosphate 1-dehydrogenase
Gene Name : G6PD
UniProt ID : P11413
Defining Change(s) :

  • 1246G->A

Allele Name : Tokyo, Fukushima
Genotype(s) : Not Available
Type(s) : ADR Inferred
Groups : G6PD deficiency
Description : Increased risk of dose-related hemolysis.
References :

  1. Bacdivim™[package insert]. Philadelphia, Pennysylvania: Mutual Pharmaceutical Company; 2013. [Link]

PMID: 15723094

Trimethoprim

Product: SB-334867 (free base)

Identifier : DBSNPE003711
Drug : DB00440 (Trimethoprim)
Interacting Gene/Enzyme : Glucose-6-phosphate 1-dehydrogenase
Gene Name : G6PD
UniProt ID : P11413
Defining Change(s) :

  • 1003G->A

Allele Name : Chatham
Genotype(s) : Not Available
Type(s) : ADR Inferred
Groups : G6PD deficiency
Description : Increased risk of dose-related hemolysis.
References :

  1. Bacdivim™[package insert]. Philadelphia, Pennysylvania: Mutual Pharmaceutical Company; 2013. [Link]

PMID: 7714776

Trimethoprim

Product: Mc-MMAE

Identifier : DBSNPE003712
Drug : DB00440 (Trimethoprim)
Interacting Gene/Enzyme : Glucose-6-phosphate 1-dehydrogenase
Gene Name : G6PD
UniProt ID : P11413
Defining Change(s) :

  • 1004C->A

Allele Name : Fushan
Genotype(s) : Not Available
Type(s) : ADR Inferred
Groups : G6PD deficiency
Description : Increased risk of dose-related hemolysis.
References :

  1. Bacdivim™[package insert]. Philadelphia, Pennysylvania: Mutual Pharmaceutical Company; 2013. [Link]

PMID: 3754610

Trimethoprim

Product: Y-320

Identifier : DBSNPE003713
Drug : DB00440 (Trimethoprim)
Interacting Gene/Enzyme : Glucose-6-phosphate 1-dehydrogenase
Gene Name : G6PD
UniProt ID : P11413
Defining Change(s) :

  • 1052G->T

Allele Name : Partenope
Genotype(s) : Not Available
Type(s) : ADR Inferred
Groups : G6PD deficiency
Description : Increased risk of dose-related hemolysis.
References :

  1. Bacdivim™[package insert]. Philadelphia, Pennysylvania: Mutual Pharmaceutical Company; 2013. [Link]

PMID: 24377382

Trimethoprim

Product: VGX-1027

Identifier : DBSNPE003714
Drug : DB00440 (Trimethoprim)
Interacting Gene/Enzyme : Glucose-6-phosphate 1-dehydrogenase
Gene Name : G6PD
UniProt ID : P11413
Defining Change(s) :

  • 1057C->T

Allele Name : Ierapediva
Genotype(s) : Not Available
Type(s) : ADR Inferred
Groups : G6PD deficiency
Description : Increased risk of dose-related hemolysis.
References :

  1. Bacdivim™[package insert]. Philadelphia, Pennysylvania: Mutual Pharmaceutical Company; 2013. [Link]

PMID: 19429792

Trimethoprim

Product: WP1066

Identifier : DBSNPE003715
Drug : DB00440 (Trimethoprim)
Interacting Gene/Enzyme : Glucose-6-phosphate 1-dehydrogenase
Gene Name : G6PD
UniProt ID : P11413
Defining Change(s) :

  • 1193A->G

Allele Name : Anadia
Genotype(s) : Not Available
Type(s) : ADR Inferred
Groups : G6PD deficiency
Description : Increased risk of dose-related hemolysis.
References :

  1. Bacdivim™[package insert]. Philadelphia, Pennysylvania: Mutual Pharmaceutical Company; 2013. [Link]

PMID: 19111597

Trimethoprim

Product: SGI-1027

Identifier : DBSNPE003716
Drug : DB00440 (Trimethoprim)
Interacting Gene/Enzyme : Glucose-6-phosphate 1-dehydrogenase
Gene Name : G6PD
UniProt ID : P11413
Defining Change(s) :

  • 1220A->C

Allele Name : Abeno
Genotype(s) : Not Available
Type(s) : ADR Inferred
Groups : G6PD deficiency
Description : Increased risk of dose-related hemolysis.
References :

  1. Bacdivim™[package insert]. Philadelphia, Pennysylvania: Mutual Pharmaceutical Company; 2013. [Link]

PMID: 7616446

Trimethoprim

Product: Naftifine (hydrochloride)

Identifier : DBSNPE003717
Drug : DB00440 (Trimethoprim)
Interacting Gene/Enzyme : Glucose-6-phosphate 1-dehydrogenase
Gene Name : G6PD
UniProt ID : P11413
Defining Change(s) :

  • 1291G->A

Allele Name : Surabaya
Genotype(s) : Not Available
Type(s) : ADR Inferred
Groups : G6PD deficiency
Description : Increased risk of dose-related hemolysis.
References :

  1. Bacdivim™[package insert]. Philadelphia, Pennysylvania: Mutual Pharmaceutical Company; 2013. [Link]

PMID: 1941609

Trimethoprim

Product: Mepivacaine (hydrochloride)

Identifier : DBSNPE003718
Drug : DB00440 (Trimethoprim)
Interacting Gene/Enzyme : Glucose-6-phosphate 1-dehydrogenase
Gene Name : G6PD
UniProt ID : P11413
Defining Change(s) :

  • 1316G->C

Allele Name : Pawnee
Genotype(s) : Not Available
Type(s) : ADR Inferred
Groups : G6PD deficiency
Description : Increased risk of dose-related hemolysis.
References :

  1. Bacdivim™[package insert]. Philadelphia, Pennysylvania: Mutual Pharmaceutical Company; 2013. [Link]

PMID: 2040358

Trimethoprim

Product: Articaine (hydrochloride)

Identifier : DBSNPE003719
Drug : DB00440 (Trimethoprim)
Interacting Gene/Enzyme : Glucose-6-phosphate 1-dehydrogenase
Gene Name : G6PD
UniProt ID : P11413
Defining Change(s) :

  • 1342A->G

Allele Name : S. Antioco
Genotype(s) : Not Available
Type(s) : ADR Inferred
Groups : G6PD deficiency
Description : Increased risk of dose-related hemolysis.
References :

  1. Bacdivim™[package insert]. Philadelphia, Pennysylvania: Mutual Pharmaceutical Company; 2013. [Link]

PMID: 1994002

Trimethoprim

Product: Ibandronate (Sodium)

Identifier : DBSNPE003720
Drug : DB00440 (Trimethoprim)
Interacting Gene/Enzyme : Glucose-6-phosphate 1-dehydrogenase
Gene Name : G6PD
UniProt ID : P11413
Defining Change(s) :

  • 1347G->C

Allele Name : Cassano
Genotype(s) : Not Available
Type(s) : ADR Inferred
Groups : G6PD deficiency
Description : Increased risk of dose-related hemolysis.
References :

