PI3KInhibitorpi3kinhibitor

Sulfasalazine

By

Sulfasalazine

Product: Scopoletin

Identifier : DBSNPE000650
Drug : DB00795 (Sulfasalazine)
Interacting Gene/Enzyme : Arylamine N-acetyldivansferase 1
Gene Name : NAT1
UniProt ID : P18440
Defining Change(s) :

  • G > A | T > A | C > A (rs4986782 )

Allele Name : NAT1*14A
Genotype(s) : Not Available
Type(s) : ADR Inferred
Groups : NAT slow acetylators
Description : Increased risk of Sulfapyridine dose related adverse effects, including skin rash.
References :

  1. Chen M, Xia B, Chen B, Guo Q, Li J, Ye M, Hu Z: N-acetyldivansferase 2 slow acetylator genotype associated with adverse effects of sulphasalazine in the diveatment of inflammatory bowel disease. Can J Gasdivoenterol. 2007 Mar;21(3):155-8. [PubMed:17377643 ]

PMID: 24880091

Sulfasalazine

By

Sulfasalazine

Product: Tat-NR2B9c

Identifier : DBSNPE000651
Drug : DB00795 (Sulfasalazine)
Interacting Gene/Enzyme : Arylamine N-acetyldivansferase 1
Gene Name : NAT1
UniProt ID : P18440
Defining Change(s) :

  • G > A (rs4986782 )

Allele Name : NAT1*14B
Genotype(s) : Not Available
Type(s) : ADR Inferred
Groups : NAT slow acetylators
Description : Increased risk of Sulfapyridine dose related adverse effects, including skin rash.
References :

  1. Chen M, Xia B, Chen B, Guo Q, Li J, Ye M, Hu Z: N-acetyldivansferase 2 slow acetylator genotype associated with adverse effects of sulphasalazine in the diveatment of inflammatory bowel disease. Can J Gasdivoenterol. 2007 Mar;21(3):155-8. [PubMed:17377643 ]

PMID: 20075332

Sulfasalazine

By

Sulfasalazine

Product: Angiotensin II 5-valine

Identifier : DBSNPE000652
Drug : DB00795 (Sulfasalazine)
Interacting Gene/Enzyme : Arylamine N-acetyldivansferase 1
Gene Name : NAT1
UniProt ID : P18440
Defining Change(s) :

  • C > T (rs5030839 )

Allele Name : NAT1*15
Genotype(s) : Not Available
Type(s) : ADR Inferred
Groups : NAT slow acetylators
Description : Increased risk of Sulfapyridine dose related adverse effects, including skin rash.
References :

  1. Chen M, Xia B, Chen B, Guo Q, Li J, Ye M, Hu Z: N-acetyldivansferase 2 slow acetylator genotype associated with adverse effects of sulphasalazine in the diveatment of inflammatory bowel disease. Can J Gasdivoenterol. 2007 Mar;21(3):155-8. [PubMed:17377643 ]

PMID: 18834865

Sulfasalazine

By

Sulfasalazine

Product: Sotetsuflavone

Identifier : DBSNPE000653
Drug : DB00795 (Sulfasalazine)
Interacting Gene/Enzyme : Arylamine N-acetyldivansferase 1
Gene Name : NAT1
UniProt ID : P18440
Defining Change(s) :

  • C > T (rs56379106 )

Allele Name : NAT1*17
Genotype(s) : Not Available
Type(s) : ADR Inferred
Groups : NAT slow acetylators
Description : Increased risk of Sulfapyridine dose related adverse effects, including skin rash.
References :

  1. Chen M, Xia B, Chen B, Guo Q, Li J, Ye M, Hu Z: N-acetyldivansferase 2 slow acetylator genotype associated with adverse effects of sulphasalazine in the diveatment of inflammatory bowel disease. Can J Gasdivoenterol. 2007 Mar;21(3):155-8. [PubMed:17377643 ]

PMID: 24239623

Sulfasalazine

By

Sulfasalazine

Product: Podocarpusflavone A

Identifier : DBSNPE000654
Drug : DB00795 (Sulfasalazine)
Interacting Gene/Enzyme : Arylamine N-acetyldivansferase 1
Gene Name : NAT1
UniProt ID : P18440
Defining Change(s) :

  • C > T (rs56318881 )

Allele Name : NAT1*19A
Genotype(s) : Not Available
Type(s) : ADR Inferred
Groups : NAT slow acetylators
Description : Increased risk of Sulfapyridine dose related adverse effects, including skin rash.
References :

  1. Chen M, Xia B, Chen B, Guo Q, Li J, Ye M, Hu Z: N-acetyldivansferase 2 slow acetylator genotype associated with adverse effects of sulphasalazine in the diveatment of inflammatory bowel disease. Can J Gasdivoenterol. 2007 Mar;21(3):155-8. [PubMed:17377643 ]

PMID: 23656407

Sulfasalazine

By

Sulfasalazine

Product: Isoginkgetin

Identifier : DBSNPE000655
Drug : DB00795 (Sulfasalazine)
Interacting Gene/Enzyme : Arylamine N-acetyldivansferase 1
Gene Name : NAT1
UniProt ID : P18440
Defining Change(s) :

  • C > T | C > T (rs56318881 )

Allele Name : NAT1*19B
Genotype(s) : Not Available
Type(s) : ADR Inferred
Groups : NAT slow acetylators
Description : Increased risk of Sulfapyridine dose related adverse effects, including skin rash.
References :

  1. Chen M, Xia B, Chen B, Guo Q, Li J, Ye M, Hu Z: N-acetyldivansferase 2 slow acetylator genotype associated with adverse effects of sulphasalazine in the diveatment of inflammatory bowel disease. Can J Gasdivoenterol. 2007 Mar;21(3):155-8. [PubMed:17377643 ]

PMID: 23754287

Sulfasalazine

By

Sulfasalazine

Product: Rubusoside

Identifier : DBSNPE000656
Drug : DB00795 (Sulfasalazine)
Interacting Gene/Enzyme : Arylamine N-acetyldivansferase 1
Gene Name : NAT1
UniProt ID : P18440
Defining Change(s) :

  • A > T (rs56172717 )

Allele Name : NAT1*22
Genotype(s) : Not Available
Type(s) : ADR Inferred
Groups : NAT slow acetylators
Description : Increased risk of Sulfapyridine dose related adverse effects, including skin rash.
References :

  1. Chen M, Xia B, Chen B, Guo Q, Li J, Ye M, Hu Z: N-acetyldivansferase 2 slow acetylator genotype associated with adverse effects of sulphasalazine in the diveatment of inflammatory bowel disease. Can J Gasdivoenterol. 2007 Mar;21(3):155-8. [PubMed:17377643 ]

PMID: 16139248

Sulfasalazine

By

Sulfasalazine

Product: LY3039478

Identifier : DBSNPE000657
Drug : DB00795 (Sulfasalazine)
Interacting Gene/Enzyme : Arylamine N-acetyldivansferase 2
Gene Name : NAT2
UniProt ID : P11245
Defining Change(s) :

  • T > C | C > T (rs1801280 )

Allele Name : NAT2*5A
Genotype(s) : Not Available
Type(s) : ADR Inferred
Groups : NAT slow acetylators
Description : Increased risk of Sulfapyridine dose related adverse effects, including skin rash.
References :

  1. Chen M, Xia B, Chen B, Guo Q, Li J, Ye M, Hu Z: N-acetyldivansferase 2 slow acetylator genotype associated with adverse effects of sulphasalazine in the diveatment of inflammatory bowel disease. Can J Gasdivoenterol. 2007 Mar;21(3):155-8. [PubMed:17377643 ]

PMID: 25547114

Sulfasalazine

By

Sulfasalazine

Product: Lenampicillin (hydrochloride)

Identifier : DBSNPE000658
Drug : DB00795 (Sulfasalazine)
Interacting Gene/Enzyme : Arylamine N-acetyldivansferase 2
Gene Name : NAT2
UniProt ID : P11245
Defining Change(s) :

  • T > C | C > T | A > G (rs1801280 )

Allele Name : NAT2*5B
Genotype(s) : Not Available
Type(s) : ADR Inferred
Groups : NAT slow acetylators
Description : Increased risk of Sulfapyridine dose related adverse effects, including skin rash.
References :

  1. Chen M, Xia B, Chen B, Guo Q, Li J, Ye M, Hu Z: N-acetyldivansferase 2 slow acetylator genotype associated with adverse effects of sulphasalazine in the diveatment of inflammatory bowel disease. Can J Gasdivoenterol. 2007 Mar;21(3):155-8. [PubMed:17377643 ]

PMID: 25738359

Sulfasalazine

By

Sulfasalazine

Product: Bay 59-3074

Identifier : DBSNPE000659
Drug : DB00795 (Sulfasalazine)
Interacting Gene/Enzyme : Arylamine N-acetyldivansferase 2
Gene Name : NAT2
UniProt ID : P11245
Defining Change(s) :

  • T > C | A > G (rs1801280 )

Allele Name : NAT2*5C
Genotype(s) : Not Available
Type(s) : ADR Inferred
Groups : NAT slow acetylators
Description : Increased risk of Sulfapyridine dose related adverse effects, including skin rash.
References :

  1. Chen M, Xia B, Chen B, Guo Q, Li J, Ye M, Hu Z: N-acetyldivansferase 2 slow acetylator genotype associated with adverse effects of sulphasalazine in the diveatment of inflammatory bowel disease. Can J Gasdivoenterol. 2007 Mar;21(3):155-8. [PubMed:17377643 ]

PMID: 24086109

Sulfasalazine

By

Sulfasalazine

Product: BAY-876

Identifier : DBSNPE000660
Drug : DB00795 (Sulfasalazine)
Interacting Gene/Enzyme : Arylamine N-acetyldivansferase 2
Gene Name : NAT2
UniProt ID : P11245
Defining Change(s) :

  • T > C (rs1801280 )

Allele Name : NAT2*5D
Genotype(s) : Not Available
Type(s) : ADR Inferred
Groups : NAT slow acetylators
Description : Increased risk of Sulfapyridine dose related adverse effects, including skin rash.
References :

  1. Chen M, Xia B, Chen B, Guo Q, Li J, Ye M, Hu Z: N-acetyldivansferase 2 slow acetylator genotype associated with adverse effects of sulphasalazine in the diveatment of inflammatory bowel disease. Can J Gasdivoenterol. 2007 Mar;21(3):155-8. [PubMed:17377643 ]

PMID: 23437320

Sulfasalazine

By

Sulfasalazine

Product: Histamine (phosphate)

Identifier : DBSNPE000661
Drug : DB00795 (Sulfasalazine)
Interacting Gene/Enzyme : Arylamine N-acetyldivansferase 2
Gene Name : NAT2
UniProt ID : P11245
Defining Change(s) :

  • T > C | G > A (rs1801280 )

Allele Name : NAT2*5E
Genotype(s) : Not Available
Type(s) : ADR Inferred
Groups : NAT slow acetylators
Description : Increased risk of Sulfapyridine dose related adverse effects, including skin rash.
References :

  1. Chen M, Xia B, Chen B, Guo Q, Li J, Ye M, Hu Z: N-acetyldivansferase 2 slow acetylator genotype associated with adverse effects of sulphasalazine in the diveatment of inflammatory bowel disease. Can J Gasdivoenterol. 2007 Mar;21(3):155-8. [PubMed:17377643 ]

PMID: 17088537

Sulfasalazine

By

Sulfasalazine

Product: ML204 (hydrochloride)

Identifier : DBSNPE000662
Drug : DB00795 (Sulfasalazine)
Interacting Gene/Enzyme : Arylamine N-acetyldivansferase 2
Gene Name : NAT2
UniProt ID : P11245
Defining Change(s) :

  • T > C | C > T | C > T | A > G (rs1801280 )

Allele Name : NAT2*5F
Genotype(s) : Not Available
Type(s) : ADR Inferred
Groups : NAT slow acetylators
Description : Increased risk of Sulfapyridine dose related adverse effects, including skin rash.
References :

  1. Chen M, Xia B, Chen B, Guo Q, Li J, Ye M, Hu Z: N-acetyldivansferase 2 slow acetylator genotype associated with adverse effects of sulphasalazine in the diveatment of inflammatory bowel disease. Can J Gasdivoenterol. 2007 Mar;21(3):155-8. [PubMed:17377643 ]

PMID: 19827834

Sulfasalazine

By

Sulfasalazine

Product: Imazamox

Identifier : DBSNPE000663
Drug : DB00795 (Sulfasalazine)
Interacting Gene/Enzyme : Arylamine N-acetyldivansferase 2
Gene Name : NAT2
UniProt ID : P11245
Defining Change(s) :

  • T > C | C > T | C > T | A > G (rs1801280 )

Allele Name : NAT2*5G
Genotype(s) : Not Available
Type(s) : ADR Inferred
Groups : NAT slow acetylators
Description : Increased risk of Sulfapyridine dose related adverse effects, including skin rash.
References :

  1. Chen M, Xia B, Chen B, Guo Q, Li J, Ye M, Hu Z: N-acetyldivansferase 2 slow acetylator genotype associated with adverse effects of sulphasalazine in the diveatment of inflammatory bowel disease. Can J Gasdivoenterol. 2007 Mar;21(3):155-8. [PubMed:17377643 ]

PMID: 26267534

Sulfasalazine

By

Sulfasalazine

Product: Val-Cit-PAB-MMAE

Identifier : DBSNPE000664
Drug : DB00795 (Sulfasalazine)
Interacting Gene/Enzyme : Arylamine N-acetyldivansferase 2
Gene Name : NAT2
UniProt ID : P11245
Defining Change(s) :

  • T > C | C > T | A > G | S287 Frameshift (rs1801280 )

Allele Name : NAT2*5H
Genotype(s) : Not Available
Type(s) : ADR Inferred
Groups : NAT slow acetylators
Description : Increased risk of Sulfapyridine dose related adverse effects, including skin rash.
References :

  1. Chen M, Xia B, Chen B, Guo Q, Li J, Ye M, Hu Z: N-acetyldivansferase 2 slow acetylator genotype associated with adverse effects of sulphasalazine in the diveatment of inflammatory bowel disease. Can J Gasdivoenterol. 2007 Mar;21(3):155-8. [PubMed:17377643 ]

PMID: 26858988

Sulfasalazine

By

Sulfasalazine

Product: EMA401

Identifier : DBSNPE000665
Drug : DB00795 (Sulfasalazine)
Interacting Gene/Enzyme : Arylamine N-acetyldivansferase 2
Gene Name : NAT2
UniProt ID : P11245
Defining Change(s) :

  • T > C | C > T | A > T | A > G (rs1801280 )

Allele Name : NAT2*5I
Genotype(s) : Not Available
Type(s) : ADR Inferred
Groups : NAT slow acetylators
Description : Increased risk of Sulfapyridine dose related adverse effects, including skin rash.
References :

  1. Chen M, Xia B, Chen B, Guo Q, Li J, Ye M, Hu Z: N-acetyldivansferase 2 slow acetylator genotype associated with adverse effects of sulphasalazine in the diveatment of inflammatory bowel disease. Can J Gasdivoenterol. 2007 Mar;21(3):155-8. [PubMed:17377643 ]

PMID: 20171952

Sulfasalazine

By

Sulfasalazine

Product: Eledoisin

Identifier : DBSNPE000666
Drug : DB00795 (Sulfasalazine)
Interacting Gene/Enzyme : Arylamine N-acetyldivansferase 2
Gene Name : NAT2
UniProt ID : P11245
Defining Change(s) :

  • T > C | C > T | G > A (rs1801280 )

Allele Name : NAT2*5J
Genotype(s) : Not Available
Type(s) : ADR Inferred
Groups : NAT slow acetylators
Description : Increased risk of Sulfapyridine dose related adverse effects, including skin rash.
References :

  1. Chen M, Xia B, Chen B, Guo Q, Li J, Ye M, Hu Z: N-acetyldivansferase 2 slow acetylator genotype associated with adverse effects of sulphasalazine in the diveatment of inflammatory bowel disease. Can J Gasdivoenterol. 2007 Mar;21(3):155-8. [PubMed:17377643 ]

PMID: 17699722

Sulfasalazine

By

Sulfasalazine

Product: HO-3867

Identifier : DBSNPE000667
Drug : DB00795 (Sulfasalazine)
Interacting Gene/Enzyme : Arylamine N-acetyldivansferase 2
Gene Name : NAT2
UniProt ID : P11245
Defining Change(s) :

  • G > A | C > T (rs1799930 )

