PI3KInhibitorpi3kinhibitor

Nalidixic Acid

By

Nalidixic Acid

Product: Entrectinib

Identifier : DBSNPE002259
Drug : DB00779 (Nalidixic Acid)
Interacting Gene/Enzyme : Glucose-6-phosphate 1-dehydrogenase
Gene Name : G6PD
UniProt ID : P11413
Defining Change(s) :

  • 1000_1002delACC

Allele Name : Villeurbanne
Genotype(s) : Not Available
Type(s) : ADR Inferred
Groups : G6PD deficiency
Description : Increased risk of hemolytic anemia.
References :

  1. NegGram® Caplets (Nalidixic acid, USP)[package insert]. Bridgewater, New Jersey: Sanofi-Aventis U.S. LLC; 2012. [Link]

PMID: 7737340

Nalidixic Acid

By

Nalidixic Acid

Product: Thiamet G

Identifier : DBSNPE002260
Drug : DB00779 (Nalidixic Acid)
Interacting Gene/Enzyme : Glucose-6-phosphate 1-dehydrogenase
Gene Name : G6PD
UniProt ID : P11413
Defining Change(s) :

  • 1006A->G

Allele Name : Torun
Genotype(s) : Not Available
Type(s) : ADR Inferred
Groups : G6PD deficiency
Description : Increased risk of hemolytic anemia.
References :

  1. NegGram® Caplets (Nalidixic acid, USP)[package insert]. Bridgewater, New Jersey: Sanofi-Aventis U.S. LLC; 2012. [Link]

PMID: 25490055

Nalidixic Acid

By

Nalidixic Acid

Product: UNC2025 (hydrochloride)

Identifier : DBSNPE002261
Drug : DB00779 (Nalidixic Acid)
Interacting Gene/Enzyme : Glucose-6-phosphate 1-dehydrogenase
Gene Name : G6PD
UniProt ID : P11413
Defining Change(s) :

  • 105_107delCAT

Allele Name : Sunderland
Genotype(s) : Not Available
Type(s) : ADR Inferred
Groups : G6PD deficiency
Description : Increased risk of hemolytic anemia.
References :

  1. NegGram® Caplets (Nalidixic acid, USP)[package insert]. Bridgewater, New Jersey: Sanofi-Aventis U.S. LLC; 2012. [Link]

PMID: 16113037

Nalidixic Acid

By

Nalidixic Acid

Product: Ponesimod

Identifier : DBSNPE002262
Drug : DB00779 (Nalidixic Acid)
Interacting Gene/Enzyme : Glucose-6-phosphate 1-dehydrogenase
Gene Name : G6PD
UniProt ID : P11413
Defining Change(s) :

  • 1081G->A

Allele Name : Iwatsuki
Genotype(s) : Not Available
Type(s) : ADR Inferred
Groups : G6PD deficiency
Description : Increased risk of hemolytic anemia.
References :

  1. NegGram® Caplets (Nalidixic acid, USP)[package insert]. Bridgewater, New Jersey: Sanofi-Aventis U.S. LLC; 2012. [Link]

PMID: 11406122

Nalidixic Acid

By

Nalidixic Acid

Product: Bulleyaconitine A

Identifier : DBSNPE002263
Drug : DB00779 (Nalidixic Acid)
Interacting Gene/Enzyme : Glucose-6-phosphate 1-dehydrogenase
Gene Name : G6PD
UniProt ID : P11413
Defining Change(s) :

  • 1082C->T

Allele Name : Serres
Genotype(s) : Not Available
Type(s) : ADR Inferred
Groups : G6PD deficiency
Description : Increased risk of hemolytic anemia.
References :

  1. NegGram® Caplets (Nalidixic acid, USP)[package insert]. Bridgewater, New Jersey: Sanofi-Aventis U.S. LLC; 2012. [Link]

PMID: 658124

Nalidixic Acid

By

Nalidixic Acid

Product: Lindane

Identifier : DBSNPE002265
Drug : DB00779 (Nalidixic Acid)
Interacting Gene/Enzyme : Glucose-6-phosphate 1-dehydrogenase
Gene Name : G6PD
UniProt ID : P11413
Defining Change(s) :