  1. Bacdivim™[package insert]. Philadelphia, Pennysylvania: Mutual Pharmaceutical Company; 2013. [Link]

PMID: 2806372

Trimethoprim

Product: Ibandronic acid

Identifier : DBSNPE003721
Drug : DB00440 (Trimethoprim)
Interacting Gene/Enzyme : Glucose-6-phosphate 1-dehydrogenase
Gene Name : G6PD
UniProt ID : P11413
Defining Change(s) :

  • 1347G->C
  • 1360C->T

Allele Name : Hermoupolis
Genotype(s) : Not Available
Type(s) : ADR Inferred
Groups : G6PD deficiency
Description : Increased risk of dose-related hemolysis.
References :

  1. Bacdivim™[package insert]. Philadelphia, Pennysylvania: Mutual Pharmaceutical Company; 2013. [Link]

PMID: 3814912

Trimethoprim

Product: Ibandronate (Sodium Monohydrate)

Identifier : DBSNPE003722
Drug : DB00440 (Trimethoprim)
Interacting Gene/Enzyme : Glucose-6-phosphate 1-dehydrogenase
Gene Name : G6PD
UniProt ID : P11413
Defining Change(s) :

  • 1360C->T

Allele Name : Union,Maewo, Chinese-2, Kalo
Genotype(s) : Not Available
Type(s) : ADR Inferred
Groups : G6PD deficiency
Description : Increased risk of dose-related hemolysis.
References :

  1. Bacdivim™[package insert]. Philadelphia, Pennysylvania: Mutual Pharmaceutical Company; 2013. [Link]

PMID: 14993104

Trimethoprim

Product: Hexamethylenetetramine

Identifier : DBSNPE003723
Drug : DB00440 (Trimethoprim)
Interacting Gene/Enzyme : Glucose-6-phosphate 1-dehydrogenase
Gene Name : G6PD
UniProt ID : P11413
Defining Change(s) :

  • 1361G->A

Allele Name : Andalus
Genotype(s) : Not Available
Type(s) : ADR Inferred
Groups : G6PD deficiency
Description : Increased risk of dose-related hemolysis.
References :

  1. Bacdivim™[package insert]. Philadelphia, Pennysylvania: Mutual Pharmaceutical Company; 2013. [Link]

PMID: 12540494

Trimethoprim

Product: Methylthiouracil

Identifier : DBSNPE003724
Drug : DB00440 (Trimethoprim)
Interacting Gene/Enzyme : Glucose-6-phosphate 1-dehydrogenase
Gene Name : G6PD
UniProt ID : P11413
Defining Change(s) :

  • 1376G->C

Allele Name : Cosenza
Genotype(s) : Not Available
Type(s) : ADR Inferred
Groups : G6PD deficiency
Description : Increased risk of dose-related hemolysis.
References :

  1. Bacdivim™[package insert]. Philadelphia, Pennysylvania: Mutual Pharmaceutical Company; 2013. [Link]

PMID: 8112383

Trimethoprim

Product: Sulfamerazine (sodium salt)

Identifier : DBSNPE003725
Drug : DB00440 (Trimethoprim)
Interacting Gene/Enzyme : Glucose-6-phosphate 1-dehydrogenase
Gene Name : G6PD
UniProt ID : P11413
Defining Change(s) :

  • 1376G->T

Allele Name : Canton, Taiwan- Hakka, Gifu-like, Agrigento-like
Genotype(s) : Not Available
Type(s) : ADR Inferred
Groups : G6PD deficiency
Description : Increased risk of dose-related hemolysis.
References :

  1. Bacdivim™[package insert]. Philadelphia, Pennysylvania: Mutual Pharmaceutical Company; 2013. [Link]

PMID: 8112384

Trimethoprim

Product: Sulfamerazine

Identifier : DBSNPE003726
Drug : DB00440 (Trimethoprim)
Interacting Gene/Enzyme : Glucose-6-phosphate 1-dehydrogenase
Gene Name : G6PD
UniProt ID : P11413
Defining Change(s) :

  • 1387C->A

Allele Name : Flores
Genotype(s) : Not Available
Type(s) : ADR Inferred
Groups : G6PD deficiency
Description : Increased risk of dose-related hemolysis.
References :

  1. Bacdivim™[package insert]. Philadelphia, Pennysylvania: Mutual Pharmaceutical Company; 2013. [Link]

PMID: 10819171

Trimethoprim

Product: Biotin

Identifier : DBSNPE003727
Drug : DB00440 (Trimethoprim)
Interacting Gene/Enzyme : Glucose-6-phosphate 1-dehydrogenase
Gene Name : G6PD
UniProt ID : P11413
Defining Change(s) :

  • 1388G->A

Allele Name : Kaiping, Anant, Dhon, Sapporo-like, Wosera
Genotype(s) : Not Available
Type(s) : ADR Inferred
Groups : G6PD deficiency
Description : Increased risk of dose-related hemolysis.
References :

  1. Bacdivim™[package insert]. Philadelphia, Pennysylvania: Mutual Pharmaceutical Company; 2013. [Link]

PMID: 10632066

Trimethoprim

Product: Trimethoprim

Identifier : DBSNPE003728
Drug : DB00440 (Trimethoprim)
Interacting Gene/Enzyme : Glucose-6-phosphate 1-dehydrogenase
Gene Name : G6PD
UniProt ID : P11413
Defining Change(s) :

  • 169C->T

Allele Name : Kamogawa
Genotype(s) : Not Available
Type(s) : ADR Inferred
Groups : G6PD deficiency
Description : Increased risk of dose-related hemolysis.
References :

  1. Bacdivim™[package insert]. Philadelphia, Pennysylvania: Mutual Pharmaceutical Company; 2013. [Link]

PMID: 12359634

Trimethoprim

Product: Ornidazole

Identifier : DBSNPE003729
Drug : DB00440 (Trimethoprim)
Interacting Gene/Enzyme : Glucose-6-phosphate 1-dehydrogenase
Gene Name : G6PD
UniProt ID : P11413
Defining Change(s) :

  • 179T>C

Allele Name : Costanzo
Genotype(s) : Not Available
Type(s) : ADR Inferred
Groups : G6PD deficiency
Description : Increased risk of dose-related hemolysis.
References :

  1. Bacdivim™[package insert]. Philadelphia, Pennysylvania: Mutual Pharmaceutical Company; 2013. [Link]

PMID: 10188786

Trimethoprim

Product: Sulfathiazole (sodium)

Identifier : DBSNPE003730
Drug : DB00440 (Trimethoprim)
Interacting Gene/Enzyme : Glucose-6-phosphate 1-dehydrogenase
Gene Name : G6PD
UniProt ID : P11413
Defining Change(s) :

  • 185C->A

Allele Name : Amazonia
Genotype(s) : Not Available
Type(s) : ADR Inferred
Groups : G6PD deficiency
Description : Increased risk of dose-related hemolysis.
References :

  1. Bacdivim™[package insert]. Philadelphia, Pennysylvania: Mutual Pharmaceutical Company; 2013. [Link]

PMID: 8566131

Trimethoprim

Product: Sulfathiazole

Identifier : DBSNPE003731
Drug : DB00440 (Trimethoprim)
Interacting Gene/Enzyme : Glucose-6-phosphate 1-dehydrogenase
Gene Name : G6PD
UniProt ID : P11413
Defining Change(s) :