Allele Name : NAT2*6A
Genotype(s) : Not Available
Type(s) : ADR Inferred
Groups : NAT slow acetylators
Description : Increased risk of Sulfapyridine dose related adverse effects, including skin rash.
References :

  1. Chen M, Xia B, Chen B, Guo Q, Li J, Ye M, Hu Z: N-acetyldivansferase 2 slow acetylator genotype associated with adverse effects of sulphasalazine in the diveatment of inflammatory bowel disease. Can J Gasdivoenterol. 2007 Mar;21(3):155-8. [PubMed:17377643 ]

PMID: 15967103

Sulfasalazine

By

Sulfasalazine

Product: CCF642

Identifier : DBSNPE000668
Drug : DB00795 (Sulfasalazine)
Interacting Gene/Enzyme : Arylamine N-acetyldivansferase 2
Gene Name : NAT2
UniProt ID : P11245
Defining Change(s) :

  • G > A (rs1799930 )

Allele Name : NAT2*6B
Genotype(s) : Not Available
Type(s) : ADR Inferred
Groups : NAT slow acetylators
Description : Increased risk of Sulfapyridine dose related adverse effects, including skin rash.
References :

  1. Chen M, Xia B, Chen B, Guo Q, Li J, Ye M, Hu Z: N-acetyldivansferase 2 slow acetylator genotype associated with adverse effects of sulphasalazine in the diveatment of inflammatory bowel disease. Can J Gasdivoenterol. 2007 Mar;21(3):155-8. [PubMed:17377643 ]

PMID: 14633705

Sulfasalazine

By

Sulfasalazine

Product: ReACp53

Identifier : DBSNPE000669
Drug : DB00795 (Sulfasalazine)
Interacting Gene/Enzyme : Arylamine N-acetyldivansferase 2
Gene Name : NAT2
UniProt ID : P11245
Defining Change(s) :

  • G > A | C > T | A > G (rs1799930 )

Allele Name : NAT2*6C
Genotype(s) : Not Available
Type(s) : ADR Inferred
Groups : NAT slow acetylators
Description : Increased risk of Sulfapyridine dose related adverse effects, including skin rash.
References :

  1. Chen M, Xia B, Chen B, Guo Q, Li J, Ye M, Hu Z: N-acetyldivansferase 2 slow acetylator genotype associated with adverse effects of sulphasalazine in the diveatment of inflammatory bowel disease. Can J Gasdivoenterol. 2007 Mar;21(3):155-8. [PubMed:17377643 ]

PMID: 14676305

Sulfasalazine

By

Sulfasalazine

Product: Lixisenatide

Identifier : DBSNPE000670
Drug : DB00795 (Sulfasalazine)
Interacting Gene/Enzyme : Arylamine N-acetyldivansferase 2
Gene Name : NAT2
UniProt ID : P11245
Defining Change(s) :

  • G > A | C > T | T > C (rs1799930 )

Allele Name : NAT2*6D
Genotype(s) : Not Available
Type(s) : ADR Inferred
Groups : NAT slow acetylators
Description : Increased risk of Sulfapyridine dose related adverse effects, including skin rash.
References :

  1. Chen M, Xia B, Chen B, Guo Q, Li J, Ye M, Hu Z: N-acetyldivansferase 2 slow acetylator genotype associated with adverse effects of sulphasalazine in the diveatment of inflammatory bowel disease. Can J Gasdivoenterol. 2007 Mar;21(3):155-8. [PubMed:17377643 ]

PMID: 12065756

Sulfasalazine

By

Sulfasalazine

Product: Lecirelin

Identifier : DBSNPE000671
Drug : DB00795 (Sulfasalazine)
Interacting Gene/Enzyme : Arylamine N-acetyldivansferase 2
Gene Name : NAT2
UniProt ID : P11245
Defining Change(s) :

  • G > A | C > T (rs1799930 )

Allele Name : NAT2*6E
Genotype(s) : Not Available
Type(s) : ADR Inferred
Groups : NAT slow acetylators
Description : Increased risk of Sulfapyridine dose related adverse effects, including skin rash.
References :

  1. Chen M, Xia B, Chen B, Guo Q, Li J, Ye M, Hu Z: N-acetyldivansferase 2 slow acetylator genotype associated with adverse effects of sulphasalazine in the diveatment of inflammatory bowel disease. Can J Gasdivoenterol. 2007 Mar;21(3):155-8. [PubMed:17377643 ]

PMID: 12065755

Sulfasalazine

By

Sulfasalazine

Product: NS-018 (maleate)

Identifier : DBSNPE000672
Drug : DB00795 (Sulfasalazine)
Interacting Gene/Enzyme : Arylamine N-acetyldivansferase 2
Gene Name : NAT2
UniProt ID : P11245
Defining Change(s) :

  • G > A (rs1799931 )

Allele Name : NAT2*7A
Genotype(s) : Not Available
Type(s) : ADR Inferred
Groups : NAT slow acetylators
Description : Increased risk of Sulfapyridine dose related adverse effects, including skin rash.
References :

  1. Chen M, Xia B, Chen B, Guo Q, Li J, Ye M, Hu Z: N-acetyldivansferase 2 slow acetylator genotype associated with adverse effects of sulphasalazine in the diveatment of inflammatory bowel disease. Can J Gasdivoenterol. 2007 Mar;21(3):155-8. [PubMed:17377643 ]

PMID: 28302086

Sulfasalazine

By

Sulfasalazine

Product: Latrepirdine (dihydrochloride)

Identifier : DBSNPE000673
Drug : DB00795 (Sulfasalazine)
Interacting Gene/Enzyme : Arylamine N-acetyldivansferase 2
Gene Name : NAT2
UniProt ID : P11245
Defining Change(s) :

  • G > A | C > T (rs1799931 )

Allele Name : NAT2*7B
Genotype(s) : Not Available
Type(s) : ADR Inferred
Groups : NAT slow acetylators
Description : Increased risk of Sulfapyridine dose related adverse effects, including skin rash.
References :

  1. Chen M, Xia B, Chen B, Guo Q, Li J, Ye M, Hu Z: N-acetyldivansferase 2 slow acetylator genotype associated with adverse effects of sulphasalazine in the diveatment of inflammatory bowel disease. Can J Gasdivoenterol. 2007 Mar;21(3):155-8. [PubMed:17377643 ]

PMID: 26812940

Sulfasalazine

By

Sulfasalazine

Product: Tetracosactide

Identifier : DBSNPE000674
Drug : DB00795 (Sulfasalazine)
Interacting Gene/Enzyme : Arylamine N-acetyldivansferase 2
Gene Name : NAT2
UniProt ID : P11245
Defining Change(s) :

  • G > A (rs72554617 )

Allele Name : NAT2*10
Genotype(s) : Not Available
Type(s) : ADR Inferred
Groups : NAT slow acetylators
Description : Increased risk of Sulfapyridine dose related adverse effects, including skin rash.
References :

  1. Chen M, Xia B, Chen B, Guo Q, Li J, Ye M, Hu Z: N-acetyldivansferase 2 slow acetylator genotype associated with adverse effects of sulphasalazine in the diveatment of inflammatory bowel disease. Can J Gasdivoenterol. 2007 Mar;21(3):155-8. [PubMed:17377643 ]

PMID: 27783651

Sulfasalazine

By

Sulfasalazine

Product: Teriparatide

Identifier : DBSNPE000675
Drug : DB00795 (Sulfasalazine)
Interacting Gene/Enzyme : Arylamine N-acetyldivansferase 2
Gene Name : NAT2
UniProt ID : P11245
Defining Change(s) :

  • G > A | A > G (rs4986996 )

Allele Name : NAT2*12D
Genotype(s) : Not Available
Type(s) : ADR Inferred
Groups : NAT slow acetylators
Description : Increased risk of Sulfapyridine dose related adverse effects, including skin rash.
References :

  1. Chen M, Xia B, Chen B, Guo Q, Li J, Ye M, Hu Z: N-acetyldivansferase 2 slow acetylator genotype associated with adverse effects of sulphasalazine in the diveatment of inflammatory bowel disease. Can J Gasdivoenterol. 2007 Mar;21(3):155-8. [PubMed:17377643 ]

PMID: 27899163

Sulfasalazine

By

Sulfasalazine

Product: EPZ031686

Identifier : DBSNPE000676
Drug : DB00795 (Sulfasalazine)
Interacting Gene/Enzyme : Arylamine N-acetyldivansferase 2
Gene Name : NAT2
UniProt ID : P11245
Defining Change(s) :

  • G > A (rs1801279 )

Allele Name : NAT2*14A
Genotype(s) : Not Available
Type(s) : ADR Inferred
Groups : NAT slow acetylators
Description : Increased risk of Sulfapyridine dose related adverse effects, including skin rash.
References :

  1. Chen M, Xia B, Chen B, Guo Q, Li J, Ye M, Hu Z: N-acetyldivansferase 2 slow acetylator genotype associated with adverse effects of sulphasalazine in the diveatment of inflammatory bowel disease. Can J Gasdivoenterol. 2007 Mar;21(3):155-8. [PubMed:17377643 ]

PMID: 26782058

Sulfasalazine

By

Sulfasalazine

Product: OICR-9429

Identifier : DBSNPE000678
Drug : DB00795 (Sulfasalazine)
Interacting Gene/Enzyme : Arylamine N-acetyldivansferase 2
Gene Name : NAT2
UniProt ID : P11245
Defining Change(s) :

  • G > A | T > C | C > T | A > G (rs1801279 )

Allele Name : NAT2*14C
Genotype(s) : Not Available
Type(s) : ADR Inferred
Groups : NAT slow acetylators
Description : Increased risk of Sulfapyridine dose related adverse effects, including skin rash.
References :

  1. Chen M, Xia B, Chen B, Guo Q, Li J, Ye M, Hu Z: N-acetyldivansferase 2 slow acetylator genotype associated with adverse effects of sulphasalazine in the diveatment of inflammatory bowel disease. Can J Gasdivoenterol. 2007 Mar;21(3):155-8. [PubMed:17377643 ]

PMID: 27806135

Sulfasalazine

By

Sulfasalazine

Product: P7C3-A20

Identifier : DBSNPE000679
Drug : DB00795 (Sulfasalazine)
Interacting Gene/Enzyme : Arylamine N-acetyldivansferase 2
Gene Name : NAT2
UniProt ID : P11245
Defining Change(s) :

  • G > A | C > T | G > A (rs1801279 )

Allele Name : NAT2*14D
Genotype(s) : Not Available
Type(s) : ADR Inferred
Groups : NAT slow acetylators
Description : Increased risk of Sulfapyridine dose related adverse effects, including skin rash.
References :

  1. Chen M, Xia B, Chen B, Guo Q, Li J, Ye M, Hu Z: N-acetyldivansferase 2 slow acetylator genotype associated with adverse effects of sulphasalazine in the diveatment of inflammatory bowel disease. Can J Gasdivoenterol. 2007 Mar;21(3):155-8. [PubMed:17377643 ]

PMID: 26891705

Sulfasalazine

By

Sulfasalazine

Product: P7C3

Identifier : DBSNPE000680
Drug : DB00795 (Sulfasalazine)
Interacting Gene/Enzyme : Arylamine N-acetyldivansferase 2
Gene Name : NAT2
UniProt ID : P11245
Defining Change(s) :

  • G > A | A > G (rs1801279 )

Allele Name : NAT2*14E
Genotype(s) : Not Available
Type(s) : ADR Inferred
Groups : NAT slow acetylators
Description : Increased risk of Sulfapyridine dose related adverse effects, including skin rash.
References :

  1. Chen M, Xia B, Chen B, Guo Q, Li J, Ye M, Hu Z: N-acetyldivansferase 2 slow acetylator genotype associated with adverse effects of sulphasalazine in the diveatment of inflammatory bowel disease. Can J Gasdivoenterol. 2007 Mar;21(3):155-8. [PubMed:17377643 ]

PMID: 26388286

Sulfasalazine

By

Sulfasalazine

Product: MK-886

Identifier : DBSNPE000681
Drug : DB00795 (Sulfasalazine)
Interacting Gene/Enzyme : Arylamine N-acetyldivansferase 2
Gene Name : NAT2
UniProt ID : P11245
Defining Change(s) :

  • G > A | T > C | A > G (rs1801279 )

Allele Name : NAT2*14F
Genotype(s) : Not Available
Type(s) : ADR Inferred
Groups : NAT slow acetylators
Description : Increased risk of Sulfapyridine dose related adverse effects, including skin rash.
References :

  1. Chen M, Xia B, Chen B, Guo Q, Li J, Ye M, Hu Z: N-acetyldivansferase 2 slow acetylator genotype associated with adverse effects of sulphasalazine in the diveatment of inflammatory bowel disease. Can J Gasdivoenterol. 2007 Mar;21(3):155-8. [PubMed:17377643 ]

PMID: 26081042

Sulfasalazine

By

Sulfasalazine

Product: PBTZ169

Identifier : DBSNPE000682
Drug : DB00795 (Sulfasalazine)
Interacting Gene/Enzyme : Arylamine N-acetyldivansferase 2
Gene Name : NAT2
UniProt ID : P11245
Defining Change(s) :

  • G > A | C > T | A > G (rs1801279 )

Allele Name : NAT2*14G
Genotype(s) : Not Available
Type(s) : ADR Inferred
Groups : NAT slow acetylators
Description : Increased risk of Sulfapyridine dose related adverse effects, including skin rash.
References :

  1. Chen M, Xia B, Chen B, Guo Q, Li J, Ye M, Hu Z: N-acetyldivansferase 2 slow acetylator genotype associated with adverse effects of sulphasalazine in the diveatment of inflammatory bowel disease. Can J Gasdivoenterol. 2007 Mar;21(3):155-8. [PubMed:17377643 ]

PMID: 26059637

Sulfasalazine

By

Sulfasalazine

Product: Tunicamycin

Identifier : DBSNPE000683
Drug : DB00795 (Sulfasalazine)
Interacting Gene/Enzyme : Arylamine N-acetyldivansferase 2
Gene Name : NAT2
UniProt ID : P11245
Defining Change(s) :

  • A > C (rs72554616 )

Allele Name : NAT2*17
Genotype(s) : Not Available
Type(s) : ADR Inferred
Groups : NAT slow acetylators
Description : Increased risk of Sulfapyridine dose related adverse effects, including skin rash.
References :

  1. Chen M, Xia B, Chen B, Guo Q, Li J, Ye M, Hu Z: N-acetyldivansferase 2 slow acetylator genotype associated with adverse effects of sulphasalazine in the diveatment of inflammatory bowel disease. Can J Gasdivoenterol. 2007 Mar;21(3):155-8. [PubMed:17377643 ]

PMID: 25915126

Sulfasalazine

By

Sulfasalazine

Product: SIS3

Identifier : DBSNPE000684
Drug : DB00795 (Sulfasalazine)
Interacting Gene/Enzyme : Arylamine N-acetyldivansferase 2
Gene Name : NAT2
UniProt ID : P11245
Defining Change(s) :

  • C > T (rs1805158 )

Allele Name : NAT2*19
Genotype(s) : Not Available
Type(s) : ADR Inferred
Groups : NAT slow acetylators
Description : Increased risk of Sulfapyridine dose related adverse effects, including skin rash.
References :

  1. Chen M, Xia B, Chen B, Guo Q, Li J, Ye M, Hu Z: N-acetyldivansferase 2 slow acetylator genotype associated with adverse effects of sulphasalazine in the diveatment of inflammatory bowel disease. Can J Gasdivoenterol. 2007 Mar;21(3):155-8. [PubMed:17377643 ]

PMID: 25879629

Sulfasalazine

By

Sulfasalazine

Product: Nitroprusside (Sodium)

Identifier : DBSNPE003798
Drug : DB00795 (Sulfasalazine)
Interacting Gene/Enzyme : Glucose-6-phosphate 1-dehydrogenase
Gene Name : G6PD
UniProt ID : P11413
Defining Change(s) :

  • 1000_1002delACC

Allele Name : Villeurbanne
Genotype(s) : Not Available
Type(s) : ADR Inferred
Groups : G6PD deficiency
Description : Increased risk of dose-related hemolytic anemia.
References :

  1. Azulfidine®[package insert]. New York City, New York: Pharmacia & Upjohn Co; 2014. [Link]

PMID: 23659326

Sulfasalazine

By

Sulfasalazine

Product: Ropivacaine (hydrochloride monohydrate)