  • 1089C->A

Allele Name : Loma Linda
Genotype(s) : Not Available
Type(s) : ADR Inferred
Groups : G6PD deficiency
Description : Increased risk of hemolytic anemia.
References :

  1. NegGram® Caplets (Nalidixic acid, USP)[package insert]. Bridgewater, New Jersey: Sanofi-Aventis U.S. LLC; 2012. [Link]

PMID: 10740291

Nalidixic Acid

By

Nalidixic Acid

Product: Procainamide (hydrochloride)

Identifier : DBSNPE002266
Drug : DB00779 (Nalidixic Acid)
Interacting Gene/Enzyme : Glucose-6-phosphate 1-dehydrogenase
Gene Name : G6PD
UniProt ID : P11413
Defining Change(s) :

  • 1089C->G

Allele Name : Aachen
Genotype(s) : Not Available
Type(s) : ADR Inferred
Groups : G6PD deficiency
Description : Increased risk of hemolytic anemia.
References :

  1. NegGram® Caplets (Nalidixic acid, USP)[package insert]. Bridgewater, New Jersey: Sanofi-Aventis U.S. LLC; 2012. [Link]

PMID: 1534584

Nalidixic Acid

By

Nalidixic Acid

Product: Methacholine (chloride)

Identifier : DBSNPE002267
Drug : DB00779 (Nalidixic Acid)
Interacting Gene/Enzyme : Glucose-6-phosphate 1-dehydrogenase
Gene Name : G6PD
UniProt ID : P11413
Defining Change(s) :

  • 1096A->G

Allele Name : Tenri
Genotype(s) : Not Available
Type(s) : ADR Inferred
Groups : G6PD deficiency
Description : Increased risk of hemolytic anemia.
References :

  1. NegGram® Caplets (Nalidixic acid, USP)[package insert]. Bridgewater, New Jersey: Sanofi-Aventis U.S. LLC; 2012. [Link]

PMID: 26584860

Nalidixic Acid

By

Nalidixic Acid

Product: Diphenidol (hydrochloride)

Identifier : DBSNPE002268
Drug : DB00779 (Nalidixic Acid)
Interacting Gene/Enzyme : Glucose-6-phosphate 1-dehydrogenase
Gene Name : G6PD
UniProt ID : P11413
Defining Change(s) :

  • 1132G>A

Allele Name : Montpellier
Genotype(s) : Not Available
Type(s) : ADR Inferred
Groups : G6PD deficiency
Description : Increased risk of hemolytic anemia.
References :

  1. NegGram® Caplets (Nalidixic acid, USP)[package insert]. Bridgewater, New Jersey: Sanofi-Aventis U.S. LLC; 2012. [Link]

PMID: 8230129

Nalidixic Acid

By

Nalidixic Acid

Product: Fluphenazine (dihydrochloride)

Identifier : DBSNPE002269
Drug : DB00779 (Nalidixic Acid)
Interacting Gene/Enzyme : Glucose-6-phosphate 1-dehydrogenase
Gene Name : G6PD
UniProt ID : P11413
Defining Change(s) :

  • 1138A->G

Allele Name : Calvo Mackenna
Genotype(s) : Not Available
Type(s) : ADR Inferred
Groups : G6PD deficiency
Description : Increased risk of hemolytic anemia.
References :

  1. NegGram® Caplets (Nalidixic acid, USP)[package insert]. Bridgewater, New Jersey: Sanofi-Aventis U.S. LLC; 2012. [Link]

PMID: 8627534

Nalidixic Acid

By

Nalidixic Acid

Product: Aminohippurate (sodium)

Identifier : DBSNPE002270
Drug : DB00779 (Nalidixic Acid)
Interacting Gene/Enzyme : Glucose-6-phosphate 1-dehydrogenase
Gene Name : G6PD
UniProt ID : P11413
Defining Change(s) :

  • 1139T->C

Allele Name : Riley
Genotype(s) : Not Available
Type(s) : ADR Inferred
Groups : G6PD deficiency
Description : Increased risk of hemolytic anemia.
References :