  • 196T->A

Allele Name : Songklanagarind
Genotype(s) : Not Available
Type(s) : ADR Inferred
Groups : G6PD deficiency
Description : Increased risk of dose-related hemolysis.
References :

  1. Bacdivim™[package insert]. Philadelphia, Pennysylvania: Mutual Pharmaceutical Company; 2013. [Link]

PMID: 12086495

Trimethoprim

Product: Nadifloxacin

Identifier : DBSNPE003732
Drug : DB00440 (Trimethoprim)
Interacting Gene/Enzyme : Glucose-6-phosphate 1-dehydrogenase
Gene Name : G6PD
UniProt ID : P11413
Defining Change(s) :

  • 202G->A
  • 871G->A

Allele Name : Hechi
Genotype(s) : Not Available
Type(s) : ADR Inferred
Groups : G6PD deficiency
Description : Increased risk of dose-related hemolysis.
References :

  1. Bacdivim™[package insert]. Philadelphia, Pennysylvania: Mutual Pharmaceutical Company; 2013. [Link]

PMID: 10556681

Trimethoprim

Product: Moguisteine

Identifier : DBSNPE003733
Drug : DB00440 (Trimethoprim)
Interacting Gene/Enzyme : Glucose-6-phosphate 1-dehydrogenase
Gene Name : G6PD
UniProt ID : P11413
Defining Change(s) :

  • 208T->C

Allele Name : Namouru
Genotype(s) : Not Available
Type(s) : ADR Inferred
Groups : G6PD deficiency
Description : Increased risk of dose-related hemolysis.
References :

  1. Bacdivim™[package insert]. Philadelphia, Pennysylvania: Mutual Pharmaceutical Company; 2013. [Link]

PMID: 9873472

Trimethoprim

Product: Creatinine

Identifier : DBSNPE003735
Drug : DB00440 (Trimethoprim)
Interacting Gene/Enzyme : Glucose-6-phosphate 1-dehydrogenase
Gene Name : G6PD
UniProt ID : P11413
Defining Change(s) :

  • 375G->T, 379G->T383T->C384C>T

Allele Name : Crispim
Genotype(s) : Not Available
Type(s) : ADR Inferred
Groups : G6PD deficiency
Description : Increased risk of dose-related hemolysis.
References :

  1. Bacdivim™[package insert]. Philadelphia, Pennysylvania: Mutual Pharmaceutical Company; 2013. [Link]

PMID: 7905771

Trimethoprim

Product: 2-Thiouracil

Identifier : DBSNPE003736
Drug : DB00440 (Trimethoprim)
Interacting Gene/Enzyme : Glucose-6-phosphate 1-dehydrogenase
Gene Name : G6PD
UniProt ID : P11413
Defining Change(s) :

  • 376A->G
  • 463C->G

Allele Name : Acrokorinthos
Genotype(s) : Not Available
Type(s) : ADR Inferred
Groups : G6PD deficiency
Description : Increased risk of dose-related hemolysis.
References :

  1. Bacdivim™[package insert]. Philadelphia, Pennysylvania: Mutual Pharmaceutical Company; 2013. [Link]

PMID: 2250662

Trimethoprim

Product: Enrofloxacin

Identifier : DBSNPE003737
Drug : DB00440 (Trimethoprim)
Interacting Gene/Enzyme : Glucose-6-phosphate 1-dehydrogenase
Gene Name : G6PD
UniProt ID : P11413
Defining Change(s) :

  • 376A->G
  • 542A->T

Allele Name : Santa Maria
Genotype(s) : Not Available
Type(s) : ADR Inferred
Groups : G6PD deficiency
Description : Increased risk of dose-related hemolysis.
References :

  1. Bacdivim™[package insert]. Philadelphia, Pennysylvania: Mutual Pharmaceutical Company; 2013. [Link]

PMID: 23092925

Trimethoprim

Product: Danofloxacin (mesylate)

Identifier : DBSNPE003738
Drug : DB00440 (Trimethoprim)
Interacting Gene/Enzyme : Glucose-6-phosphate 1-dehydrogenase
Gene Name : G6PD
UniProt ID : P11413
Defining Change(s) :

  • 376A->G
  • 871G->A

Allele Name : Ananindeua
Genotype(s) : Not Available
Type(s) : ADR Inferred
Groups : G6PD deficiency
Description : Increased risk of dose-related hemolysis.
References :

  1. Bacdivim™[package insert]. Philadelphia, Pennysylvania: Mutual Pharmaceutical Company; 2013. [Link]

PMID: 18059262

Trimethoprim

Product: Alverine (citrate)

Identifier : DBSNPE003739
Drug : DB00440 (Trimethoprim)
Interacting Gene/Enzyme : Glucose-6-phosphate 1-dehydrogenase
Gene Name : G6PD
UniProt ID : P11413
Defining Change(s) :

  • 383T->C

Allele Name : Vanua Lava
Genotype(s) : Not Available
Type(s) : ADR Inferred
Groups : G6PD deficiency
Description : Increased risk of dose-related hemolysis.
References :

  1. Bacdivim™[package insert]. Philadelphia, Pennysylvania: Mutual Pharmaceutical Company; 2013. [Link]

PMID: 18772318

Trimethoprim

Product: Otilonium (bromide)

Identifier : DBSNPE003740
Drug : DB00440 (Trimethoprim)
Interacting Gene/Enzyme : Glucose-6-phosphate 1-dehydrogenase
Gene Name : G6PD
UniProt ID : P11413
Defining Change(s) :

  • 406C->T

Allele Name : Valladolid
Genotype(s) : Not Available
Type(s) : ADR Inferred
Groups : G6PD deficiency
Description : Increased risk of dose-related hemolysis.
References :

  1. Bacdivim™[package insert]. Philadelphia, Pennysylvania: Mutual Pharmaceutical Company; 2013. [Link]

PMID: 19438238

Trimethoprim

Product: Bismuth Subsalicylate

Identifier : DBSNPE003741
Drug : DB00440 (Trimethoprim)
Interacting Gene/Enzyme : Glucose-6-phosphate 1-dehydrogenase
Gene Name : G6PD
UniProt ID : P11413
Defining Change(s) :

  • 409C->T

Allele Name : Belem
Genotype(s) : Not Available
Type(s) : ADR Inferred
Groups : G6PD deficiency
Description : Increased risk of dose-related hemolysis.
References :

  1. Bacdivim™[package insert]. Philadelphia, Pennysylvania: Mutual Pharmaceutical Company; 2013. [Link]

PMID: 20004578

Trimethoprim

Product: Flavoxate (hydrochloride)

Identifier : DBSNPE003742
Drug : DB00440 (Trimethoprim)
Interacting Gene/Enzyme : Glucose-6-phosphate 1-dehydrogenase
Gene Name : G6PD
UniProt ID : P11413
Defining Change(s) :

  • 442G->A

Allele Name : Liuzhou
Genotype(s) : Not Available
Type(s) : ADR Inferred
Groups : G6PD deficiency
Description : Increased risk of dose-related hemolysis.
References :