Identifier : DBSNPE003799
Drug : DB00795 (Sulfasalazine)
Interacting Gene/Enzyme : Glucose-6-phosphate 1-dehydrogenase
Gene Name : G6PD
UniProt ID : P11413
Defining Change(s) :

  • 1006A->G

Allele Name : Torun
Genotype(s) : Not Available
Type(s) : ADR Inferred
Groups : G6PD deficiency
Description : Increased risk of dose-related hemolytic anemia.
References :

  1. Azulfidine®[package insert]. New York City, New York: Pharmacia & Upjohn Co; 2014. [Link]

PMID: 21104120

Sulfasalazine

By

Sulfasalazine

Product: Spironolactone

Identifier : DBSNPE003800
Drug : DB00795 (Sulfasalazine)
Interacting Gene/Enzyme : Glucose-6-phosphate 1-dehydrogenase
Gene Name : G6PD
UniProt ID : P11413
Defining Change(s) :

  • 105_107delCAT

Allele Name : Sunderland
Genotype(s) : Not Available
Type(s) : ADR Inferred
Groups : G6PD deficiency
Description : Increased risk of dose-related hemolytic anemia.
References :

  1. Azulfidine®[package insert]. New York City, New York: Pharmacia & Upjohn Co; 2014. [Link]

PMID: 20067788

Sulfasalazine

By

Sulfasalazine

Product: Nabumetone

Identifier : DBSNPE003801
Drug : DB00795 (Sulfasalazine)
Interacting Gene/Enzyme : Glucose-6-phosphate 1-dehydrogenase
Gene Name : G6PD
UniProt ID : P11413
Defining Change(s) :

  • 1081G->A

Allele Name : Iwatsuki
Genotype(s) : Not Available
Type(s) : ADR Inferred
Groups : G6PD deficiency
Description : Increased risk of dose-related hemolytic anemia.
References :

  1. Azulfidine®[package insert]. New York City, New York: Pharmacia & Upjohn Co; 2014. [Link]

PMID: 22406620

Sulfasalazine

By

Sulfasalazine

Product: Carbimazole

Identifier : DBSNPE003802
Drug : DB00795 (Sulfasalazine)
Interacting Gene/Enzyme : Glucose-6-phosphate 1-dehydrogenase
Gene Name : G6PD
UniProt ID : P11413
Defining Change(s) :

  • 1082C->T

Allele Name : Serres
Genotype(s) : Not Available
Type(s) : ADR Inferred
Groups : G6PD deficiency
Description : Increased risk of dose-related hemolytic anemia.
References :

  1. Azulfidine®[package insert]. New York City, New York: Pharmacia & Upjohn Co; 2014. [Link]

PMID: 25897521

Sulfasalazine

By

Sulfasalazine

Product: Bisacodyl

Identifier : DBSNPE003803
Drug : DB00795 (Sulfasalazine)
Interacting Gene/Enzyme : Glucose-6-phosphate 1-dehydrogenase
Gene Name : G6PD
UniProt ID : P11413
Defining Change(s) :

  • 1084_1101delCTGAACGAGCGCAAGGCC

Allele Name : Tondela
Genotype(s) : Not Available
Type(s) : ADR Inferred
Groups : G6PD deficiency
Description : Increased risk of dose-related hemolytic anemia.
References :

  1. Azulfidine®[package insert]. New York City, New York: Pharmacia & Upjohn Co; 2014. [Link]

PMID: 16644899

Sulfasalazine

By

Sulfasalazine

Product: Tetrahydrozoline (hydrochloride)

Identifier : DBSNPE003805
Drug : DB00795 (Sulfasalazine)
Interacting Gene/Enzyme : Glucose-6-phosphate 1-dehydrogenase
Gene Name : G6PD
UniProt ID : P11413
Defining Change(s) :

  • 1089C->G

Allele Name : Aachen
Genotype(s) : Not Available
Type(s) : ADR Inferred
Groups : G6PD deficiency
Description : Increased risk of dose-related hemolytic anemia.
References :

  1. Azulfidine®[package insert]. New York City, New York: Pharmacia & Upjohn Co; 2014. [Link]

PMID: 11911256

Sulfasalazine

By

Sulfasalazine

Product: Nafcillin (sodium monohydrate)

Identifier : DBSNPE003806
Drug : DB00795 (Sulfasalazine)
Interacting Gene/Enzyme : Glucose-6-phosphate 1-dehydrogenase
Gene Name : G6PD
UniProt ID : P11413
Defining Change(s) :

  • 1096A->G

Allele Name : Tenri
Genotype(s) : Not Available
Type(s) : ADR Inferred
Groups : G6PD deficiency
Description : Increased risk of dose-related hemolytic anemia.
References :

  1. Azulfidine®[package insert]. New York City, New York: Pharmacia & Upjohn Co; 2014. [Link]

PMID: 10858013

Sulfasalazine

By

Sulfasalazine

Product: Norethindrone

Identifier : DBSNPE003807
Drug : DB00795 (Sulfasalazine)
Interacting Gene/Enzyme : Glucose-6-phosphate 1-dehydrogenase
Gene Name : G6PD
UniProt ID : P11413
Defining Change(s) :

  • 1132G>A

Allele Name : Montpellier
Genotype(s) : Not Available
Type(s) : ADR Inferred
Groups : G6PD deficiency
Description : Increased risk of dose-related hemolytic anemia.
References :

  1. Azulfidine®[package insert]. New York City, New York: Pharmacia & Upjohn Co; 2014. [Link]

PMID: 11997287

Sulfasalazine

By

Sulfasalazine

Product: PF-562271 (besylate)

Identifier : DBSNPE003809
Drug : DB00795 (Sulfasalazine)
Interacting Gene/Enzyme : Glucose-6-phosphate 1-dehydrogenase
Gene Name : G6PD
UniProt ID : P11413
Defining Change(s) :

  • 1139T->C

Allele Name : Riley
Genotype(s) : Not Available
Type(s) : ADR Inferred
Groups : G6PD deficiency
Description : Increased risk of dose-related hemolytic anemia.
References :

  1. Azulfidine®[package insert]. New York City, New York: Pharmacia & Upjohn Co; 2014. [Link]

PMID: 11342481

Sulfasalazine

By

Sulfasalazine

Product: AMG 487

Identifier : DBSNPE003810
Drug : DB00795 (Sulfasalazine)
Interacting Gene/Enzyme : Glucose-6-phosphate 1-dehydrogenase
Gene Name : G6PD
UniProt ID : P11413
Defining Change(s) :

  • 1141T->C

Allele Name : Olomouc
Genotype(s) : Not Available
Type(s) : ADR Inferred
Groups : G6PD deficiency
Description : Increased risk of dose-related hemolytic anemia.
References :

  1. Azulfidine®[package insert]. New York City, New York: Pharmacia & Upjohn Co; 2014. [Link]

PMID: 10649971

Sulfasalazine

By

Sulfasalazine

Product: (S)-(+)-Modafinic acid

Identifier : DBSNPE003811
Drug : DB00795 (Sulfasalazine)
Interacting Gene/Enzyme : Glucose-6-phosphate 1-dehydrogenase
Gene Name : G6PD
UniProt ID : P11413
Defining Change(s) :

  • 1153T->C

Allele Name : Tomah
Genotype(s) : Not Available
Type(s) : ADR Inferred
Groups : G6PD deficiency
Description : Increased risk of dose-related hemolytic anemia.
References :

  1. Azulfidine®[package insert]. New York City, New York: Pharmacia & Upjohn Co; 2014. [Link]

PMID: 9179398

Sulfasalazine

By

Sulfasalazine

Product: (R)-(-)-Modafinic acid

Identifier : DBSNPE003812
Drug : DB00795 (Sulfasalazine)
Interacting Gene/Enzyme : Glucose-6-phosphate 1-dehydrogenase
Gene Name : G6PD
UniProt ID : P11413
Defining Change(s) :

  • 1154G->T

Allele Name : Lynwood
Genotype(s) : Not Available
Type(s) : ADR Inferred
Groups : G6PD deficiency
Description : Increased risk of dose-related hemolytic anemia.
References :

  1. Azulfidine®[package insert]. New York City, New York: Pharmacia & Upjohn Co; 2014. [Link]

PMID: 23077716

Sulfasalazine

By

Sulfasalazine

Product: Methazolamide

Identifier : DBSNPE003813
Drug : DB00795 (Sulfasalazine)
Interacting Gene/Enzyme : Glucose-6-phosphate 1-dehydrogenase
Gene Name : G6PD
UniProt ID : P11413
Defining Change(s) :

  • 1155C->G

Allele Name : Madrid
Genotype(s) : Not Available
Type(s) : ADR Inferred
Groups : G6PD deficiency
Description : Increased risk of dose-related hemolytic anemia.
References :

  1. Azulfidine®[package insert]. New York City, New York: Pharmacia & Upjohn Co; 2014. [Link]

PMID: 16000631

Sulfasalazine

By

Sulfasalazine

Product: Dibucaine (hydrochloride)

Identifier : DBSNPE003814
Drug : DB00795 (Sulfasalazine)
Interacting Gene/Enzyme : Glucose-6-phosphate 1-dehydrogenase
Gene Name : G6PD
UniProt ID : P11413
Defining Change(s) :

  • 1156A->G

Allele Name : Iowa, Walter Reed, Springfield
Genotype(s) : Not Available
Type(s) : ADR Inferred
Groups : G6PD deficiency
Description : Increased risk of dose-related hemolytic anemia.
References :

  1. Azulfidine®[package insert]. New York City, New York: Pharmacia & Upjohn Co; 2014. [Link]

PMID: 11278946

Sulfasalazine

By

Sulfasalazine

Product: Dibucaine

Identifier : DBSNPE003815
Drug : DB00795 (Sulfasalazine)
Interacting Gene/Enzyme : Glucose-6-phosphate 1-dehydrogenase
Gene Name : G6PD
UniProt ID : P11413
Defining Change(s) :

  • 1160G->A

Allele Name : Beverly Hills, Genova, Iwate, Niigata, Yamaguchi
Genotype(s) : Not Available
Type(s) : ADR Inferred
Groups : G6PD deficiency
Description : Increased risk of dose-related hemolytic anemia.
References :

  1. Azulfidine®[package insert]. New York City, New York: Pharmacia & Upjohn Co; 2014. [Link]

PMID: 20726512

Sulfasalazine

By

Sulfasalazine

Product: Doxapram (hydrochloride hydrate)

Identifier : DBSNPE003816
Drug : DB00795 (Sulfasalazine)
Interacting Gene/Enzyme : Glucose-6-phosphate 1-dehydrogenase
Gene Name : G6PD
UniProt ID : P11413
Defining Change(s) :

  • 1162A->G

Allele Name : Hartford
Genotype(s) : Not Available
Type(s) : ADR Inferred
Groups : G6PD deficiency
Description : Increased risk of dose-related hemolytic anemia.
References :

  1. Azulfidine®[package insert]. New York City, New York: Pharmacia & Upjohn Co; 2014. [Link]

PMID: 11229774

Sulfasalazine

By

Sulfasalazine

Product: Doxapram

Identifier : DBSNPE003817
Drug : DB00795 (Sulfasalazine)
Interacting Gene/Enzyme : Glucose-6-phosphate 1-dehydrogenase
Gene Name : G6PD
UniProt ID : P11413
Defining Change(s) :

  • 1166A->G

Allele Name : Praha
Genotype(s) : Not Available
Type(s) : ADR Inferred
Groups : G6PD deficiency
Description : Increased risk of dose-related hemolytic anemia.
References :

  1. Azulfidine®[package insert]. New York City, New York: Pharmacia & Upjohn Co; 2014. [Link]

PMID: 12877590

Sulfasalazine

By

Sulfasalazine

Product: Avanafil

Identifier : DBSNPE003818
Drug : DB00795 (Sulfasalazine)
Interacting Gene/Enzyme : Glucose-6-phosphate 1-dehydrogenase
Gene Name : G6PD
UniProt ID : P11413
Defining Change(s) :

  • 1175T>C

Allele Name : Krakow
Genotype(s) : Not Available
Type(s) : ADR Inferred
Groups : G6PD deficiency
Description : Increased risk of dose-related hemolytic anemia.
References :

  1. Azulfidine®[package insert]. New York City, New York: Pharmacia & Upjohn Co; 2014. [Link]

PMID: 25457675

Sulfasalazine

By

Sulfasalazine

Product: L-Hyoscyamine

Identifier : DBSNPE003819
Drug : DB00795 (Sulfasalazine)
Interacting Gene/Enzyme : Glucose-6-phosphate 1-dehydrogenase
Gene Name : G6PD
UniProt ID : P11413
Defining Change(s) :

  • 1177C->G

Allele Name : Wisconsin
Genotype(s) : Not Available
Type(s) : ADR Inferred
Groups : G6PD deficiency
Description : Increased risk of dose-related hemolytic anemia.
References :

  1. Azulfidine®[package insert]. New York City, New York: Pharmacia & Upjohn Co; 2014. [Link]

PMID: 18945617

Sulfasalazine

By

Sulfasalazine

Product: Ampiroxicam

Identifier : DBSNPE003820
Drug : DB00795 (Sulfasalazine)
Interacting Gene/Enzyme : Glucose-6-phosphate 1-dehydrogenase
Gene Name : G6PD
UniProt ID : P11413
Defining Change(s) :

  • 1178G->A

Allele Name : Nashville, Anaheim, Portici
Genotype(s) : Not Available
Type(s) : ADR Inferred
Groups : G6PD deficiency
Description : Increased risk of dose-related hemolytic anemia.
References :

  1. Azulfidine®[package insert]. New York City, New York: Pharmacia & Upjohn Co; 2014. [Link]

PMID: 17591762

Sulfasalazine

By

Sulfasalazine

Product: Acebutolol (hydrochloride)

Identifier : DBSNPE003821
Drug : DB00795 (Sulfasalazine)
Interacting Gene/Enzyme : Glucose-6-phosphate 1-dehydrogenase
Gene Name : G6PD
UniProt ID : P11413
Defining Change(s) :

  • 1180G->C

Allele Name : Alhambra
Genotype(s) : Not Available
Type(s) : ADR Inferred
Groups : G6PD deficiency
Description : Increased risk of dose-related hemolytic anemia.
References :

  1. Azulfidine®[package insert]. New York City, New York: Pharmacia & Upjohn Co; 2014. [Link]

PMID: 16854779

Sulfasalazine

By

Sulfasalazine

Product: Doxycycline (hydrochloride)

Identifier : DBSNPE003822
Drug : DB00795 (Sulfasalazine)
Interacting Gene/Enzyme : Glucose-6-phosphate 1-dehydrogenase
Gene Name : G6PD
UniProt ID : P11413
Defining Change(s) :

  • 1187C->T

Allele Name : Bari
Genotype(s) : Not Available
Type(s) : ADR Inferred
Groups : G6PD deficiency
Description : Increased risk of dose-related hemolytic anemia.
References :

  1. Azulfidine®[package insert]. New York City, New York: Pharmacia & Upjohn Co; 2014. [Link]

PMID: 22610965

Sulfasalazine

By

Sulfasalazine

Product: Pergolide (mesylate)

Identifier : DBSNPE003823
Drug : DB00795 (Sulfasalazine)
Interacting Gene/Enzyme : Glucose-6-phosphate 1-dehydrogenase
Gene Name : G6PD
UniProt ID : P11413
Defining Change(s) :

  • 1192G->A

Allele Name : Puerto Limon
Genotype(s) : Not Available
Type(s) : ADR Inferred
Groups : G6PD deficiency
Description : Increased risk of dose-related hemolytic anemia.
References :

  1. Azulfidine®[package insert]. New York City, New York: Pharmacia & Upjohn Co; 2014. [Link]

PMID: 21951056

Sulfasalazine

By

Sulfasalazine

Product: Balicatib

Identifier : DBSNPE003824
Drug : DB00795 (Sulfasalazine)
Interacting Gene/Enzyme : Glucose-6-phosphate 1-dehydrogenase
Gene Name : G6PD
UniProt ID : P11413
Defining Change(s) :

  • 1205C>A

Allele Name : Covao do Lobo
Genotype(s) : Not Available
Type(s) : ADR Inferred
Groups : G6PD deficiency
Description : Increased risk of dose-related hemolytic anemia.
References :

  1. Azulfidine®[package insert]. New York City, New York: Pharmacia & Upjohn Co; 2014. [Link]

PMID: 17980460

Sulfasalazine

By

Sulfasalazine

Product: Cinepazide

Identifier : DBSNPE003825
Drug : DB00795 (Sulfasalazine)
Interacting Gene/Enzyme : Glucose-6-phosphate 1-dehydrogenase
Gene Name : G6PD
UniProt ID : P11413
Defining Change(s) :