  1. NegGram® Caplets (Nalidixic acid, USP)[package insert]. Bridgewater, New Jersey: Sanofi-Aventis U.S. LLC; 2012. [Link]

PMID: 8930150

Nalidixic Acid

By

Nalidixic Acid

Product: Tetracaine

Identifier : DBSNPE002271
Drug : DB00779 (Nalidixic Acid)
Interacting Gene/Enzyme : Glucose-6-phosphate 1-dehydrogenase
Gene Name : G6PD
UniProt ID : P11413
Defining Change(s) :

  • 1141T->C

Allele Name : Olomouc
Genotype(s) : Not Available
Type(s) : ADR Inferred
Groups : G6PD deficiency
Description : Increased risk of hemolytic anemia.
References :

  1. NegGram® Caplets (Nalidixic acid, USP)[package insert]. Bridgewater, New Jersey: Sanofi-Aventis U.S. LLC; 2012. [Link]

PMID: 8851513

Nalidixic Acid

By

Nalidixic Acid

Product: Tolazoline (hydrochloride)

Identifier : DBSNPE002272
Drug : DB00779 (Nalidixic Acid)
Interacting Gene/Enzyme : Glucose-6-phosphate 1-dehydrogenase
Gene Name : G6PD
UniProt ID : P11413
Defining Change(s) :

  • 1153T->C

Allele Name : Tomah
Genotype(s) : Not Available
Type(s) : ADR Inferred
Groups : G6PD deficiency
Description : Increased risk of hemolytic anemia.
References :

  1. NegGram® Caplets (Nalidixic acid, USP)[package insert]. Bridgewater, New Jersey: Sanofi-Aventis U.S. LLC; 2012. [Link]

PMID: 8182696

Nalidixic Acid

By

Nalidixic Acid

Product: BVT 2733

Identifier : DBSNPE002274
Drug : DB00779 (Nalidixic Acid)
Interacting Gene/Enzyme : Glucose-6-phosphate 1-dehydrogenase
Gene Name : G6PD
UniProt ID : P11413
Defining Change(s) :

  • 1155C->G

Allele Name : Madrid
Genotype(s) : Not Available
Type(s) : ADR Inferred
Groups : G6PD deficiency
Description : Increased risk of hemolytic anemia.
References :

  1. NegGram® Caplets (Nalidixic acid, USP)[package insert]. Bridgewater, New Jersey: Sanofi-Aventis U.S. LLC; 2012. [Link]

PMID: 8322381

Nalidixic Acid

By

Nalidixic Acid

Product: Loxapine (succinate)

Identifier : DBSNPE002275
Drug : DB00779 (Nalidixic Acid)
Interacting Gene/Enzyme : Glucose-6-phosphate 1-dehydrogenase
Gene Name : G6PD
UniProt ID : P11413
Defining Change(s) :

  • 1156A->G

Allele Name : Iowa, Walter Reed, Springfield
Genotype(s) : Not Available
Type(s) : ADR Inferred
Groups : G6PD deficiency
Description : Increased risk of hemolytic anemia.
References :

  1. NegGram® Caplets (Nalidixic acid, USP)[package insert]. Bridgewater, New Jersey: Sanofi-Aventis U.S. LLC; 2012. [Link]

PMID: 1727148

Nalidixic Acid

By

Nalidixic Acid

Product: RI-2

Identifier : DBSNPE002276
Drug : DB00779 (Nalidixic Acid)
Interacting Gene/Enzyme : Glucose-6-phosphate 1-dehydrogenase
Gene Name : G6PD
UniProt ID : P11413
Defining Change(s) :

  • 1160G->A

Allele Name : Beverly Hills, Genova, Iwate, Niigata, Yamaguchi
Genotype(s) : Not Available
Type(s) : ADR Inferred
Groups : G6PD deficiency
Description : Increased risk of hemolytic anemia.
References :

  1. NegGram® Caplets (Nalidixic acid, USP)[package insert]. Bridgewater, New Jersey: Sanofi-Aventis U.S. LLC; 2012. [Link]

PMID: 2148188

Nalidixic Acid

By

Nalidixic Acid

Product: PKC-IN-1

Identifier : DBSNPE002277
Drug : DB00779 (Nalidixic Acid)
Interacting Gene/Enzyme : Glucose-6-phosphate 1-dehydrogenase
Gene Name : G6PD
UniProt ID : P11413
Defining Change(s) :