  1. Bacdivim™[package insert]. Philadelphia, Pennysylvania: Mutual Pharmaceutical Company; 2013. [Link]

PMID: 20801651

Trimethoprim

Product: Hydroxyzine (dihydrochloride)

Identifier : DBSNPE003743
Drug : DB00440 (Trimethoprim)
Interacting Gene/Enzyme : Glucose-6-phosphate 1-dehydrogenase
Gene Name : G6PD
UniProt ID : P11413
Defining Change(s) :

  • 473G>A

Allele Name : Shenzen
Genotype(s) : Not Available
Type(s) : ADR Inferred
Groups : G6PD deficiency
Description : Increased risk of dose-related hemolysis.
References :

  1. Bacdivim™[package insert]. Philadelphia, Pennysylvania: Mutual Pharmaceutical Company; 2013. [Link]

PMID: 24368842

Trimethoprim

Product: Hydroxyzine

Identifier : DBSNPE003744
Drug : DB00440 (Trimethoprim)
Interacting Gene/Enzyme : Glucose-6-phosphate 1-dehydrogenase
Gene Name : G6PD
UniProt ID : P11413
Defining Change(s) :

  • 493A->G

Allele Name : Taipei “Chinese- 3”
Genotype(s) : Not Available
Type(s) : ADR Inferred
Groups : G6PD deficiency
Description : Increased risk of dose-related hemolysis.
References :

  1. Bacdivim™[package insert]. Philadelphia, Pennysylvania: Mutual Pharmaceutical Company; 2013. [Link]

PMID: 23521796

Trimethoprim

Product: Homatropine (Bromide)

Identifier : DBSNPE003745
Drug : DB00440 (Trimethoprim)
Interacting Gene/Enzyme : Glucose-6-phosphate 1-dehydrogenase
Gene Name : G6PD
UniProt ID : P11413
Defining Change(s) :

  • 496C>T

Allele Name : Toledo
Genotype(s) : Not Available
Type(s) : ADR Inferred
Groups : G6PD deficiency
Description : Increased risk of dose-related hemolysis.
References :

  1. Bacdivim™[package insert]. Philadelphia, Pennysylvania: Mutual Pharmaceutical Company; 2013. [Link]

PMID: 22542104

Trimethoprim

Product: Procaine (hydrochloride)

Identifier : DBSNPE003746
Drug : DB00440 (Trimethoprim)
Interacting Gene/Enzyme : Glucose-6-phosphate 1-dehydrogenase
Gene Name : G6PD
UniProt ID : P11413
Defining Change(s) :

  • 497G->A

Allele Name : Naone
Genotype(s) : Not Available
Type(s) : ADR Inferred
Groups : G6PD deficiency
Description : Increased risk of dose-related hemolysis.
References :

  1. Bacdivim™[package insert]. Philadelphia, Pennysylvania: Mutual Pharmaceutical Company; 2013. [Link]

PMID: 23412396

Trimethoprim

Product: Procaine

Identifier : DBSNPE003747
Drug : DB00440 (Trimethoprim)
Interacting Gene/Enzyme : Glucose-6-phosphate 1-dehydrogenase
Gene Name : G6PD
UniProt ID : P11413
Defining Change(s) :

  • 517T->C

Allele Name : Nankang
Genotype(s) : Not Available
Type(s) : ADR Inferred
Groups : G6PD deficiency
Description : Increased risk of dose-related hemolysis.
References :

  1. Bacdivim™[package insert]. Philadelphia, Pennysylvania: Mutual Pharmaceutical Company; 2013. [Link]

PMID: 22937213

Trimethoprim

Product: Probenecid

Identifier : DBSNPE003749
Drug : DB00440 (Trimethoprim)
Interacting Gene/Enzyme : Glucose-6-phosphate 1-dehydrogenase
Gene Name : G6PD
UniProt ID : P11413
Defining Change(s) :

  • 563C->T

Allele Name : Mediterranean, Dallas, Panama‚ Sassari, Cagliari, Birmingham
Genotype(s) : Not Available
Type(s) : ADR Inferred
Groups : G6PD deficiency
Description : Increased risk of dose-related hemolysis.
References :

  1. Bacdivim™[package insert]. Philadelphia, Pennysylvania: Mutual Pharmaceutical Company; 2013. [Link]

PMID: 19029917

Trimethoprim

Product: Sodium Picosulfate

Identifier : DBSNPE003750
Drug : DB00440 (Trimethoprim)
Interacting Gene/Enzyme : Glucose-6-phosphate 1-dehydrogenase
Gene Name : G6PD
UniProt ID : P11413
Defining Change(s) :

  • 592C->T

Allele Name : Coimbra Shunde
Genotype(s) : Not Available
Type(s) : ADR Inferred
Groups : G6PD deficiency
Description : Increased risk of dose-related hemolysis.
References :

  1. Bacdivim™[package insert]. Philadelphia, Pennysylvania: Mutual Pharmaceutical Company; 2013. [Link]

PMID: 19666749

Trimethoprim

Product: Allylthiourea

Identifier : DBSNPE003751
Drug : DB00440 (Trimethoprim)
Interacting Gene/Enzyme : Glucose-6-phosphate 1-dehydrogenase
Gene Name : G6PD
UniProt ID : P11413
Defining Change(s) :

  • 593G>A

Allele Name : Nilgiri
Genotype(s) : Not Available
Type(s) : ADR Inferred
Groups : G6PD deficiency
Description : Increased risk of dose-related hemolysis.
References :

  1. Bacdivim™[package insert]. Philadelphia, Pennysylvania: Mutual Pharmaceutical Company; 2013. [Link]

PMID: 25752982

Trimethoprim

Product: Ouabain (Octahydrate)

Identifier : DBSNPE003752
Drug : DB00440 (Trimethoprim)
Interacting Gene/Enzyme : Glucose-6-phosphate 1-dehydrogenase
Gene Name : G6PD
UniProt ID : P11413
Defining Change(s) :

  • 679C->T

Allele Name : Radlowo
Genotype(s) : Not Available
Type(s) : ADR Inferred
Groups : G6PD deficiency
Description : Increased risk of dose-related hemolysis.
References :

  1. Bacdivim™[package insert]. Philadelphia, Pennysylvania: Mutual Pharmaceutical Company; 2013. [Link]

PMID: 22633404

Trimethoprim

Product: Cyclamic acid

Identifier : DBSNPE003753
Drug : DB00440 (Trimethoprim)
Interacting Gene/Enzyme : Glucose-6-phosphate 1-dehydrogenase
Gene Name : G6PD
UniProt ID : P11413
Defining Change(s) :

  • 811G>C

Allele Name : Roubaix
Genotype(s) : Not Available
Type(s) : ADR Inferred
Groups : G6PD deficiency
Description : Increased risk of dose-related hemolysis.
References :

  1. Bacdivim™[package insert]. Philadelphia, Pennysylvania: Mutual Pharmaceutical Company; 2013. [Link]

PMID: 16116451

Trimethoprim

Product: Bindarit

Identifier : DBSNPE003754
Drug : DB00440 (Trimethoprim)
Interacting Gene/Enzyme : Glucose-6-phosphate 1-dehydrogenase
Gene Name : G6PD
UniProt ID : P11413
Defining Change(s) :