  • 1215G->A

Allele Name : Clinic
Genotype(s) : Not Available
Type(s) : ADR Inferred
Groups : G6PD deficiency
Description : Increased risk of dose-related hemolytic anemia.
References :

  1. Azulfidine®[package insert]. New York City, New York: Pharmacia & Upjohn Co; 2014. [Link]

PMID: 22593577

Sulfasalazine

By

Sulfasalazine

Product: Cinepazide (Maleate)

Identifier : DBSNPE003826
Drug : DB00795 (Sulfasalazine)
Interacting Gene/Enzyme : Glucose-6-phosphate 1-dehydrogenase
Gene Name : G6PD
UniProt ID : P11413
Defining Change(s) :

  • 1225C->T

Allele Name : Udivecht
Genotype(s) : Not Available
Type(s) : ADR Inferred
Groups : G6PD deficiency
Description : Increased risk of dose-related hemolytic anemia.
References :

  1. Azulfidine®[package insert]. New York City, New York: Pharmacia & Upjohn Co; 2014. [Link]

PMID: 21841791

Sulfasalazine

By

Sulfasalazine

Product: Amoxicillin (trihydrate)

Identifier : DBSNPE003827
Drug : DB00795 (Sulfasalazine)
Interacting Gene/Enzyme : Glucose-6-phosphate 1-dehydrogenase
Gene Name : G6PD
UniProt ID : P11413
Defining Change(s) :

  • 1226C->G

Allele Name : Suwalki
Genotype(s) : Not Available
Type(s) : ADR Inferred
Groups : G6PD deficiency
Description : Increased risk of dose-related hemolytic anemia.
References :

  1. Azulfidine®[package insert]. New York City, New York: Pharmacia & Upjohn Co; 2014. [Link]

PMID: 25915127

Sulfasalazine

By

Sulfasalazine

Product: Amoxicillin

Identifier : DBSNPE003828
Drug : DB00795 (Sulfasalazine)
Interacting Gene/Enzyme : Glucose-6-phosphate 1-dehydrogenase
Gene Name : G6PD
UniProt ID : P11413
Defining Change(s) :

  • 1228G->T

Allele Name : Riverside
Genotype(s) : Not Available
Type(s) : ADR Inferred
Groups : G6PD deficiency
Description : Increased risk of dose-related hemolytic anemia.
References :

  1. Azulfidine®[package insert]. New York City, New York: Pharmacia & Upjohn Co; 2014. [Link]

PMID: 26493500

Sulfasalazine

By

Sulfasalazine

Product: Nilvadipine

Identifier : DBSNPE003830
Drug : DB00795 (Sulfasalazine)
Interacting Gene/Enzyme : Glucose-6-phosphate 1-dehydrogenase
Gene Name : G6PD
UniProt ID : P11413
Defining Change(s) :

  • 1229G->C

Allele Name : Kawasaki
Genotype(s) : Not Available
Type(s) : ADR Inferred
Groups : G6PD deficiency
Description : Increased risk of dose-related hemolytic anemia.
References :

  1. Azulfidine®[package insert]. New York City, New York: Pharmacia & Upjohn Co; 2014. [Link]

PMID: 26695765

Sulfasalazine

By

Sulfasalazine

Product: Norepinephrine (hydrochloride)

Identifier : DBSNPE003831
Drug : DB00795 (Sulfasalazine)
Interacting Gene/Enzyme : Glucose-6-phosphate 1-dehydrogenase
Gene Name : G6PD
UniProt ID : P11413
Defining Change(s) :

  • 1231A->G

Allele Name : Munich
Genotype(s) : Not Available
Type(s) : ADR Inferred
Groups : G6PD deficiency
Description : Increased risk of dose-related hemolytic anemia.
References :

  1. Azulfidine®[package insert]. New York City, New York: Pharmacia & Upjohn Co; 2014. [Link]

PMID: 25706534

Sulfasalazine

By

Sulfasalazine

Product: Norepinephrine (bitartrate monohydrate)

Identifier : DBSNPE003832
Drug : DB00795 (Sulfasalazine)
Interacting Gene/Enzyme : Glucose-6-phosphate 1-dehydrogenase
Gene Name : G6PD
UniProt ID : P11413
Defining Change(s) :

  • 1284C->A

Allele Name : Georgia
Genotype(s) : Not Available
Type(s) : ADR Inferred
Groups : G6PD deficiency
Description : Increased risk of dose-related hemolytic anemia.
References :

  1. Azulfidine®[package insert]. New York City, New York: Pharmacia & Upjohn Co; 2014. [Link]

PMID: 26139150

Sulfasalazine

By

Sulfasalazine

Product: Arecoline (hydrobromide)

Identifier : DBSNPE003833
Drug : DB00795 (Sulfasalazine)
Interacting Gene/Enzyme : Glucose-6-phosphate 1-dehydrogenase
Gene Name : G6PD
UniProt ID : P11413
Defining Change(s) :

  • 1292T->G

Allele Name : Sumare
Genotype(s) : Not Available
Type(s) : ADR Inferred
Groups : G6PD deficiency
Description : Increased risk of dose-related hemolytic anemia.
References :

  1. Azulfidine®[package insert]. New York City, New York: Pharmacia & Upjohn Co; 2014. [Link]

PMID: 25454631

Sulfasalazine

By

Sulfasalazine

Product: Ethisterone

Identifier : DBSNPE003834
Drug : DB00795 (Sulfasalazine)
Interacting Gene/Enzyme : Glucose-6-phosphate 1-dehydrogenase
Gene Name : G6PD
UniProt ID : P11413
Defining Change(s) :

  • 1318C->T

Allele Name : Telti/Kobe
Genotype(s) : Not Available
Type(s) : ADR Inferred
Groups : G6PD deficiency
Description : Increased risk of dose-related hemolytic anemia.
References :

  1. Azulfidine®[package insert]. New York City, New York: Pharmacia & Upjohn Co; 2014. [Link]

PMID: 23477365

Sulfasalazine

By

Sulfasalazine

Product: Lonidamine

Identifier : DBSNPE003835
Drug : DB00795 (Sulfasalazine)
Interacting Gene/Enzyme : Glucose-6-phosphate 1-dehydrogenase
Gene Name : G6PD
UniProt ID : P11413
Defining Change(s) :

  • 1339G->A

Allele Name : Santiago de Cuba, Morioka
Genotype(s) : Not Available
Type(s) : ADR Inferred
Groups : G6PD deficiency
Description : Increased risk of dose-related hemolytic anemia.
References :

  1. Azulfidine®[package insert]. New York City, New York: Pharmacia & Upjohn Co; 2014. [Link]

PMID: 23292653

Sulfasalazine

By

Sulfasalazine

Product: Fluocinonide

Identifier : DBSNPE003836
Drug : DB00795 (Sulfasalazine)
Interacting Gene/Enzyme : Glucose-6-phosphate 1-dehydrogenase
Gene Name : G6PD
UniProt ID : P11413
Defining Change(s) :

  • 1358T->A

Allele Name : Harima
Genotype(s) : Not Available
Type(s) : ADR Inferred
Groups : G6PD deficiency
Description : Increased risk of dose-related hemolytic anemia.
References :

  1. Azulfidine®[package insert]. New York City, New York: Pharmacia & Upjohn Co; 2014. [Link]

PMID: 15113696

Sulfasalazine

By

Sulfasalazine

Product: Buflomedil (hydrochloride)

Identifier : DBSNPE003837
Drug : DB00795 (Sulfasalazine)
Interacting Gene/Enzyme : Glucose-6-phosphate 1-dehydrogenase
Gene Name : G6PD
UniProt ID : P11413
Defining Change(s) :

  • 1366G->C

Allele Name : Figuera da Foz
Genotype(s) : Not Available
Type(s) : ADR Inferred
Groups : G6PD deficiency
Description : Increased risk of dose-related hemolytic anemia.
References :

  1. Azulfidine®[package insert]. New York City, New York: Pharmacia & Upjohn Co; 2014. [Link]

PMID: 11478907

Sulfasalazine

By

Sulfasalazine

Product: Idebenone

Identifier : DBSNPE003838
Drug : DB00795 (Sulfasalazine)
Interacting Gene/Enzyme : Glucose-6-phosphate 1-dehydrogenase
Gene Name : G6PD
UniProt ID : P11413
Defining Change(s) :

  • 1367A>T

Allele Name : Amiens
Genotype(s) : Not Available
Type(s) : ADR Inferred
Groups : G6PD deficiency
Description : Increased risk of dose-related hemolytic anemia.
References :

  1. Azulfidine®[package insert]. New York City, New York: Pharmacia & Upjohn Co; 2014. [Link]

PMID: 16434202

Sulfasalazine

By

Sulfasalazine

Product: Tioxolone

Identifier : DBSNPE003839
Drug : DB00795 (Sulfasalazine)
Interacting Gene/Enzyme : Glucose-6-phosphate 1-dehydrogenase
Gene Name : G6PD
UniProt ID : P11413
Defining Change(s) :

  • 1376G->T, 1502T->G

Allele Name : Bangkok Noi
Genotype(s) : Not Available
Type(s) : ADR Inferred
Groups : G6PD deficiency
Description : Increased risk of dose-related hemolytic anemia.
References :

  1. Azulfidine®[package insert]. New York City, New York: Pharmacia & Upjohn Co; 2014. [Link]

PMID: 19182070

Sulfasalazine

By

Sulfasalazine

Product: Acemetacin

Identifier : DBSNPE003840
Drug : DB00795 (Sulfasalazine)
Interacting Gene/Enzyme : Glucose-6-phosphate 1-dehydrogenase
Gene Name : G6PD
UniProt ID : P11413
Defining Change(s) :

  • 1462G->A

Allele Name : Fukaya
Genotype(s) : Not Available
Type(s) : ADR Inferred
Groups : G6PD deficiency
Description : Increased risk of dose-related hemolytic anemia.
References :

  1. Azulfidine®[package insert]. New York City, New York: Pharmacia & Upjohn Co; 2014. [Link]

PMID: 18393860

Sulfasalazine

By

Sulfasalazine

Product: Miglitol

Identifier : DBSNPE003841
Drug : DB00795 (Sulfasalazine)
Interacting Gene/Enzyme : Glucose-6-phosphate 1-dehydrogenase
Gene Name : G6PD
UniProt ID : P11413
Defining Change(s) :

  • 1463G->T

Allele Name : Campinas
Genotype(s) : Not Available
Type(s) : ADR Inferred
Groups : G6PD deficiency
Description : Increased risk of dose-related hemolytic anemia.
References :

  1. Azulfidine®[package insert]. New York City, New York: Pharmacia & Upjohn Co; 2014. [Link]

PMID: 19340414

Sulfasalazine

By

Sulfasalazine

Product: Clobetasol propionate

Identifier : DBSNPE003842
Drug : DB00795 (Sulfasalazine)
Interacting Gene/Enzyme : Glucose-6-phosphate 1-dehydrogenase
Gene Name : G6PD
UniProt ID : P11413
Defining Change(s) :

  • 1465C>T

Allele Name : Buenos Aires
Genotype(s) : Not Available
Type(s) : ADR Inferred
Groups : G6PD deficiency
Description : Increased risk of dose-related hemolytic anemia.
References :

  1. Azulfidine®[package insert]. New York City, New York: Pharmacia & Upjohn Co; 2014. [Link]

PMID: 17668922

Sulfasalazine

By

Sulfasalazine

Product: Thiamphenicol

Identifier : DBSNPE003843
Drug : DB00795 (Sulfasalazine)
Interacting Gene/Enzyme : Glucose-6-phosphate 1-dehydrogenase
Gene Name : G6PD
UniProt ID : P11413
Defining Change(s) :

  • 1466C->T

Allele Name : Arakawa
Genotype(s) : Not Available
Type(s) : ADR Inferred
Groups : G6PD deficiency
Description : Increased risk of dose-related hemolytic anemia.
References :

  1. Azulfidine®[package insert]. New York City, New York: Pharmacia & Upjohn Co; 2014. [Link]

PMID: 17237257

Sulfasalazine

By

Sulfasalazine

Product: Quinapril (hydrochloride)

Identifier : DBSNPE003844
Drug : DB00795 (Sulfasalazine)
Interacting Gene/Enzyme : Glucose-6-phosphate 1-dehydrogenase
Gene Name : G6PD
UniProt ID : P11413
Defining Change(s) :

  • 1488_1490delGAA

Allele Name : Brighton
Genotype(s) : Not Available
Type(s) : ADR Inferred
Groups : G6PD deficiency
Description : Increased risk of dose-related hemolytic anemia.
References :

  1. Azulfidine®[package insert]. New York City, New York: Pharmacia & Upjohn Co; 2014. [Link]

PMID: 21190859

Sulfasalazine

By

Sulfasalazine

Product: Phenacetin

Identifier : DBSNPE003845
Drug : DB00795 (Sulfasalazine)
Interacting Gene/Enzyme : Glucose-6-phosphate 1-dehydrogenase
Gene Name : G6PD
UniProt ID : P11413
Defining Change(s) :

  • 159G->C

Allele Name : Kozukata
Genotype(s) : Not Available
Type(s) : ADR Inferred
Groups : G6PD deficiency
Description : Increased risk of dose-related hemolytic anemia.
References :

  1. Azulfidine®[package insert]. New York City, New York: Pharmacia & Upjohn Co; 2014. [Link]

PMID: 19836369

Sulfasalazine

By

Sulfasalazine

Product: Cloxacillin (sodium monohydrate)

Identifier : DBSNPE003846
Drug : DB00795 (Sulfasalazine)
Interacting Gene/Enzyme : Glucose-6-phosphate 1-dehydrogenase
Gene Name : G6PD
UniProt ID : P11413
Defining Change(s) :

  • 180_182delTCT

Allele Name : Amsterdam
Genotype(s) : Not Available
Type(s) : ADR Inferred
Groups : G6PD deficiency
Description : Increased risk of dose-related hemolytic anemia.
References :

  1. Azulfidine®[package insert]. New York City, New York: Pharmacia & Upjohn Co; 2014. [Link]

PMID: 18996199

Sulfasalazine

By

Sulfasalazine

Product: Oxacillin (sodium monohydrate)

Identifier : DBSNPE003847
Drug : DB00795 (Sulfasalazine)
Interacting Gene/Enzyme : Glucose-6-phosphate 1-dehydrogenase
Gene Name : G6PD
UniProt ID : P11413
Defining Change(s) :

  • 202G->A, 376A->G, 1264C>G

Allele Name : No name
Genotype(s) : Not Available
Type(s) : ADR Inferred
Groups : G6PD deficiency
Description : Increased risk of dose-related hemolytic anemia.
References :

  1. Azulfidine®[package insert]. New York City, New York: Pharmacia & Upjohn Co; 2014. [Link]

PMID: 18310442

Sulfasalazine

By

Sulfasalazine

Product: Hydralazine (hydrochloride)

Identifier : DBSNPE003848
Drug : DB00795 (Sulfasalazine)
Interacting Gene/Enzyme : Glucose-6-phosphate 1-dehydrogenase
Gene Name : G6PD
UniProt ID : P11413
Defining Change(s) :

  • 224T->C

Allele Name : Swansea
Genotype(s) : Not Available
Type(s) : ADR Inferred
Groups : G6PD deficiency
Description : Increased risk of dose-related hemolytic anemia.
References :

  1. Azulfidine®[package insert]. New York City, New York: Pharmacia & Upjohn Co; 2014. [Link]

PMID: 8754753

Sulfasalazine

By

Sulfasalazine

Product: Clomiphene (citrate)

Identifier : DBSNPE003849
Drug : DB00795 (Sulfasalazine)
Interacting Gene/Enzyme : Glucose-6-phosphate 1-dehydrogenase
Gene Name : G6PD
UniProt ID : P11413
Defining Change(s) :

  • 281_283delAGA

Allele Name : Urayasu
Genotype(s) : Not Available
Type(s) : ADR Inferred
Groups : G6PD deficiency
Description : Increased risk of dose-related hemolytic anemia.
References :

  1. Azulfidine®[package insert]. New York City, New York: Pharmacia & Upjohn Co; 2014. [Link]

PMID: 20331604

Sulfasalazine

By

Sulfasalazine

Product: Clarithromycin

Identifier : DBSNPE003850
Drug : DB00795 (Sulfasalazine)
Interacting Gene/Enzyme : Glucose-6-phosphate 1-dehydrogenase
Gene Name : G6PD
UniProt ID : P11413
Defining Change(s) :

  • 317C->G544C->T592C->T

Allele Name : Vancouver
Genotype(s) : Not Available
Type(s) : ADR Inferred
Groups : G6PD deficiency
Description : Increased risk of dose-related hemolytic anemia.
References :

  1. Azulfidine®[package insert]. New York City, New York: Pharmacia & Upjohn Co; 2014. [Link]

PMID: 16888084

Sulfasalazine

By

Sulfasalazine

Product: D-Pantothenic acid

Identifier : DBSNPE003851
Drug : DB00795 (Sulfasalazine)
Interacting Gene/Enzyme : Glucose-6-phosphate 1-dehydrogenase
Gene Name : G6PD
UniProt ID : P11413
Defining Change(s) :

  • 376A->G, 1159C->T

Allele Name : Mt Sinai
Genotype(s) : Not Available
Type(s) : ADR Inferred
Groups : G6PD deficiency
Description : Increased risk of dose-related hemolytic anemia.
References :

  1. Azulfidine®[package insert]. New York City, New York: Pharmacia & Upjohn Co; 2014. [Link]

PMID: 12646021

Sulfasalazine

By

Sulfasalazine

Product: Pancuronium (dibromide)

Identifier : DBSNPE003852
Drug : DB00795 (Sulfasalazine)
Interacting Gene/Enzyme : Glucose-6-phosphate 1-dehydrogenase
Gene Name : G6PD
UniProt ID : P11413
Defining Change(s) :

  • 488G->A

Allele Name : Plymouth
Genotype(s) : Not Available
Type(s) : ADR Inferred
Groups : G6PD deficiency
Description : Increased risk of dose-related hemolytic anemia.
References :

  1. Azulfidine®[package insert]. New York City, New York: Pharmacia & Upjohn Co; 2014. [Link]

PMID: 12591111

Sulfasalazine

By

Sulfasalazine

Product: Ozagrel

Identifier : DBSNPE003853
Drug : DB00795 (Sulfasalazine)
Interacting Gene/Enzyme : Glucose-6-phosphate 1-dehydrogenase
Gene Name : G6PD
UniProt ID : P11413
Defining Change(s) :

  • 514C->T

Allele Name : Volendam
Genotype(s) : Not Available
Type(s) : ADR Inferred
Groups : G6PD deficiency
Description : Increased risk of dose-related hemolytic anemia.
References :

  1. Azulfidine®[package insert]. New York City, New York: Pharmacia & Upjohn Co; 2014. [Link]

PMID: 12409007

Sulfasalazine

By

Sulfasalazine

Product: Oxymetazoline (hydrochloride)

Identifier : DBSNPE003854
Drug : DB00795 (Sulfasalazine)
Interacting Gene/Enzyme : Glucose-6-phosphate 1-dehydrogenase
Gene Name : G6PD
UniProt ID : P11413
Defining Change(s) :

  • 527A->G

Allele Name : Shinshu
Genotype(s) : Not Available
Type(s) : ADR Inferred
Groups : G6PD deficiency
Description : Increased risk of dose-related hemolytic anemia.
References :

  1. Azulfidine®[package insert]. New York City, New York: Pharmacia & Upjohn Co; 2014. [Link]

PMID: 15135895

Sulfasalazine

By

Sulfasalazine

Product: Olopatadine (hydrochloride)

Identifier : DBSNPE003855
Drug : DB00795 (Sulfasalazine)
Interacting Gene/Enzyme : Glucose-6-phosphate 1-dehydrogenase
Gene Name : G6PD
UniProt ID : P11413
Defining Change(s) :

  • 535A->T

Allele Name : Chikugo
Genotype(s) : Not Available
Type(s) : ADR Inferred
Groups : G6PD deficiency
Description : Increased risk of dose-related hemolytic anemia.
References :

  1. Azulfidine®[package insert]. New York City, New York: Pharmacia & Upjohn Co; 2014. [Link]

PMID: 9813305

Sulfasalazine

By

Sulfasalazine

Product: Novobiocin (Sodium)

Identifier : DBSNPE003856
Drug : DB00795 (Sulfasalazine)
Interacting Gene/Enzyme : Glucose-6-phosphate 1-dehydrogenase
Gene Name : G6PD
UniProt ID : P11413
Defining Change(s) :

  • 561_563delCTC

Allele Name : Tsukui
Genotype(s) : Not Available
Type(s) : ADR Inferred
Groups : G6PD deficiency
Description : Increased risk of dose-related hemolytic anemia.
References :

  1. Azulfidine®[package insert]. New York City, New York: Pharmacia & Upjohn Co; 2014. [Link]

PMID: 9845266

Sulfasalazine

By

Sulfasalazine

Product: Nitrendipine

Identifier : DBSNPE003857
Drug : DB00795 (Sulfasalazine)
Interacting Gene/Enzyme : Glucose-6-phosphate 1-dehydrogenase
Gene Name : G6PD
UniProt ID : P11413
Defining Change(s) :

  • 573C>G

Allele Name : Pedoplis-Ckaro
Genotype(s) : Not Available
Type(s) : ADR Inferred
Groups : G6PD deficiency
Description : Increased risk of dose-related hemolytic anemia.
References :

  1. Azulfidine®[package insert]. New York City, New York: Pharmacia & Upjohn Co; 2014. [Link]

PMID: 20702773

Sulfasalazine

By

Sulfasalazine

Product: Neostigmine (Bromide)

Identifier : DBSNPE003858
Drug : DB00795 (Sulfasalazine)
Interacting Gene/Enzyme : Glucose-6-phosphate 1-dehydrogenase
Gene Name : G6PD
UniProt ID : P11413
Defining Change(s) :

  • 593G->C

Allele Name : Santiago
Genotype(s) : Not Available
Type(s) : ADR Inferred
Groups : G6PD deficiency
Description : Increased risk of dose-related hemolytic anemia.
References :

  1. Azulfidine®[package insert]. New York City, New York: Pharmacia & Upjohn Co; 2014. [Link]

PMID: 16959942

Sulfasalazine

By

Sulfasalazine

Product: Nateglinide

Identifier : DBSNPE003859
Drug : DB00795 (Sulfasalazine)
Interacting Gene/Enzyme : Glucose-6-phosphate 1-dehydrogenase
Gene Name : G6PD
UniProt ID : P11413
Defining Change(s) :

  • 637G->T

Allele Name : Minnesota, Marion, Gastonia, LeJeune
Genotype(s) : Not Available
Type(s) : ADR Inferred
Groups : G6PD deficiency
Description : Increased risk of dose-related hemolytic anemia.
References :

  1. Azulfidine®[package insert]. New York City, New York: Pharmacia & Upjohn Co; 2014. [Link]

PMID: 11150170

Sulfasalazine

By

Sulfasalazine

Product: Mycophenolic acid

Identifier : DBSNPE003860
Drug : DB00795 (Sulfasalazine)
Interacting Gene/Enzyme : Glucose-6-phosphate 1-dehydrogenase
Gene Name : G6PD
UniProt ID : P11413
Defining Change(s) :

  • 637G->T, 1037A->T

Allele Name : Cincinnati
Genotype(s) : Not Available
Type(s) : ADR Inferred
Groups : G6PD deficiency
Description : Increased risk of dose-related hemolytic anemia.
References :

  1. Azulfidine®[package insert]. New York City, New York: Pharmacia & Upjohn Co; 2014. [Link]

PMID: 16679696

Sulfasalazine

By

Sulfasalazine

Product: Moroxydine (hydrochloride)

Identifier : DBSNPE003862
Drug : DB00795 (Sulfasalazine)
Interacting Gene/Enzyme : Glucose-6-phosphate 1-dehydrogenase
Gene Name : G6PD
UniProt ID : P11413
Defining Change(s) :

  • 683_685delACA

Allele Name : North Dallas
Genotype(s) : Not Available
Type(s) : ADR Inferred
Groups : G6PD deficiency
Description : Increased risk of dose-related hemolytic anemia.
References :

  1. Azulfidine®[package insert]. New York City, New York: Pharmacia & Upjohn Co; 2014. [Link]

PMID: 11792967

Sulfasalazine

By

Sulfasalazine

Product: Mitoxantrone (dihydrochloride)

Identifier : DBSNPE003863
Drug : DB00795 (Sulfasalazine)
Interacting Gene/Enzyme : Glucose-6-phosphate 1-dehydrogenase
Gene Name : G6PD
UniProt ID : P11413
Defining Change(s) :

  • 695G->A

Allele Name : Asahikawa
Genotype(s) : Not Available
Type(s) : ADR Inferred
Groups : G6PD deficiency
Description : Increased risk of dose-related hemolytic anemia.
References :

  1. Azulfidine®[package insert]. New York City, New York: Pharmacia & Upjohn Co; 2014. [Link]

PMID: 10443584

Sulfasalazine

By

Sulfasalazine

Product: Mitoxantrone

Identifier : DBSNPE003864
Drug : DB00795 (Sulfasalazine)
Interacting Gene/Enzyme : Glucose-6-phosphate 1-dehydrogenase
Gene Name : G6PD
UniProt ID : P11413
Defining Change(s) :

  • 713A->G

Allele Name : Durham
Genotype(s) : Not Available
Type(s) : ADR Inferred
Groups : G6PD deficiency
Description : Increased risk of dose-related hemolytic anemia.
References :

  1. Azulfidine®[package insert]. New York City, New York: Pharmacia & Upjohn Co; 2014. [Link]

PMID: 17245369

Sulfasalazine

By

Sulfasalazine

Product: Manidipine

Identifier : DBSNPE003865
Drug : DB00795 (Sulfasalazine)
Interacting Gene/Enzyme : Glucose-6-phosphate 1-dehydrogenase
Gene Name : G6PD
UniProt ID : P11413
Defining Change(s) :

  • 724_729delGGCACT

Allele Name : Stonybrook
Genotype(s) : Not Available
Type(s) : ADR Inferred
Groups : G6PD deficiency
Description : Increased risk of dose-related hemolytic anemia.
References :

  1. Azulfidine®[package insert]. New York City, New York: Pharmacia & Upjohn Co; 2014. [Link]

PMID: 14531843

Sulfasalazine

By

Sulfasalazine

Product: Loperamide (hydrochloride)

Identifier : DBSNPE003866
Drug : DB00795 (Sulfasalazine)
Interacting Gene/Enzyme : Glucose-6-phosphate 1-dehydrogenase
Gene Name : G6PD
UniProt ID : P11413
Defining Change(s) :

  • 769C->G

Allele Name : Wayne
Genotype(s) : Not Available
Type(s) : ADR Inferred
Groups : G6PD deficiency
Description : Increased risk of dose-related hemolytic anemia.
References :

  1. Azulfidine®[package insert]. New York City, New York: Pharmacia & Upjohn Co; 2014. [Link]

PMID: 15317471

Sulfasalazine

By

Sulfasalazine

Product: Lincomycin (hydrochloride)

Identifier : DBSNPE003867
Drug : DB00795 (Sulfasalazine)
Interacting Gene/Enzyme : Glucose-6-phosphate 1-dehydrogenase
Gene Name : G6PD
UniProt ID : P11413
Defining Change(s) :

  • 806G->A

Allele Name : Aveiro
Genotype(s) : Not Available
Type(s) : ADR Inferred
Groups : G6PD deficiency
Description : Increased risk of dose-related hemolytic anemia.
References :

  1. Azulfidine®[package insert]. New York City, New York: Pharmacia & Upjohn Co; 2014. [Link]

PMID: 12361385

Sulfasalazine

By

Sulfasalazine

Product: Gallamine Triethiodide

Identifier : DBSNPE003868
Drug : DB00795 (Sulfasalazine)
Interacting Gene/Enzyme : Glucose-6-phosphate 1-dehydrogenase
Gene Name : G6PD
UniProt ID : P11413
Defining Change(s) :

  • 820G->A

Allele Name : Cleveland Corum
Genotype(s) : Not Available
Type(s) : ADR Inferred
Groups : G6PD deficiency
Description : Increased risk of dose-related hemolytic anemia.
References :

  1. Azulfidine®[package insert]. New York City, New York: Pharmacia & Upjohn Co; 2014. [Link]

PMID: 25915476

Sulfasalazine

By

Sulfasalazine

Product: Fluocinolone (Acetonide)

Identifier : DBSNPE003869
Drug : DB00795 (Sulfasalazine)
Interacting Gene/Enzyme : Glucose-6-phosphate 1-dehydrogenase
Gene Name : G6PD
UniProt ID : P11413
Defining Change(s) :

  • 821A>T

Allele Name : Lille
Genotype(s) : Not Available
Type(s) : ADR Inferred
Groups : G6PD deficiency
Description : Increased risk of dose-related hemolytic anemia.
References :

  1. Azulfidine®[package insert]. New York City, New York: Pharmacia & Upjohn Co; 2014. [Link]

PMID: 25076858

Sulfasalazine

By

Sulfasalazine

Product: Fleroxacin

Identifier : DBSNPE003870
Drug : DB00795 (Sulfasalazine)
Interacting Gene/Enzyme : Glucose-6-phosphate 1-dehydrogenase
Gene Name : G6PD
UniProt ID : P11413
Defining Change(s) :

  • 825G>C

Allele Name : Bangkok
Genotype(s) : Not Available
Type(s) : ADR Inferred
Groups : G6PD deficiency
Description : Increased risk of dose-related hemolytic anemia.
References :

  1. Azulfidine®[package insert]. New York City, New York: Pharmacia & Upjohn Co; 2014. [Link]

PMID: 18082228

Sulfasalazine

By

Sulfasalazine

Product: Fenbendazole

Identifier : DBSNPE003871
Drug : DB00795 (Sulfasalazine)
Interacting Gene/Enzyme : Glucose-6-phosphate 1-dehydrogenase
Gene Name : G6PD
UniProt ID : P11413
Defining Change(s) :

  • 826C->T

Allele Name : Sugao
Genotype(s) : Not Available
Type(s) : ADR Inferred
Groups : G6PD deficiency
Description : Increased risk of dose-related hemolytic anemia.
References :

  1. Azulfidine®[package insert]. New York City, New York: Pharmacia & Upjohn Co; 2014. [Link]

PMID: 14660013

Sulfasalazine

By

Sulfasalazine

Product: Estriol

Identifier : DBSNPE003873
Drug : DB00795 (Sulfasalazine)
Interacting Gene/Enzyme : Glucose-6-phosphate 1-dehydrogenase
Gene Name : G6PD
UniProt ID : P11413
Defining Change(s) :

  • 833C->T

Allele Name : Wexham
Genotype(s) : Not Available
Type(s) : ADR Inferred
Groups : G6PD deficiency
Description : Increased risk of dose-related hemolytic anemia.
References :

  1. Azulfidine®[package insert]. New York City, New York: Pharmacia & Upjohn Co; 2014. [Link]

PMID: 9630346

Sulfasalazine

By

Sulfasalazine

Product: Levosimendan

Identifier : DBSNPE003874
Drug : DB00795 (Sulfasalazine)
Interacting Gene/Enzyme : Glucose-6-phosphate 1-dehydrogenase
Gene Name : G6PD
UniProt ID : P11413
Defining Change(s) :

  • 851T>C

Allele Name : Piodivkow
Genotype(s) : Not Available
Type(s) : ADR Inferred
Groups : G6PD deficiency
Description : Increased risk of dose-related hemolytic anemia.
References :

  1. Azulfidine®[package insert]. New York City, New York: Pharmacia & Upjohn Co; 2014. [Link]

PMID: 25453189

Sulfasalazine

By

Sulfasalazine

Product: Poliumoside

Identifier : DBSNPE003875
Drug : DB00795 (Sulfasalazine)
Interacting Gene/Enzyme : Glucose-6-phosphate 1-dehydrogenase
Gene Name : G6PD
UniProt ID : P11413
Defining Change(s) :

  • 910G->T

Allele Name : West Virginia
Genotype(s) : Not Available
Type(s) : ADR Inferred
Groups : G6PD deficiency
Description : Increased risk of dose-related hemolytic anemia.
References :

  1. Azulfidine®[package insert]. New York City, New York: Pharmacia & Upjohn Co; 2014. [Link]

PMID: 12065241

Sulfasalazine

By

Sulfasalazine

Product: Isoacteoside

Identifier : DBSNPE003876
Drug : DB00795 (Sulfasalazine)
Interacting Gene/Enzyme : Glucose-6-phosphate 1-dehydrogenase
Gene Name : G6PD
UniProt ID : P11413
Defining Change(s) :