  • 835A->G

Allele Name : Haikou
Genotype(s) : Not Available
Type(s) : ADR Inferred
Groups : G6PD deficiency
Description : Increased risk of dose-related hemolysis.
References :

  1. Bacdivim™[package insert]. Philadelphia, Pennysylvania: Mutual Pharmaceutical Company; 2013. [Link]

PMID: 20237073

Trimethoprim

Product: Niclosamide (monohydrate)

Identifier : DBSNPE003755
Drug : DB00440 (Trimethoprim)
Interacting Gene/Enzyme : Glucose-6-phosphate 1-dehydrogenase
Gene Name : G6PD
UniProt ID : P11413
Defining Change(s) :

  • 835A->T

Allele Name : Chinese-1
Genotype(s) : Not Available
Type(s) : ADR Inferred
Groups : G6PD deficiency
Description : Increased risk of dose-related hemolysis.
References :

  1. Bacdivim™[package insert]. Philadelphia, Pennysylvania: Mutual Pharmaceutical Company; 2013. [Link]

PMID: 26017782

Trimethoprim

Product: Niclosamide

Identifier : DBSNPE003756
Drug : DB00440 (Trimethoprim)
Interacting Gene/Enzyme : Glucose-6-phosphate 1-dehydrogenase
Gene Name : G6PD
UniProt ID : P11413
Defining Change(s) :

  • 848A>G

Allele Name : Mizushima
Genotype(s) : Not Available
Type(s) : ADR Inferred
Groups : G6PD deficiency
Description : Increased risk of dose-related hemolysis.
References :

  1. Bacdivim™[package insert]. Philadelphia, Pennysylvania: Mutual Pharmaceutical Company; 2013. [Link]

PMID: 15362850

Trimethoprim

Product: PMSF

Identifier : DBSNPE003757
Drug : DB00440 (Trimethoprim)
Interacting Gene/Enzyme : Glucose-6-phosphate 1-dehydrogenase
Gene Name : G6PD
UniProt ID : P11413
Defining Change(s) :

  • 853C->T

Allele Name : Osaka
Genotype(s) : Not Available
Type(s) : ADR Inferred
Groups : G6PD deficiency
Description : Increased risk of dose-related hemolysis.
References :

  1. Bacdivim™[package insert]. Philadelphia, Pennysylvania: Mutual Pharmaceutical Company; 2013. [Link]

PMID: 25522140

Trimethoprim

Product: Lamotrigine

Identifier : DBSNPE003758
Drug : DB00440 (Trimethoprim)
Interacting Gene/Enzyme : Glucose-6-phosphate 1-dehydrogenase
Gene Name : G6PD
UniProt ID : P11413
Defining Change(s) :

  • 871G->A

Allele Name : Viangchan, Jammu
Genotype(s) : Not Available
Type(s) : ADR Inferred
Groups : G6PD deficiency
Description : Increased risk of dose-related hemolysis.
References :

  1. Bacdivim™[package insert]. Philadelphia, Pennysylvania: Mutual Pharmaceutical Company; 2013. [Link]

PMID: 15804433

Trimethoprim

Product: Bufexamac

Identifier : DBSNPE003759
Drug : DB00440 (Trimethoprim)
Interacting Gene/Enzyme : Glucose-6-phosphate 1-dehydrogenase
Gene Name : G6PD
UniProt ID : P11413
Defining Change(s) :

  • 916G->A

Allele Name : Seoul
Genotype(s) : Not Available
Type(s) : ADR Inferred
Groups : G6PD deficiency
Description : Increased risk of dose-related hemolysis.
References :

  1. Bacdivim™[package insert]. Philadelphia, Pennysylvania: Mutual Pharmaceutical Company; 2013. [Link]

PMID: 7850477

Trimethoprim

Product: Niflumic acid

Identifier : DBSNPE003760
Drug : DB00440 (Trimethoprim)
Interacting Gene/Enzyme : Glucose-6-phosphate 1-dehydrogenase
Gene Name : G6PD
UniProt ID : P11413
Defining Change(s) :

  • 929G->A

Allele Name : Ludhiana
Genotype(s) : Not Available
Type(s) : ADR Inferred
Groups : G6PD deficiency
Description : Increased risk of dose-related hemolysis.
References :

  1. Bacdivim™[package insert]. Philadelphia, Pennysylvania: Mutual Pharmaceutical Company; 2013. [Link]

PMID: 16483784

Trimethoprim

Product: Paroxetine (hydrochloride)

Identifier : DBSNPE003761
Drug : DB00440 (Trimethoprim)
Interacting Gene/Enzyme : Glucose-6-phosphate 1-dehydrogenase
Gene Name : G6PD
UniProt ID : P11413
Defining Change(s) :

  • 977C->A

Allele Name : Farroupilha
Genotype(s) : Not Available
Type(s) : ADR Inferred
Groups : G6PD deficiency
Description : Increased risk of dose-related hemolysis.
References :

  1. Bacdivim™[package insert]. Philadelphia, Pennysylvania: Mutual Pharmaceutical Company; 2013. [Link]

PMID: 15080939

Trimethoprim

Product: Carbazochrome (sodium sulfonate)

Identifier : DBSNPE003762
Drug : DB00440 (Trimethoprim)
Interacting Gene/Enzyme : Glucose-6-phosphate 1-dehydrogenase
Gene Name : G6PD
UniProt ID : P11413
Defining Change(s) :

  • 1024C->T

Allele Name : Chinese-5
Genotype(s) : Not Available
Type(s) : ADR Inferred
Groups : G6PD deficiency
Description : Increased risk of dose-related hemolysis.
References :

  1. Bacdivim™[package insert]. Philadelphia, Pennysylvania: Mutual Pharmaceutical Company; 2013. [Link]

PMID: 22787427

Trimethoprim

Product: Hygromycin B

Identifier : DBSNPE003763
Drug : DB00440 (Trimethoprim)
Interacting Gene/Enzyme : Glucose-6-phosphate 1-dehydrogenase
Gene Name : G6PD
UniProt ID : P11413
Defining Change(s) :

  • 130G>A

Allele Name : Rignano
Genotype(s) : Not Available
Type(s) : ADR Inferred
Groups : G6PD deficiency
Description : Increased risk of dose-related hemolysis.
References :

  1. Bacdivim™[package insert]. Philadelphia, Pennysylvania: Mutual Pharmaceutical Company; 2013. [Link]

PMID: 20027628

Trimethoprim

Product: PF-04449913

Identifier : DBSNPE003764
Drug : DB00440 (Trimethoprim)
Interacting Gene/Enzyme : Glucose-6-phosphate 1-dehydrogenase
Gene Name : G6PD
UniProt ID : P11413
Defining Change(s) :

  • 131C->G

Allele Name : Orissa
Genotype(s) : Not Available
Type(s) : ADR Inferred
Groups : G6PD deficiency
Description : Increased risk of dose-related hemolysis.
References :

  1. Bacdivim™[package insert]. Philadelphia, Pennysylvania: Mutual Pharmaceutical Company; 2013. [Link]

PMID: 25589674

Trimethoprim

Product: Sulfamethazine

Identifier : DBSNPE003765
Drug : DB00440 (Trimethoprim)
Interacting Gene/Enzyme : Glucose-6-phosphate 1-dehydrogenase
Gene Name : G6PD
UniProt ID : P11413
Defining Change(s) :

  • 1380G>C

Allele Name : G6PDNice
Genotype(s) : Not Available
Type(s) : ADR Inferred
Groups : G6PD deficiency
Description : Increased risk of dose-related hemolysis.
References :

  1. Bacdivim™[package insert]. Philadelphia, Pennysylvania: Mutual Pharmaceutical Company; 2013. [Link]

PMID: 23856325

Trimethoprim

Product: DBeQ

Identifier : DBSNPE003766
Drug : DB00440 (Trimethoprim)
Interacting Gene/Enzyme : Glucose-6-phosphate 1-dehydrogenase
Gene Name : G6PD
UniProt ID : P11413
Defining Change(s) :

  • 1387C->T

Allele Name : Kamiube, Keelung
Genotype(s) : Not Available
Type(s) : ADR Inferred
Groups : G6PD deficiency
Description : Increased risk of dose-related hemolysis.
References :

  1. Bacdivim™[package insert]. Philadelphia, Pennysylvania: Mutual Pharmaceutical Company; 2013. [Link]

PMID: 7728753

Trimethoprim

Product: Staurosporine

Identifier : DBSNPE003767
Drug : DB00440 (Trimethoprim)
Interacting Gene/Enzyme : Glucose-6-phosphate 1-dehydrogenase
Gene Name : G6PD
UniProt ID : P11413
Defining Change(s) :

  • 1400C->G

Allele Name : Neapolis
Genotype(s) : Not Available
Type(s) : ADR Inferred
Groups : G6PD deficiency
Description : Increased risk of dose-related hemolysis.
References :

  1. Bacdivim™[package insert]. Philadelphia, Pennysylvania: Mutual Pharmaceutical Company; 2013. [Link]

PMID: 8062271

Trimethoprim

Product: RO4987655

Identifier : DBSNPE003768
Drug : DB00440 (Trimethoprim)
Interacting Gene/Enzyme : Glucose-6-phosphate 1-dehydrogenase
Gene Name : G6PD
UniProt ID : P11413
Defining Change(s) :

  • 143T->C

Allele Name : Aures
Genotype(s) : Not Available
Type(s) : ADR Inferred
Groups : G6PD deficiency
Description : Increased risk of dose-related hemolysis.
References :

  1. Bacdivim™[package insert]. Philadelphia, Pennysylvania: Mutual Pharmaceutical Company; 2013. [Link]

PMID: 8347186

Trimethoprim

Product: Vanoxerine

Identifier : DBSNPE003769
Drug : DB00440 (Trimethoprim)
Interacting Gene/Enzyme : Glucose-6-phosphate 1-dehydrogenase
Gene Name : G6PD
UniProt ID : P11413
Defining Change(s) :

  • 1442C->G

Allele Name : Split
Genotype(s) : Not Available
Type(s) : ADR Inferred
Groups : G6PD deficiency
Description : Increased risk of dose-related hemolysis.
References :

  1. Bacdivim™[package insert]. Philadelphia, Pennysylvania: Mutual Pharmaceutical Company; 2013. [Link]

PMID: 24973455

Trimethoprim

Product: Vanoxerine (dihydrochloride)

Identifier : DBSNPE003770
Drug : DB00440 (Trimethoprim)
Interacting Gene/Enzyme : Glucose-6-phosphate 1-dehydrogenase
Gene Name : G6PD
UniProt ID : P11413
Defining Change(s) :

  • 148C->T

Allele Name : Kambos
Genotype(s) : Not Available
Type(s) : ADR Inferred
Groups : G6PD deficiency
Description : Increased risk of dose-related hemolysis.
References :

  1. Bacdivim™[package insert]. Philadelphia, Pennysylvania: Mutual Pharmaceutical Company; 2013. [Link]

PMID: 25114113

Trimethoprim

Product: Indacaterol (maleate)

Identifier : DBSNPE003772
Drug : DB00440 (Trimethoprim)
Interacting Gene/Enzyme : Glucose-6-phosphate 1-dehydrogenase
Gene Name : G6PD
UniProt ID : P11413
Defining Change(s) :

  • 172G->A

Allele Name : Metaponto
Genotype(s) : Not Available
Type(s) : ADR Inferred
Groups : G6PD deficiency
Description : Increased risk of dose-related hemolysis.
References :

  1. Bacdivim™[package insert]. Philadelphia, Pennysylvania: Mutual Pharmaceutical Company; 2013. [Link]

PMID: 24662724

Trimethoprim

Product: Atovaquone

Identifier : DBSNPE003773
Drug : DB00440 (Trimethoprim)
Interacting Gene/Enzyme : Glucose-6-phosphate 1-dehydrogenase
Gene Name : G6PD
UniProt ID : P11413
Defining Change(s) :

  • 185C->T

Allele Name : Musashino
Genotype(s) : Not Available
Type(s) : ADR Inferred
Groups : G6PD deficiency
Description : Increased risk of dose-related hemolysis.
References :

  1. Bacdivim™[package insert]. Philadelphia, Pennysylvania: Mutual Pharmaceutical Company; 2013. [Link]

PMID: 24022491

Trimethoprim

Product: Diclofenac (diethylamine)

Identifier : DBSNPE003774
Drug : DB00440 (Trimethoprim)
Interacting Gene/Enzyme : Glucose-6-phosphate 1-dehydrogenase
Gene Name : G6PD
UniProt ID : P11413
Defining Change(s) :

  • 202G->A

Allele Name : Asahi
Genotype(s) : Not Available
Type(s) : ADR Inferred
Groups : G6PD deficiency
Description : Increased risk of dose-related hemolysis.
References :

  1. Bacdivim™[package insert]. Philadelphia, Pennysylvania: Mutual Pharmaceutical Company; 2013. [Link]

PMID: 23688423

Trimethoprim

Product: Medetomidine (hydrochloride)

Identifier : DBSNPE003775
Drug : DB00440 (Trimethoprim)
Interacting Gene/Enzyme : Glucose-6-phosphate 1-dehydrogenase
Gene Name : G6PD
UniProt ID : P11413
Defining Change(s) :

  • 202G->A
  • 376A->G

Allele Name : A- (202), Ferrara I
Genotype(s) : Not Available
Type(s) : ADR Inferred
Groups : G6PD deficiency
Description : Increased risk of dose-related hemolysis.
References :

  1. Bacdivim™[package insert]. Philadelphia, Pennysylvania: Mutual Pharmaceutical Company; 2013. [Link]

PMID: 22988345

Trimethoprim

Product: Kif15-IN-2

Identifier : DBSNPE003776
Drug : DB00440 (Trimethoprim)
Interacting Gene/Enzyme : Glucose-6-phosphate 1-dehydrogenase
Gene Name : G6PD
UniProt ID : P11413
Defining Change(s) :

  • 209A->G

Allele Name : Murcia Oristano
Genotype(s) : Not Available
Type(s) : ADR Inferred
Groups : G6PD deficiency
Description : Increased risk of dose-related hemolysis.
References :