  • 921G->C

Allele Name : Omiya
Genotype(s) : Not Available
Type(s) : ADR Inferred
Groups : G6PD deficiency
Description : Increased risk of dose-related hemolytic anemia.
References :

  1. Azulfidine®[package insert]. New York City, New York: Pharmacia & Upjohn Co; 2014. [Link]

PMID: 11726778

Sulfasalazine

By

Sulfasalazine

Product: Verbascoside

Identifier : DBSNPE003877
Drug : DB00795 (Sulfasalazine)
Interacting Gene/Enzyme : Glucose-6-phosphate 1-dehydrogenase
Gene Name : G6PD
UniProt ID : P11413
Defining Change(s) :

  • 953_976delCCACCAAAGGGTACCTGGAC GACC

Allele Name : Nara
Genotype(s) : Not Available
Type(s) : ADR Inferred
Groups : G6PD deficiency
Description : Increased risk of dose-related hemolytic anemia.
References :

  1. Azulfidine®[package insert]. New York City, New York: Pharmacia & Upjohn Co; 2014. [Link]

PMID: 9832440

Sulfasalazine

By

Sulfasalazine

Product: Clorsulon

Identifier : DBSNPE003878
Drug : DB00795 (Sulfasalazine)
Interacting Gene/Enzyme : Glucose-6-phosphate 1-dehydrogenase
Gene Name : G6PD
UniProt ID : P11413
Defining Change(s) :

  • 962G->A

Allele Name : Manhattan
Genotype(s) : Not Available
Type(s) : ADR Inferred
Groups : G6PD deficiency
Description : Increased risk of dose-related hemolytic anemia.
References :

  1. Azulfidine®[package insert]. New York City, New York: Pharmacia & Upjohn Co; 2014. [Link]

PMID: 25860801

Sulfasalazine

By

Sulfasalazine

Product: Brompheniramine (maleate)

Identifier : DBSNPE003879
Drug : DB00795 (Sulfasalazine)
Interacting Gene/Enzyme : Glucose-6-phosphate 1-dehydrogenase
Gene Name : G6PD
UniProt ID : P11413
Defining Change(s) :

  • 964T->C

Allele Name : Rehevot
Genotype(s) : Not Available
Type(s) : ADR Inferred
Groups : G6PD deficiency
Description : Increased risk of dose-related hemolytic anemia.
References :

  1. Azulfidine®[package insert]. New York City, New York: Pharmacia & Upjohn Co; 2014. [Link]

PMID: 15033920

Sulfasalazine

By

Sulfasalazine

Product: Trazodone (hydrochloride)

Identifier : DBSNPE003880
Drug : DB00795 (Sulfasalazine)
Interacting Gene/Enzyme : Glucose-6-phosphate 1-dehydrogenase
Gene Name : G6PD
UniProt ID : P11413
Defining Change(s) :

  • 99A->G
  • 1360C->T

Allele Name : Honiara
Genotype(s) : Not Available
Type(s) : ADR Inferred
Groups : G6PD deficiency
Description : Increased risk of dose-related hemolytic anemia.
References :

  1. Azulfidine®[package insert]. New York City, New York: Pharmacia & Upjohn Co; 2014. [Link]

PMID: 11963824

Sulfasalazine

By

Sulfasalazine

Product: Xylometazoline (hydrochloride)

Identifier : DBSNPE003881
Drug : DB00795 (Sulfasalazine)
Interacting Gene/Enzyme : Glucose-6-phosphate 1-dehydrogenase
Gene Name : G6PD
UniProt ID : P11413
Defining Change(s) :

  • 1246G->A

Allele Name : Tokyo, Fukushima
Genotype(s) : Not Available
Type(s) : ADR Inferred
Groups : G6PD deficiency
Description : Increased risk of dose-related hemolytic anemia.
References :

  1. Azulfidine®[package insert]. New York City, New York: Pharmacia & Upjohn Co; 2014. [Link]

PMID: 12909200

Sulfasalazine

By

Sulfasalazine

Product: Tetracycline (hydrochloride)

Identifier : DBSNPE003882
Drug : DB00795 (Sulfasalazine)
Interacting Gene/Enzyme : Glucose-6-phosphate 1-dehydrogenase
Gene Name : G6PD
UniProt ID : P11413
Defining Change(s) :

  • 1003G->A

Allele Name : Chatham
Genotype(s) : Not Available
Type(s) : ADR Inferred
Groups : G6PD deficiency
Description : Increased risk of dose-related hemolytic anemia.
References :

  1. Azulfidine®[package insert]. New York City, New York: Pharmacia & Upjohn Co; 2014. [Link]

PMID: 16436498

Sulfasalazine

By

Sulfasalazine

Product: Tetracaine (hydrochloride)

Identifier : DBSNPE003883
Drug : DB00795 (Sulfasalazine)
Interacting Gene/Enzyme : Glucose-6-phosphate 1-dehydrogenase
Gene Name : G6PD
UniProt ID : P11413
Defining Change(s) :

  • 1004C->A

Allele Name : Fushan
Genotype(s) : Not Available
Type(s) : ADR Inferred
Groups : G6PD deficiency
Description : Increased risk of dose-related hemolytic anemia.
References :

  1. Azulfidine®[package insert]. New York City, New York: Pharmacia & Upjohn Co; 2014. [Link]

PMID: 16098742

Sulfasalazine

By

Sulfasalazine

Product: Streptomycin (sulfate)

Identifier : DBSNPE003884
Drug : DB00795 (Sulfasalazine)
Interacting Gene/Enzyme : Glucose-6-phosphate 1-dehydrogenase
Gene Name : G6PD
UniProt ID : P11413
Defining Change(s) :

  • 1052G->T

Allele Name : Partenope
Genotype(s) : Not Available
Type(s) : ADR Inferred
Groups : G6PD deficiency
Description : Increased risk of dose-related hemolytic anemia.
References :

  1. Azulfidine®[package insert]. New York City, New York: Pharmacia & Upjohn Co; 2014. [Link]

PMID: 15027849

Sulfasalazine

By

Sulfasalazine

Product: (R)-(-)-Phenylephrine (hydrochloride)

Identifier : DBSNPE003885
Drug : DB00795 (Sulfasalazine)
Interacting Gene/Enzyme : Glucose-6-phosphate 1-dehydrogenase
Gene Name : G6PD
UniProt ID : P11413
Defining Change(s) :

  • 1057C->T

Allele Name : Ierapediva
Genotype(s) : Not Available
Type(s) : ADR Inferred
Groups : G6PD deficiency
Description : Increased risk of dose-related hemolytic anemia.
References :

  1. Azulfidine®[package insert]. New York City, New York: Pharmacia & Upjohn Co; 2014. [Link]

PMID: 25982086

Sulfasalazine

By

Sulfasalazine

Product: Neomycin (sulfate)

Identifier : DBSNPE003886
Drug : DB00795 (Sulfasalazine)
Interacting Gene/Enzyme : Glucose-6-phosphate 1-dehydrogenase
Gene Name : G6PD
UniProt ID : P11413
Defining Change(s) :

  • 1193A->G

Allele Name : Anadia
Genotype(s) : Not Available
Type(s) : ADR Inferred
Groups : G6PD deficiency
Description : Increased risk of dose-related hemolytic anemia.
References :

  1. Azulfidine®[package insert]. New York City, New York: Pharmacia & Upjohn Co; 2014. [Link]

PMID: 23276279

Sulfasalazine

By

Sulfasalazine

Product: Medroxyprogesterone (acetate)

Identifier : DBSNPE003887
Drug : DB00795 (Sulfasalazine)
Interacting Gene/Enzyme : Glucose-6-phosphate 1-dehydrogenase
Gene Name : G6PD
UniProt ID : P11413
Defining Change(s) :

  • 1220A->C

Allele Name : Abeno
Genotype(s) : Not Available
Type(s) : ADR Inferred
Groups : G6PD deficiency
Description : Increased risk of dose-related hemolytic anemia.
References :

  1. Azulfidine®[package insert]. New York City, New York: Pharmacia & Upjohn Co; 2014. [Link]

PMID: 19996949

Sulfasalazine

By

Sulfasalazine

Product: Isoprenaline (hydrochloride)

Identifier : DBSNPE003888
Drug : DB00795 (Sulfasalazine)
Interacting Gene/Enzyme : Glucose-6-phosphate 1-dehydrogenase
Gene Name : G6PD
UniProt ID : P11413
Defining Change(s) :

  • 1291G->A

Allele Name : Surabaya
Genotype(s) : Not Available
Type(s) : ADR Inferred
Groups : G6PD deficiency
Description : Increased risk of dose-related hemolytic anemia.
References :

  1. Azulfidine®[package insert]. New York City, New York: Pharmacia & Upjohn Co; 2014. [Link]

PMID: 17482720

Sulfasalazine

By

Sulfasalazine

Product: Amoxicillin (sodium)

Identifier : DBSNPE003889
Drug : DB00795 (Sulfasalazine)
Interacting Gene/Enzyme : Glucose-6-phosphate 1-dehydrogenase
Gene Name : G6PD
UniProt ID : P11413
Defining Change(s) :

  • 1316G->C

Allele Name : Pawnee
Genotype(s) : Not Available
Type(s) : ADR Inferred
Groups : G6PD deficiency
Description : Increased risk of dose-related hemolytic anemia.
References :

  1. Azulfidine®[package insert]. New York City, New York: Pharmacia & Upjohn Co; 2014. [Link]

PMID: 17885689

Sulfasalazine

By

Sulfasalazine

Product: 5-Aminolevulinic acid (hydrochloride)

Identifier : DBSNPE003890
Drug : DB00795 (Sulfasalazine)
Interacting Gene/Enzyme : Glucose-6-phosphate 1-dehydrogenase
Gene Name : G6PD
UniProt ID : P11413
Defining Change(s) :

  • 1342A->G

Allele Name : S. Antioco
Genotype(s) : Not Available
Type(s) : ADR Inferred
Groups : G6PD deficiency
Description : Increased risk of dose-related hemolytic anemia.
References :

  1. Azulfidine®[package insert]. New York City, New York: Pharmacia & Upjohn Co; 2014. [Link]

PMID: 7658432

Sulfasalazine

By

Sulfasalazine

Product: Prucalopride

Identifier : DBSNPE003891
Drug : DB00795 (Sulfasalazine)
Interacting Gene/Enzyme : Glucose-6-phosphate 1-dehydrogenase
Gene Name : G6PD
UniProt ID : P11413
Defining Change(s) :

  • 1347G->C

Allele Name : Cassano
Genotype(s) : Not Available
Type(s) : ADR Inferred
Groups : G6PD deficiency
Description : Increased risk of dose-related hemolytic anemia.
References :

  1. Azulfidine®[package insert]. New York City, New York: Pharmacia & Upjohn Co; 2014. [Link]

PMID: 25136332

Sulfasalazine

By

Sulfasalazine

Product: Azelastine (hydrochloride)

Identifier : DBSNPE003892
Drug : DB00795 (Sulfasalazine)
Interacting Gene/Enzyme : Glucose-6-phosphate 1-dehydrogenase
Gene Name : G6PD
UniProt ID : P11413
Defining Change(s) :

  • 1347G->C
  • 1360C->T

Allele Name : Hermoupolis
Genotype(s) : Not Available
Type(s) : ADR Inferred
Groups : G6PD deficiency
Description : Increased risk of dose-related hemolytic anemia.
References :

  1. Azulfidine®[package insert]. New York City, New York: Pharmacia & Upjohn Co; 2014. [Link]

PMID: 24285728

Sulfasalazine

By

Sulfasalazine

Product: Trospium (chloride)

Identifier : DBSNPE003893
Drug : DB00795 (Sulfasalazine)
Interacting Gene/Enzyme : Glucose-6-phosphate 1-dehydrogenase
Gene Name : G6PD
UniProt ID : P11413
Defining Change(s) :

  • 1360C->T

Allele Name : Union,Maewo, Chinese-2, Kalo
Genotype(s) : Not Available
Type(s) : ADR Inferred
Groups : G6PD deficiency
Description : Increased risk of dose-related hemolytic anemia.
References :

  1. Azulfidine®[package insert]. New York City, New York: Pharmacia & Upjohn Co; 2014. [Link]

PMID: 20695846

Sulfasalazine

By

Sulfasalazine

Product: Tiotropium (bromide hydrate)

Identifier : DBSNPE003894
Drug : DB00795 (Sulfasalazine)
Interacting Gene/Enzyme : Glucose-6-phosphate 1-dehydrogenase
Gene Name : G6PD
UniProt ID : P11413
Defining Change(s) :

  • 1361G->A

Allele Name : Andalus
Genotype(s) : Not Available
Type(s) : ADR Inferred
Groups : G6PD deficiency
Description : Increased risk of dose-related hemolytic anemia.
References :

  1. Azulfidine®[package insert]. New York City, New York: Pharmacia & Upjohn Co; 2014. [Link]

PMID: 19929853

Sulfasalazine

By

Sulfasalazine

Product: Scopine

Identifier : DBSNPE003895
Drug : DB00795 (Sulfasalazine)
Interacting Gene/Enzyme : Glucose-6-phosphate 1-dehydrogenase
Gene Name : G6PD
UniProt ID : P11413
Defining Change(s) :

  • 1376G->C

Allele Name : Cosenza
Genotype(s) : Not Available
Type(s) : ADR Inferred
Groups : G6PD deficiency
Description : Increased risk of dose-related hemolytic anemia.
References :

  1. Azulfidine®[package insert]. New York City, New York: Pharmacia & Upjohn Co; 2014. [Link]

PMID: 26181372

Sulfasalazine

By

Sulfasalazine

Product: Cefprozil (monohydrate)

Identifier : DBSNPE003896
Drug : DB00795 (Sulfasalazine)
Interacting Gene/Enzyme : Glucose-6-phosphate 1-dehydrogenase
Gene Name : G6PD
UniProt ID : P11413
Defining Change(s) :

  • 1376G->T

Allele Name : Canton, Taiwan- Hakka, Gifu-like, Agrigento-like
Genotype(s) : Not Available
Type(s) : ADR Inferred
Groups : G6PD deficiency
Description : Increased risk of dose-related hemolytic anemia.
References :

  1. Azulfidine®[package insert]. New York City, New York: Pharmacia & Upjohn Co; 2014. [Link]

PMID: 25068893

Sulfasalazine

By

Sulfasalazine

Product: Clomipramine (hydrochloride)

Identifier : DBSNPE003898
Drug : DB00795 (Sulfasalazine)
Interacting Gene/Enzyme : Glucose-6-phosphate 1-dehydrogenase
Gene Name : G6PD
UniProt ID : P11413
Defining Change(s) :

  • 1388G->A

Allele Name : Kaiping, Anant, Dhon, Sapporo-like, Wosera
Genotype(s) : Not Available
Type(s) : ADR Inferred
Groups : G6PD deficiency
Description : Increased risk of dose-related hemolytic anemia.
References :

  1. Azulfidine®[package insert]. New York City, New York: Pharmacia & Upjohn Co; 2014. [Link]

PMID: 16370372

Sulfasalazine

By

Sulfasalazine

Product: Riboflavin

Identifier : DBSNPE003899
Drug : DB00795 (Sulfasalazine)
Interacting Gene/Enzyme : Glucose-6-phosphate 1-dehydrogenase
Gene Name : G6PD
UniProt ID : P11413
Defining Change(s) :

  • 169C->T

Allele Name : Kamogawa
Genotype(s) : Not Available
Type(s) : ADR Inferred
Groups : G6PD deficiency
Description : Increased risk of dose-related hemolytic anemia.
References :

  1. Azulfidine®[package insert]. New York City, New York: Pharmacia & Upjohn Co; 2014. [Link]

PMID: 16766717

Sulfasalazine

By

Sulfasalazine

Product: Lomefloxacin (hydrochloride)

Identifier : DBSNPE003900
Drug : DB00795 (Sulfasalazine)
Interacting Gene/Enzyme : Glucose-6-phosphate 1-dehydrogenase
Gene Name : G6PD
UniProt ID : P11413
Defining Change(s) :

  • 179T>C

Allele Name : Costanzo
Genotype(s) : Not Available
Type(s) : ADR Inferred
Groups : G6PD deficiency
Description : Increased risk of dose-related hemolytic anemia.
References :

  1. Azulfidine®[package insert]. New York City, New York: Pharmacia & Upjohn Co; 2014. [Link]

PMID: 12887330

Sulfasalazine

By

Sulfasalazine

Product: Miconazole

Identifier : DBSNPE003901
Drug : DB00795 (Sulfasalazine)
Interacting Gene/Enzyme : Glucose-6-phosphate 1-dehydrogenase
Gene Name : G6PD
UniProt ID : P11413
Defining Change(s) :

  • 185C->A

Allele Name : Amazonia
Genotype(s) : Not Available
Type(s) : ADR Inferred
Groups : G6PD deficiency
Description : Increased risk of dose-related hemolytic anemia.
References :

  1. Azulfidine®[package insert]. New York City, New York: Pharmacia & Upjohn Co; 2014. [Link]

PMID: 8526859

Sulfasalazine

By

Sulfasalazine

Product: Econazole (nitrate)

Identifier : DBSNPE003902
Drug : DB00795 (Sulfasalazine)
Interacting Gene/Enzyme : Glucose-6-phosphate 1-dehydrogenase
Gene Name : G6PD
UniProt ID : P11413
Defining Change(s) :

  • 196T->A

Allele Name : Songklanagarind
Genotype(s) : Not Available
Type(s) : ADR Inferred
Groups : G6PD deficiency
Description : Increased risk of dose-related hemolytic anemia.
References :

  1. Azulfidine®[package insert]. New York City, New York: Pharmacia & Upjohn Co; 2014. [Link]

PMID: 25394661

Sulfasalazine

By

Sulfasalazine

Product: Ritodrine (hydrochloride)

Identifier : DBSNPE003903
Drug : DB00795 (Sulfasalazine)
Interacting Gene/Enzyme : Glucose-6-phosphate 1-dehydrogenase
Gene Name : G6PD
UniProt ID : P11413
Defining Change(s) :

  • 202G->A
  • 871G->A

Allele Name : Hechi
Genotype(s) : Not Available
Type(s) : ADR Inferred
Groups : G6PD deficiency
Description : Increased risk of dose-related hemolytic anemia.
References :

  1. Azulfidine®[package insert]. New York City, New York: Pharmacia & Upjohn Co; 2014. [Link]

PMID: 17471180

Sulfasalazine

By

Sulfasalazine

Product: Dopamine (hydrochloride)

Identifier : DBSNPE003904
Drug : DB00795 (Sulfasalazine)
Interacting Gene/Enzyme : Glucose-6-phosphate 1-dehydrogenase
Gene Name : G6PD
UniProt ID : P11413
Defining Change(s) :

  • 208T->C

Allele Name : Namouru
Genotype(s) : Not Available
Type(s) : ADR Inferred
Groups : G6PD deficiency
Description : Increased risk of dose-related hemolytic anemia.
References :

  1. Azulfidine®[package insert]. New York City, New York: Pharmacia & Upjohn Co; 2014. [Link]

PMID: 10218875

Sulfasalazine

By

Sulfasalazine

Product: Ciclopirox

Identifier : DBSNPE003905
Drug : DB00795 (Sulfasalazine)
Interacting Gene/Enzyme : Glucose-6-phosphate 1-dehydrogenase
Gene Name : G6PD
UniProt ID : P11413
Defining Change(s) :

  • 352T>C

Allele Name : Bao Loc
Genotype(s) : Not Available
Type(s) : ADR Inferred
Groups : G6PD deficiency
Description : Increased risk of dose-related hemolytic anemia.
References :

  1. Azulfidine®[package insert]. New York City, New York: Pharmacia & Upjohn Co; 2014. [Link]

PMID: 10482915

Sulfasalazine

By

Sulfasalazine

Product: Methacycline (hydrochloride)

Identifier : DBSNPE003906
Drug : DB00795 (Sulfasalazine)
Interacting Gene/Enzyme : Glucose-6-phosphate 1-dehydrogenase
Gene Name : G6PD
UniProt ID : P11413
Defining Change(s) :

  • 375G->T, 379G->T383T->C384C>T

Allele Name : Crispim
Genotype(s) : Not Available
Type(s) : ADR Inferred
Groups : G6PD deficiency
Description : Increased risk of dose-related hemolytic anemia.
References :

  1. Azulfidine®[package insert]. New York City, New York: Pharmacia & Upjohn Co; 2014. [Link]

PMID: 9547366

Sulfasalazine

By

Sulfasalazine

Product: Phenytoin

Identifier : DBSNPE003907
Drug : DB00795 (Sulfasalazine)
Interacting Gene/Enzyme : Glucose-6-phosphate 1-dehydrogenase
Gene Name : G6PD
UniProt ID : P11413
Defining Change(s) :

  • 376A->G
  • 463C->G

Allele Name : Acrokorinthos
Genotype(s) : Not Available
Type(s) : ADR Inferred
Groups : G6PD deficiency
Description : Increased risk of dose-related hemolytic anemia.
References :

  1. Azulfidine®[package insert]. New York City, New York: Pharmacia & Upjohn Co; 2014. [Link]

PMID: 26655634

Sulfasalazine

By

Sulfasalazine

Product: L-Epinephrine

Identifier : DBSNPE003909
Drug : DB00795 (Sulfasalazine)
Interacting Gene/Enzyme : Glucose-6-phosphate 1-dehydrogenase
Gene Name : G6PD
UniProt ID : P11413
Defining Change(s) :

  • 376A->G
  • 871G->A

Allele Name : Ananindeua
Genotype(s) : Not Available
Type(s) : ADR Inferred
Groups : G6PD deficiency
Description : Increased risk of dose-related hemolytic anemia.
References :

  1. Azulfidine®[package insert]. New York City, New York: Pharmacia & Upjohn Co; 2014. [Link]

PMID: 21950687

Sulfasalazine

By

Sulfasalazine

Product: L-Epinephrine (Bitartrate)

Identifier : DBSNPE003910
Drug : DB00795 (Sulfasalazine)
Interacting Gene/Enzyme : Glucose-6-phosphate 1-dehydrogenase
Gene Name : G6PD
UniProt ID : P11413
Defining Change(s) :

  • 383T->C

Allele Name : Vanua Lava
Genotype(s) : Not Available
Type(s) : ADR Inferred
Groups : G6PD deficiency
Description : Increased risk of dose-related hemolytic anemia.
References :

  1. Azulfidine®[package insert]. New York City, New York: Pharmacia & Upjohn Co; 2014. [Link]

PMID: 23153195

Sulfasalazine

By

Sulfasalazine

Product: DL-Epinephrine

Identifier : DBSNPE003911
Drug : DB00795 (Sulfasalazine)
Interacting Gene/Enzyme : Glucose-6-phosphate 1-dehydrogenase
Gene Name : G6PD
UniProt ID : P11413
Defining Change(s) :

  • 406C->T

Allele Name : Valladolid
Genotype(s) : Not Available
Type(s) : ADR Inferred
Groups : G6PD deficiency
Description : Increased risk of dose-related hemolytic anemia.
References :

  1. Azulfidine®[package insert]. New York City, New York: Pharmacia & Upjohn Co; 2014. [Link]

PMID: 21937605

Sulfasalazine

By

Sulfasalazine

Product: Naphazoline (hydrochloride)

Identifier : DBSNPE003912
Drug : DB00795 (Sulfasalazine)
Interacting Gene/Enzyme : Glucose-6-phosphate 1-dehydrogenase
Gene Name : G6PD
UniProt ID : P11413
Defining Change(s) :

  • 409C->T

Allele Name : Belem
Genotype(s) : Not Available
Type(s) : ADR Inferred
Groups : G6PD deficiency
Description : Increased risk of dose-related hemolytic anemia.
References :

  1. Azulfidine®[package insert]. New York City, New York: Pharmacia & Upjohn Co; 2014. [Link]

PMID: 22357920

Sulfasalazine

By

Sulfasalazine

Product: NAD+

Identifier : DBSNPE003913
Drug : DB00795 (Sulfasalazine)
Interacting Gene/Enzyme : Glucose-6-phosphate 1-dehydrogenase
Gene Name : G6PD
UniProt ID : P11413
Defining Change(s) :

  • 442G->A

Allele Name : Liuzhou
Genotype(s) : Not Available
Type(s) : ADR Inferred
Groups : G6PD deficiency
Description : Increased risk of dose-related hemolytic anemia.
References :

  1. Azulfidine®[package insert]. New York City, New York: Pharmacia & Upjohn Co; 2014. [Link]

PMID: 21163524

Sulfasalazine

By

Sulfasalazine

Product: Maprotiline (hydrochloride)

Identifier : DBSNPE003914
Drug : DB00795 (Sulfasalazine)
Interacting Gene/Enzyme : Glucose-6-phosphate 1-dehydrogenase
Gene Name : G6PD
UniProt ID : P11413
Defining Change(s) :

  • 473G>A

Allele Name : Shenzen
Genotype(s) : Not Available
Type(s) : ADR Inferred
Groups : G6PD deficiency
Description : Increased risk of dose-related hemolytic anemia.
References :

  1. Azulfidine®[package insert]. New York City, New York: Pharmacia & Upjohn Co; 2014. [Link]

PMID: 19509218

Sulfasalazine

By

Sulfasalazine

Product: APY29

Identifier : DBSNPE003915
Drug : DB00795 (Sulfasalazine)
Interacting Gene/Enzyme : Glucose-6-phosphate 1-dehydrogenase
Gene Name : G6PD
UniProt ID : P11413
Defining Change(s) :

  • 493A->G

Allele Name : Taipei “Chinese- 3”
Genotype(s) : Not Available
Type(s) : ADR Inferred
Groups : G6PD deficiency
Description : Increased risk of dose-related hemolytic anemia.
References :

  1. Azulfidine®[package insert]. New York City, New York: Pharmacia & Upjohn Co; 2014. [Link]

PMID: 19023135

Sulfasalazine

By

Sulfasalazine

Product: CK-636

Identifier : DBSNPE003916
Drug : DB00795 (Sulfasalazine)
Interacting Gene/Enzyme : Glucose-6-phosphate 1-dehydrogenase
Gene Name : G6PD
UniProt ID : P11413
Defining Change(s) :

  • 496C>T

Allele Name : Toledo
Genotype(s) : Not Available
Type(s) : ADR Inferred
Groups : G6PD deficiency
Description : Increased risk of dose-related hemolytic anemia.
References :

  1. Azulfidine®[package insert]. New York City, New York: Pharmacia & Upjohn Co; 2014. [Link]

PMID: 18191200

Sulfasalazine

By

Sulfasalazine

Product: Xylazine (hydrochloride)

Identifier : DBSNPE003917
Drug : DB00795 (Sulfasalazine)
Interacting Gene/Enzyme : Glucose-6-phosphate 1-dehydrogenase
Gene Name : G6PD
UniProt ID : P11413
Defining Change(s) :

  • 497G->A

Allele Name : Naone
Genotype(s) : Not Available
Type(s) : ADR Inferred
Groups : G6PD deficiency
Description : Increased risk of dose-related hemolytic anemia.
References :

  1. Azulfidine®[package insert]. New York City, New York: Pharmacia & Upjohn Co; 2014. [Link]

PMID: 18494935

Sulfasalazine

By

Sulfasalazine

Product: Xylazine

Identifier : DBSNPE003918
Drug : DB00795 (Sulfasalazine)
Interacting Gene/Enzyme : Glucose-6-phosphate 1-dehydrogenase
Gene Name : G6PD
UniProt ID : P11413
Defining Change(s) :

  • 517T->C

Allele Name : Nankang
Genotype(s) : Not Available
Type(s) : ADR Inferred
Groups : G6PD deficiency
Description : Increased risk of dose-related hemolytic anemia.
References :

  1. Azulfidine®[package insert]. New York City, New York: Pharmacia & Upjohn Co; 2014. [Link]

PMID: 16455764

Sulfasalazine

By

Sulfasalazine

Product: Vardenafil

Identifier : DBSNPE003919
Drug : DB00795 (Sulfasalazine)
Interacting Gene/Enzyme : Glucose-6-phosphate 1-dehydrogenase
Gene Name : G6PD
UniProt ID : P11413
Defining Change(s) :

  • 519C->G

Allele Name : Miaoli
Genotype(s) : Not Available
Type(s) : ADR Inferred
Groups : G6PD deficiency
Description : Increased risk of dose-related hemolytic anemia.
References :

  1. Azulfidine®[package insert]. New York City, New York: Pharmacia & Upjohn Co; 2014. [Link]

PMID: 18516295

Sulfasalazine

By

Sulfasalazine

Product: Tobramycin

Identifier : DBSNPE003920
Drug : DB00795 (Sulfasalazine)
Interacting Gene/Enzyme : Glucose-6-phosphate 1-dehydrogenase
Gene Name : G6PD
UniProt ID : P11413
Defining Change(s) :

  • 563C->T

Allele Name : Mediterranean, Dallas, Panama‚ Sassari, Cagliari, Birmingham
Genotype(s) : Not Available
Type(s) : ADR Inferred
Groups : G6PD deficiency
Description : Increased risk of dose-related hemolytic anemia.
References :

  1. Azulfidine®[package insert]. New York City, New York: Pharmacia & Upjohn Co; 2014. [Link]

PMID: 16190767

Sulfasalazine

By

Sulfasalazine

Product: Tenoxicam

Identifier : DBSNPE003921
Drug : DB00795 (Sulfasalazine)
Interacting Gene/Enzyme : Glucose-6-phosphate 1-dehydrogenase
Gene Name : G6PD
UniProt ID : P11413
Defining Change(s) :

  • 592C->T

Allele Name : Coimbra Shunde
Genotype(s) : Not Available
Type(s) : ADR Inferred
Groups : G6PD deficiency
Description : Increased risk of dose-related hemolytic anemia.
References :

  1. Azulfidine®[package insert]. New York City, New York: Pharmacia & Upjohn Co; 2014. [Link]

PMID: 15745797

Sulfasalazine

By

Sulfasalazine

Product: Sulfadoxine

Identifier : DBSNPE003922
Drug : DB00795 (Sulfasalazine)
Interacting Gene/Enzyme : Glucose-6-phosphate 1-dehydrogenase
Gene Name : G6PD
UniProt ID : P11413
Defining Change(s) :

  • 593G>A

Allele Name : Nilgiri
Genotype(s) : Not Available
Type(s) : ADR Inferred
Groups : G6PD deficiency
Description : Increased risk of dose-related hemolytic anemia.
References :

  1. Azulfidine®[package insert]. New York City, New York: Pharmacia & Upjohn Co; 2014. [Link]

PMID: 19037995

Sulfasalazine

By

Sulfasalazine

Product: Spectinomycin (dihydrochloride)

Identifier : DBSNPE003923
Drug : DB00795 (Sulfasalazine)
Interacting Gene/Enzyme : Glucose-6-phosphate 1-dehydrogenase
Gene Name : G6PD
UniProt ID : P11413
Defining Change(s) :

  • 679C->T

Allele Name : Radlowo
Genotype(s) : Not Available
Type(s) : ADR Inferred
Groups : G6PD deficiency
Description : Increased risk of dose-related hemolytic anemia.
References :

  1. Azulfidine®[package insert]. New York City, New York: Pharmacia & Upjohn Co; 2014. [Link]

PMID: 18723490

Sulfasalazine

By

Sulfasalazine

Product: Sotalol (hydrochloride)

Identifier : DBSNPE003924
Drug : DB00795 (Sulfasalazine)
Interacting Gene/Enzyme : Glucose-6-phosphate 1-dehydrogenase
Gene Name : G6PD
UniProt ID : P11413
Defining Change(s) :

  • 811G>C

Allele Name : Roubaix
Genotype(s) : Not Available
Type(s) : ADR Inferred
Groups : G6PD deficiency
Description : Increased risk of dose-related hemolytic anemia.
References :

  1. Azulfidine®[package insert]. New York City, New York: Pharmacia & Upjohn Co; 2014. [Link]

PMID: 15729694

Sulfasalazine

By

Sulfasalazine

Product: Salbutamol (hemisulfate)

Identifier : DBSNPE003925
Drug : DB00795 (Sulfasalazine)
Interacting Gene/Enzyme : Glucose-6-phosphate 1-dehydrogenase
Gene Name : G6PD
UniProt ID : P11413
Defining Change(s) :

  • 835A->G

Allele Name : Haikou
Genotype(s) : Not Available
Type(s) : ADR Inferred
Groups : G6PD deficiency
Description : Increased risk of dose-related hemolytic anemia.
References :