  1. Bacdivim™[package insert]. Philadelphia, Pennysylvania: Mutual Pharmaceutical Company; 2013. [Link]

PMID: 22296847

Trimethoprim

Product: Kif15-IN-1

Identifier : DBSNPE003777
Drug : DB00440 (Trimethoprim)
Interacting Gene/Enzyme : Glucose-6-phosphate 1-dehydrogenase
Gene Name : G6PD
UniProt ID : P11413
Defining Change(s) :

  • 241C->T

Allele Name : Ube Konan
Genotype(s) : Not Available
Type(s) : ADR Inferred
Groups : G6PD deficiency
Description : Increased risk of dose-related hemolysis.
References :

  1. Bacdivim™[package insert]. Philadelphia, Pennysylvania: Mutual Pharmaceutical Company; 2013. [Link]

PMID: 22496348

Trimethoprim

Product: Meisoindigo

Identifier : DBSNPE003778
Drug : DB00440 (Trimethoprim)
Interacting Gene/Enzyme : Glucose-6-phosphate 1-dehydrogenase
Gene Name : G6PD
UniProt ID : P11413
Defining Change(s) :

  • 242G->A

Allele Name : Lagosanto
Genotype(s) : Not Available
Type(s) : ADR Inferred
Groups : G6PD deficiency
Description : Increased risk of dose-related hemolysis.
References :

  1. Bacdivim™[package insert]. Philadelphia, Pennysylvania: Mutual Pharmaceutical Company; 2013. [Link]

PMID: 23112050

Trimethoprim

Product: RJR-2403 (hemioxalate)

Identifier : DBSNPE003779
Drug : DB00440 (Trimethoprim)
Interacting Gene/Enzyme : Glucose-6-phosphate 1-dehydrogenase
Gene Name : G6PD
UniProt ID : P11413
Defining Change(s) :

  • 274C->T

Allele Name : Guangzhou
Genotype(s) : Not Available
Type(s) : ADR Inferred
Groups : G6PD deficiency
Description : Increased risk of dose-related hemolysis.
References :

  1. Bacdivim™[package insert]. Philadelphia, Pennysylvania: Mutual Pharmaceutical Company; 2013. [Link]

PMID: 21454702

Trimethoprim

Product: Pimecrolimus

Identifier : DBSNPE003780
Drug : DB00440 (Trimethoprim)
Interacting Gene/Enzyme : Glucose-6-phosphate 1-dehydrogenase
Gene Name : G6PD
UniProt ID : P11413
Defining Change(s) :

  • 323T->A

Allele Name : Hammersmith
Genotype(s) : Not Available
Type(s) : ADR Inferred
Groups : G6PD deficiency
Description : Increased risk of dose-related hemolysis.
References :

  1. Bacdivim™[package insert]. Philadelphia, Pennysylvania: Mutual Pharmaceutical Company; 2013. [Link]

PMID: 21829200

Trimethoprim

Product: TCS JNK 5a

Identifier : DBSNPE003781
Drug : DB00440 (Trimethoprim)
Interacting Gene/Enzyme : Glucose-6-phosphate 1-dehydrogenase
Gene Name : G6PD
UniProt ID : P11413
Defining Change(s) :

  • 34G->T

Allele Name : Sinnai
Genotype(s) : Not Available
Type(s) : ADR Inferred
Groups : G6PD deficiency
Description : Increased risk of dose-related hemolysis.
References :

  1. Bacdivim™[package insert]. Philadelphia, Pennysylvania: Mutual Pharmaceutical Company; 2013. [Link]

PMID: 21660152

Trimethoprim

Product: b-AP15

Identifier : DBSNPE003782
Drug : DB00440 (Trimethoprim)
Interacting Gene/Enzyme : Glucose-6-phosphate 1-dehydrogenase
Gene Name : G6PD
UniProt ID : P11413
Defining Change(s) :

  • 376A->G
  • 680G->T

Allele Name : A- (680)
Genotype(s) : Not Available
Type(s) : ADR Inferred
Groups : G6PD deficiency
Description : Increased risk of dose-related hemolysis.
References :

  1. Bacdivim™[package insert]. Philadelphia, Pennysylvania: Mutual Pharmaceutical Company; 2013. [Link]

PMID: 21533148

Trimethoprim

Product: R788 (disodium hexahydrate)

Identifier : DBSNPE003783
Drug : DB00440 (Trimethoprim)
Interacting Gene/Enzyme : Glucose-6-phosphate 1-dehydrogenase
Gene Name : G6PD
UniProt ID : P11413
Defining Change(s) :

  • 376A->G
  • 968T->C

Allele Name : A- (968), Betica,Selma, Guantanamo
Genotype(s) : Not Available
Type(s) : ADR Inferred
Groups : G6PD deficiency
Description : Increased risk of dose-related hemolysis.
References :

  1. Bacdivim™[package insert]. Philadelphia, Pennysylvania: Mutual Pharmaceutical Company; 2013. [Link]

PMID: 21535875

Trimethoprim

Product: ACT-132577

Identifier : DBSNPE003784
Drug : DB00440 (Trimethoprim)
Interacting Gene/Enzyme : Glucose-6-phosphate 1-dehydrogenase
Gene Name : G6PD
UniProt ID : P11413
Defining Change(s) :

  • 383T>G

Allele Name : Salerno Pyrgos
Genotype(s) : Not Available
Type(s) : ADR Inferred
Groups : G6PD deficiency
Description : Increased risk of dose-related hemolysis.
References :

  1. Bacdivim™[package insert]. Philadelphia, Pennysylvania: Mutual Pharmaceutical Company; 2013. [Link]

PMID: 23298463

Trimethoprim

Product: MI-773

Identifier : DBSNPE003785
Drug : DB00440 (Trimethoprim)
Interacting Gene/Enzyme : Glucose-6-phosphate 1-dehydrogenase
Gene Name : G6PD
UniProt ID : P11413
Defining Change(s) :

  • 392G->T

Allele Name : Quing Yan
Genotype(s) : Not Available
Type(s) : ADR Inferred
Groups : G6PD deficiency
Description : Increased risk of dose-related hemolysis.
References :

  1. Bacdivim™[package insert]. Philadelphia, Pennysylvania: Mutual Pharmaceutical Company; 2013. [Link]

PMID: 17689559

Trimethoprim

Product: BQ-788 (sodium salt)

Identifier : DBSNPE003786
Drug : DB00440 (Trimethoprim)
Interacting Gene/Enzyme : Glucose-6-phosphate 1-dehydrogenase
Gene Name : G6PD
UniProt ID : P11413
Defining Change(s) :

  • 40G->A

Allele Name : Lages
Genotype(s) : Not Available
Type(s) : ADR Inferred
Groups : G6PD deficiency
Description : Increased risk of dose-related hemolysis.
References :

  1. Bacdivim™[package insert]. Philadelphia, Pennysylvania: Mutual Pharmaceutical Company; 2013. [Link]

PMID: 11839633

Trimethoprim

Product: CEP-37440

Identifier : DBSNPE003787
Drug : DB00440 (Trimethoprim)
Interacting Gene/Enzyme : Glucose-6-phosphate 1-dehydrogenase
Gene Name : G6PD
UniProt ID : P11413
Defining Change(s) :