  1. Azulfidine®[package insert]. New York City, New York: Pharmacia & Upjohn Co; 2014. [Link]

PMID: 22624712

Sulfasalazine

By

Sulfasalazine

Product: Roxithromycin

Identifier : DBSNPE003926
Drug : DB00795 (Sulfasalazine)
Interacting Gene/Enzyme : Glucose-6-phosphate 1-dehydrogenase
Gene Name : G6PD
UniProt ID : P11413
Defining Change(s) :

  • 835A->T

Allele Name : Chinese-1
Genotype(s) : Not Available
Type(s) : ADR Inferred
Groups : G6PD deficiency
Description : Increased risk of dose-related hemolytic anemia.
References :

  1. Azulfidine®[package insert]. New York City, New York: Pharmacia & Upjohn Co; 2014. [Link]

PMID: 16789731

Sulfasalazine

By

Sulfasalazine

Product: Ribavirin

Identifier : DBSNPE003927
Drug : DB00795 (Sulfasalazine)
Interacting Gene/Enzyme : Glucose-6-phosphate 1-dehydrogenase
Gene Name : G6PD
UniProt ID : P11413
Defining Change(s) :

  • 848A>G

Allele Name : Mizushima
Genotype(s) : Not Available
Type(s) : ADR Inferred
Groups : G6PD deficiency
Description : Increased risk of dose-related hemolytic anemia.
References :

  1. Azulfidine®[package insert]. New York City, New York: Pharmacia & Upjohn Co; 2014. [Link]

PMID: 14704432

Sulfasalazine

By

Sulfasalazine

Product: Quinine (hydrochloride dihydrate)

Identifier : DBSNPE003928
Drug : DB00795 (Sulfasalazine)
Interacting Gene/Enzyme : Glucose-6-phosphate 1-dehydrogenase
Gene Name : G6PD
UniProt ID : P11413
Defining Change(s) :

  • 853C->T

Allele Name : Osaka
Genotype(s) : Not Available
Type(s) : ADR Inferred
Groups : G6PD deficiency
Description : Increased risk of dose-related hemolytic anemia.
References :

  1. Azulfidine®[package insert]. New York City, New York: Pharmacia & Upjohn Co; 2014. [Link]

PMID: 20395210

Sulfasalazine

By

Sulfasalazine

Product: Propafenone (hydrochloride)

Identifier : DBSNPE003929
Drug : DB00795 (Sulfasalazine)
Interacting Gene/Enzyme : Glucose-6-phosphate 1-dehydrogenase
Gene Name : G6PD
UniProt ID : P11413
Defining Change(s) :

  • 871G->A

Allele Name : Viangchan, Jammu
Genotype(s) : Not Available
Type(s) : ADR Inferred
Groups : G6PD deficiency
Description : Increased risk of dose-related hemolytic anemia.
References :

  1. Azulfidine®[package insert]. New York City, New York: Pharmacia & Upjohn Co; 2014. [Link]

PMID: 10230772

Sulfasalazine

By

Sulfasalazine

Product: Phenoxybenzamine (hydrochloride)

Identifier : DBSNPE003930
Drug : DB00795 (Sulfasalazine)
Interacting Gene/Enzyme : Glucose-6-phosphate 1-dehydrogenase
Gene Name : G6PD
UniProt ID : P11413
Defining Change(s) :

  • 916G->A

Allele Name : Seoul
Genotype(s) : Not Available
Type(s) : ADR Inferred
Groups : G6PD deficiency
Description : Increased risk of dose-related hemolytic anemia.
References :

  1. Azulfidine®[package insert]. New York City, New York: Pharmacia & Upjohn Co; 2014. [Link]

PMID: 20080970

Sulfasalazine

By

Sulfasalazine

Product: MMAF

Identifier : DBSNPE003931
Drug : DB00795 (Sulfasalazine)
Interacting Gene/Enzyme : Glucose-6-phosphate 1-dehydrogenase
Gene Name : G6PD
UniProt ID : P11413
Defining Change(s) :

  • 929G->A

Allele Name : Ludhiana
Genotype(s) : Not Available
Type(s) : ADR Inferred
Groups : G6PD deficiency
Description : Increased risk of dose-related hemolytic anemia.
References :

  1. Azulfidine®[package insert]. New York City, New York: Pharmacia & Upjohn Co; 2014. [Link]

PMID: 25271708

Sulfasalazine

By

Sulfasalazine

Product: Domperidone

Identifier : DBSNPE003932
Drug : DB00795 (Sulfasalazine)
Interacting Gene/Enzyme : Glucose-6-phosphate 1-dehydrogenase
Gene Name : G6PD
UniProt ID : P11413
Defining Change(s) :

  • 977C->A

Allele Name : Farroupilha
Genotype(s) : Not Available
Type(s) : ADR Inferred
Groups : G6PD deficiency
Description : Increased risk of dose-related hemolytic anemia.
References :

  1. Azulfidine®[package insert]. New York City, New York: Pharmacia & Upjohn Co; 2014. [Link]

PMID: 18455128

Sulfasalazine

By

Sulfasalazine

Product: Pramipexole

Identifier : DBSNPE003933
Drug : DB00795 (Sulfasalazine)
Interacting Gene/Enzyme : Glucose-6-phosphate 1-dehydrogenase
Gene Name : G6PD
UniProt ID : P11413
Defining Change(s) :

  • 1024C->T

Allele Name : Chinese-5
Genotype(s) : Not Available
Type(s) : ADR Inferred
Groups : G6PD deficiency
Description : Increased risk of dose-related hemolytic anemia.
References :

  1. Azulfidine®[package insert]. New York City, New York: Pharmacia & Upjohn Co; 2014. [Link]

PMID: 15308639

Sulfasalazine

By

Sulfasalazine

Product: Clonidine (hydrochloride)

Identifier : DBSNPE003934
Drug : DB00795 (Sulfasalazine)
Interacting Gene/Enzyme : Glucose-6-phosphate 1-dehydrogenase
Gene Name : G6PD
UniProt ID : P11413
Defining Change(s) :

  • 130G>A

Allele Name : Rignano
Genotype(s) : Not Available
Type(s) : ADR Inferred
Groups : G6PD deficiency
Description : Increased risk of dose-related hemolytic anemia.
References :

  1. Azulfidine®[package insert]. New York City, New York: Pharmacia & Upjohn Co; 2014. [Link]

PMID: 14614447

Sulfasalazine

By

Sulfasalazine

Product: Clindamycin (hydrochloride)

Identifier : DBSNPE003935
Drug : DB00795 (Sulfasalazine)
Interacting Gene/Enzyme : Glucose-6-phosphate 1-dehydrogenase
Gene Name : G6PD
UniProt ID : P11413
Defining Change(s) :

  • 131C->G

Allele Name : Orissa
Genotype(s) : Not Available
Type(s) : ADR Inferred
Groups : G6PD deficiency
Description : Increased risk of dose-related hemolytic anemia.
References :

  1. Azulfidine®[package insert]. New York City, New York: Pharmacia & Upjohn Co; 2014. [Link]

PMID: 10617466

Sulfasalazine

By

Sulfasalazine

Product: Chlorpromazine (hydrochloride)

Identifier : DBSNPE003936
Drug : DB00795 (Sulfasalazine)
Interacting Gene/Enzyme : Glucose-6-phosphate 1-dehydrogenase
Gene Name : G6PD
UniProt ID : P11413
Defining Change(s) :

  • 1380G>C

Allele Name : G6PDNice
Genotype(s) : Not Available
Type(s) : ADR Inferred
Groups : G6PD deficiency
Description : Increased risk of dose-related hemolytic anemia.
References :

  1. Azulfidine®[package insert]. New York City, New York: Pharmacia & Upjohn Co; 2014. [Link]

PMID: 21109480

Sulfasalazine

By

Sulfasalazine

Product: Bethanechol (chloride)

Identifier : DBSNPE003937
Drug : DB00795 (Sulfasalazine)
Interacting Gene/Enzyme : Glucose-6-phosphate 1-dehydrogenase
Gene Name : G6PD
UniProt ID : P11413
Defining Change(s) :

  • 1387C->T

Allele Name : Kamiube, Keelung
Genotype(s) : Not Available
Type(s) : ADR Inferred
Groups : G6PD deficiency
Description : Increased risk of dose-related hemolytic anemia.
References :

  1. Azulfidine®[package insert]. New York City, New York: Pharmacia & Upjohn Co; 2014. [Link]

PMID: 17485365

Sulfasalazine

By

Sulfasalazine

Product: Bupivacaine (hydrochloride)

Identifier : DBSNPE003938
Drug : DB00795 (Sulfasalazine)
Interacting Gene/Enzyme : Glucose-6-phosphate 1-dehydrogenase
Gene Name : G6PD
UniProt ID : P11413
Defining Change(s) :

  • 1400C->G

Allele Name : Neapolis
Genotype(s) : Not Available
Type(s) : ADR Inferred
Groups : G6PD deficiency
Description : Increased risk of dose-related hemolytic anemia.
References :

  1. Azulfidine®[package insert]. New York City, New York: Pharmacia & Upjohn Co; 2014. [Link]

PMID: 16557267

Sulfasalazine

By

Sulfasalazine

Product: Benserazide (hydrochloride)

Identifier : DBSNPE003939
Drug : DB00795 (Sulfasalazine)
Interacting Gene/Enzyme : Glucose-6-phosphate 1-dehydrogenase
Gene Name : G6PD
UniProt ID : P11413
Defining Change(s) :

  • 143T->C

Allele Name : Aures
Genotype(s) : Not Available
Type(s) : ADR Inferred
Groups : G6PD deficiency
Description : Increased risk of dose-related hemolytic anemia.
References :

  1. Azulfidine®[package insert]. New York City, New York: Pharmacia & Upjohn Co; 2014. [Link]

PMID: 15998635

Sulfasalazine

By

Sulfasalazine

Product: Bupropion (hydrochloride)

Identifier : DBSNPE003940
Drug : DB00795 (Sulfasalazine)
Interacting Gene/Enzyme : Glucose-6-phosphate 1-dehydrogenase
Gene Name : G6PD
UniProt ID : P11413
Defining Change(s) :

  • 1442C->G

Allele Name : Split
Genotype(s) : Not Available
Type(s) : ADR Inferred
Groups : G6PD deficiency
Description : Increased risk of dose-related hemolytic anemia.
References :

  1. Azulfidine®[package insert]. New York City, New York: Pharmacia & Upjohn Co; 2014. [Link]

PMID: 20498645

Sulfasalazine

By

Sulfasalazine

Product: AHU-377 (hemicalcium salt)

Identifier : DBSNPE003941
Drug : DB00795 (Sulfasalazine)
Interacting Gene/Enzyme : Glucose-6-phosphate 1-dehydrogenase
Gene Name : G6PD
UniProt ID : P11413
Defining Change(s) :

  • 148C->T

Allele Name : Kambos
Genotype(s) : Not Available
Type(s) : ADR Inferred
Groups : G6PD deficiency
Description : Increased risk of dose-related hemolytic anemia.
References :

  1. Azulfidine®[package insert]. New York City, New York: Pharmacia & Upjohn Co; 2014. [Link]

PMID: 18650397

Sulfasalazine

By

Sulfasalazine

Product: p53 and MDM2 proteins-interaction-inhibitor (dihydrochloride)

Identifier : DBSNPE003942
Drug : DB00795 (Sulfasalazine)
Interacting Gene/Enzyme : Glucose-6-phosphate 1-dehydrogenase
Gene Name : G6PD
UniProt ID : P11413
Defining Change(s) :

  • 170G>A

Allele Name : Palesdivina
Genotype(s) : Not Available
Type(s) : ADR Inferred
Groups : G6PD deficiency
Description : Increased risk of dose-related hemolytic anemia.
References :

  1. Azulfidine®[package insert]. New York City, New York: Pharmacia & Upjohn Co; 2014. [Link]

PMID: 17113036

Sulfasalazine

By

Sulfasalazine

Product: DMOG

Identifier : DBSNPE003943
Drug : DB00795 (Sulfasalazine)
Interacting Gene/Enzyme : Glucose-6-phosphate 1-dehydrogenase
Gene Name : G6PD
UniProt ID : P11413
Defining Change(s) :

  • 172G->A

Allele Name : Metaponto
Genotype(s) : Not Available
Type(s) : ADR Inferred
Groups : G6PD deficiency
Description : Increased risk of dose-related hemolytic anemia.
References :

  1. Azulfidine®[package insert]. New York City, New York: Pharmacia & Upjohn Co; 2014. [Link]

PMID: 11875500

Sulfasalazine

By

Sulfasalazine

Product: Amantadine (hydrochloride)

Identifier : DBSNPE003945
Drug : DB00795 (Sulfasalazine)
Interacting Gene/Enzyme : Glucose-6-phosphate 1-dehydrogenase
Gene Name : G6PD
UniProt ID : P11413
Defining Change(s) :

  • 202G->A

Allele Name : Asahi
Genotype(s) : Not Available
Type(s) : ADR Inferred
Groups : G6PD deficiency
Description : Increased risk of dose-related hemolytic anemia.
References :

  1. Azulfidine®[package insert]. New York City, New York: Pharmacia & Upjohn Co; 2014. [Link]

PMID: 12507923

Sulfasalazine

By

Sulfasalazine

Product: Tolbutamide

Identifier : DBSNPE003946
Drug : DB00795 (Sulfasalazine)
Interacting Gene/Enzyme : Glucose-6-phosphate 1-dehydrogenase
Gene Name : G6PD
UniProt ID : P11413
Defining Change(s) :

  • 202G->A
  • 376A->G

Allele Name : A- (202), Ferrara I
Genotype(s) : Not Available
Type(s) : ADR Inferred
Groups : G6PD deficiency
Description : Increased risk of dose-related hemolytic anemia.
References :

  1. Azulfidine®[package insert]. New York City, New York: Pharmacia & Upjohn Co; 2014. [Link]

PMID: 19075036

Sulfasalazine

By

Sulfasalazine

Product: Geniposidic acid

Identifier : DBSNPE003947
Drug : DB00795 (Sulfasalazine)
Interacting Gene/Enzyme : Glucose-6-phosphate 1-dehydrogenase
Gene Name : G6PD
UniProt ID : P11413
Defining Change(s) :

  • 209A->G

Allele Name : Murcia Oristano
Genotype(s) : Not Available
Type(s) : ADR Inferred
Groups : G6PD deficiency
Description : Increased risk of dose-related hemolytic anemia.
References :

  1. Azulfidine®[package insert]. New York City, New York: Pharmacia & Upjohn Co; 2014. [Link]

PMID: 19323829

Sulfasalazine

By

Sulfasalazine

Product: BTB06584

Identifier : DBSNPE003948
Drug : DB00795 (Sulfasalazine)
Interacting Gene/Enzyme : Glucose-6-phosphate 1-dehydrogenase
Gene Name : G6PD
UniProt ID : P11413
Defining Change(s) :

  • 241C->T

Allele Name : Ube Konan
Genotype(s) : Not Available
Type(s) : ADR Inferred
Groups : G6PD deficiency
Description : Increased risk of dose-related hemolytic anemia.
References :

  1. Azulfidine®[package insert]. New York City, New York: Pharmacia & Upjohn Co; 2014. [Link]

PMID: 18663359

Sulfasalazine

By

Sulfasalazine

Product: Paeoniflorin

Identifier : DBSNPE003949
Drug : DB00795 (Sulfasalazine)
Interacting Gene/Enzyme : Glucose-6-phosphate 1-dehydrogenase
Gene Name : G6PD
UniProt ID : P11413
Defining Change(s) :

  • 242G->A

Allele Name : Lagosanto
Genotype(s) : Not Available
Type(s) : ADR Inferred
Groups : G6PD deficiency
Description : Increased risk of dose-related hemolytic anemia.
References :

  1. Azulfidine®[package insert]. New York City, New York: Pharmacia & Upjohn Co; 2014. [Link]

PMID: 15735745

Sulfasalazine

By

Sulfasalazine

Product: D-Sorbitol

Identifier : DBSNPE003950
Drug : DB00795 (Sulfasalazine)
Interacting Gene/Enzyme : Glucose-6-phosphate 1-dehydrogenase
Gene Name : G6PD
UniProt ID : P11413
Defining Change(s) :

  • 274C->T

Allele Name : Guangzhou
Genotype(s) : Not Available
Type(s) : ADR Inferred
Groups : G6PD deficiency
Description : Increased risk of dose-related hemolytic anemia.
References :

  1. Azulfidine®[package insert]. New York City, New York: Pharmacia & Upjohn Co; 2014. [Link]

PMID: 21718309