  • 466G->A

Allele Name : Ilesha
Genotype(s) : Not Available
Type(s) : ADR Inferred
Groups : G6PD deficiency
Description : Increased risk of dose-related hemolysis.
References :

  1. Bacdivim™[package insert]. Philadelphia, Pennysylvania: Mutual Pharmaceutical Company; 2013. [Link]

PMID: 10368126

Trimethoprim

Product: Sulfacetamide (Sodium)

Identifier : DBSNPE003788
Drug : DB00440 (Trimethoprim)
Interacting Gene/Enzyme : Glucose-6-phosphate 1-dehydrogenase
Gene Name : G6PD
UniProt ID : P11413
Defining Change(s) :

  • 487G->A

Allele Name : Mahidol
Genotype(s) : Not Available
Type(s) : ADR Inferred
Groups : G6PD deficiency
Description : Increased risk of dose-related hemolysis.
References :

  1. Bacdivim™[package insert]. Philadelphia, Pennysylvania: Mutual Pharmaceutical Company; 2013. [Link]

PMID: 25611319

Trimethoprim

Product: Triamterene

Identifier : DBSNPE003789
Drug : DB00440 (Trimethoprim)
Interacting Gene/Enzyme : Glucose-6-phosphate 1-dehydrogenase
Gene Name : G6PD
UniProt ID : P11413
Defining Change(s) :

  • 542A->T

Allele Name : Malaga
Genotype(s) : Not Available
Type(s) : ADR Inferred
Groups : G6PD deficiency
Description : Increased risk of dose-related hemolysis.
References :

  1. Bacdivim™[package insert]. Philadelphia, Pennysylvania: Mutual Pharmaceutical Company; 2013. [Link]

PMID: 21602423

Trimethoprim

Product: Mefenamic acid

Identifier : DBSNPE003790
Drug : DB00440 (Trimethoprim)
Interacting Gene/Enzyme : Glucose-6-phosphate 1-dehydrogenase
Gene Name : G6PD
UniProt ID : P11413
Defining Change(s) :

  • 634A->G

Allele Name : Sibari
Genotype(s) : Not Available
Type(s) : ADR Inferred
Groups : G6PD deficiency
Description : Increased risk of dose-related hemolysis.
References :

  1. Bacdivim™[package insert]. Philadelphia, Pennysylvania: Mutual Pharmaceutical Company; 2013. [Link]

PMID: 17678888

Trimethoprim

Product: Propranolol (hydrochloride)

Identifier : DBSNPE003791
Drug : DB00440 (Trimethoprim)
Interacting Gene/Enzyme : Glucose-6-phosphate 1-dehydrogenase
Gene Name : G6PD
UniProt ID : P11413
Defining Change(s) :

  • 680G->A

Allele Name : Mexico City
Genotype(s) : Not Available
Type(s) : ADR Inferred
Groups : G6PD deficiency
Description : Increased risk of dose-related hemolysis.
References :

  1. Bacdivim™[package insert]. Philadelphia, Pennysylvania: Mutual Pharmaceutical Company; 2013. [Link]

PMID: 1322694

Trimethoprim

Product: Zinc Pyrithione

Identifier : DBSNPE003792
Drug : DB00440 (Trimethoprim)
Interacting Gene/Enzyme : Glucose-6-phosphate 1-dehydrogenase
Gene Name : G6PD
UniProt ID : P11413
Defining Change(s) :

  • 703C->T

Allele Name : Nanning
Genotype(s) : Not Available
Type(s) : ADR Inferred
Groups : G6PD deficiency
Description : Increased risk of dose-related hemolysis.
References :

  1. Bacdivim™[package insert]. Philadelphia, Pennysylvania: Mutual Pharmaceutical Company; 2013. [Link]

PMID: 26710229

Trimethoprim

Product: Decamethonium (Bromide)

Identifier : DBSNPE003793
Drug : DB00440 (Trimethoprim)
Interacting Gene/Enzyme : Glucose-6-phosphate 1-dehydrogenase
Gene Name : G6PD
UniProt ID : P11413
Defining Change(s) :

  • 844G->C

Allele Name : Seattle, Lodi, Modena, Ferrara II, Athens-like
Genotype(s) : Not Available
Type(s) : ADR Inferred
Groups : G6PD deficiency
Description : Increased risk of dose-related hemolysis.
References :

  1. Bacdivim™[package insert]. Philadelphia, Pennysylvania: Mutual Pharmaceutical Company; 2013. [Link]

PMID: 26520569

Trimethoprim

Product: Hexamethonium (Bromide)

Identifier : DBSNPE003794
Drug : DB00440 (Trimethoprim)
Interacting Gene/Enzyme : Glucose-6-phosphate 1-dehydrogenase
Gene Name : G6PD
UniProt ID : P11413
Defining Change(s) :

  • 844G->T

Allele Name : Bajo Maumere
Genotype(s) : Not Available
Type(s) : ADR Inferred
Groups : G6PD deficiency
Description : Increased risk of dose-related hemolysis.
References :

  1. Bacdivim™[package insert]. Philadelphia, Pennysylvania: Mutual Pharmaceutical Company; 2013. [Link]

PMID: 16083752

Trimethoprim

Product: Dequalinium (Chloride)

Identifier : DBSNPE003795
Drug : DB00440 (Trimethoprim)
Interacting Gene/Enzyme : Glucose-6-phosphate 1-dehydrogenase
Gene Name : G6PD
UniProt ID : P11413
Defining Change(s) :

  • 854G->A

Allele Name : Montalbano
Genotype(s) : Not Available
Type(s) : ADR Inferred
Groups : G6PD deficiency
Description : Increased risk of dose-related hemolysis.
References :

  1. Bacdivim™[package insert]. Philadelphia, Pennysylvania: Mutual Pharmaceutical Company; 2013. [Link]

PMID: 14524532

Trimethoprim

Product: Guanabenz (Acetate)

Identifier : DBSNPE003796
Drug : DB00440 (Trimethoprim)
Interacting Gene/Enzyme : Glucose-6-phosphate 1-dehydrogenase
Gene Name : G6PD
UniProt ID : P11413
Defining Change(s) :

  • 949G->A

Allele Name : Kalyan-Kerala, Jamnaga, Rohini
Genotype(s) : Not Available
Type(s) : ADR Inferred
Groups : G6PD deficiency
Description : Increased risk of dose-related hemolysis.
References :

  1. Bacdivim™[package insert]. Philadelphia, Pennysylvania: Mutual Pharmaceutical Company; 2013. [Link]

PMID: 9364582

Trimethoprim

Product: Ronidazole

Identifier : DBSNPE003797
Drug : DB00440 (Trimethoprim)
Interacting Gene/Enzyme : Glucose-6-phosphate 1-dehydrogenase
Gene Name : G6PD
UniProt ID : P11413
Defining Change(s) :

  • 95A->G

Allele Name : Gaohe
Genotype(s) : Not Available
Type(s) : ADR Inferred
Groups : G6PD deficiency
Description : Increased risk of dose-related hemolysis.
References :

  1. Bacdivim™[package insert]. Philadelphia, Pennysylvania: Mutual Pharmaceutical Company; 2013. [Link]

PMID: 25365206

By

Related Post