  • 1162A->G

Allele Name : Hartford
Genotype(s) : Not Available
Type(s) : ADR Inferred
Groups : G6PD deficiency
Description : Increased risk of hemolytic anemia.
References :

  1. NegGram® Caplets (Nalidixic acid, USP)[package insert]. Bridgewater, New Jersey: Sanofi-Aventis U.S. LLC; 2012. [Link]

PMID: 8681893

Nalidixic Acid

By

Nalidixic Acid

Product: Ranirestat

Identifier : DBSNPE002278
Drug : DB00779 (Nalidixic Acid)
Interacting Gene/Enzyme : Glucose-6-phosphate 1-dehydrogenase
Gene Name : G6PD
UniProt ID : P11413
Defining Change(s) :

  • 1166A->G

Allele Name : Praha
Genotype(s) : Not Available
Type(s) : ADR Inferred
Groups : G6PD deficiency
Description : Increased risk of hemolytic anemia.
References :

  1. NegGram® Caplets (Nalidixic acid, USP)[package insert]. Bridgewater, New Jersey: Sanofi-Aventis U.S. LLC; 2012. [Link]

PMID: 7696633

Nalidixic Acid

By

Nalidixic Acid

Product: Clioquinol

Identifier : DBSNPE002279
Drug : DB00779 (Nalidixic Acid)
Interacting Gene/Enzyme : Glucose-6-phosphate 1-dehydrogenase
Gene Name : G6PD
UniProt ID : P11413
Defining Change(s) :

  • 1175T>C

Allele Name : Krakow
Genotype(s) : Not Available
Type(s) : ADR Inferred
Groups : G6PD deficiency
Description : Increased risk of hemolytic anemia.
References :

  1. NegGram® Caplets (Nalidixic acid, USP)[package insert]. Bridgewater, New Jersey: Sanofi-Aventis U.S. LLC; 2012. [Link]

PMID: 21278726

Nalidixic Acid

By

Nalidixic Acid

Product: TP-0903

Identifier : DBSNPE002280
Drug : DB00779 (Nalidixic Acid)
Interacting Gene/Enzyme : Glucose-6-phosphate 1-dehydrogenase
Gene Name : G6PD
UniProt ID : P11413
Defining Change(s) :

  • 1177C->G

Allele Name : Wisconsin
Genotype(s) : Not Available
Type(s) : ADR Inferred
Groups : G6PD deficiency
Description : Increased risk of hemolytic anemia.
References :

  1. NegGram® Caplets (Nalidixic acid, USP)[package insert]. Bridgewater, New Jersey: Sanofi-Aventis U.S. LLC; 2012. [Link]

PMID: 17904591

Nalidixic Acid

By

Nalidixic Acid

Product: SKLB4771

Identifier : DBSNPE002281
Drug : DB00779 (Nalidixic Acid)
Interacting Gene/Enzyme : Glucose-6-phosphate 1-dehydrogenase
Gene Name : G6PD
UniProt ID : P11413
Defining Change(s) :

  • 1178G->A

Allele Name : Nashville, Anaheim, Portici
Genotype(s) : Not Available
Type(s) : ADR Inferred
Groups : G6PD deficiency
Description : Increased risk of hemolytic anemia.
References :

  1. NegGram® Caplets (Nalidixic acid, USP)[package insert]. Bridgewater, New Jersey: Sanofi-Aventis U.S. LLC; 2012. [Link]

PMID: 10465680

Nalidixic Acid

By

Nalidixic Acid

Product: Eliprodil

Identifier : DBSNPE002282
Drug : DB00779 (Nalidixic Acid)
Interacting Gene/Enzyme : Glucose-6-phosphate 1-dehydrogenase
Gene Name : G6PD
UniProt ID : P11413
Defining Change(s) :

  • 1180G->C

Allele Name : Alhambra
Genotype(s) : Not Available
Type(s) : ADR Inferred
Groups : G6PD deficiency
Description : Increased risk of hemolytic anemia.
References :

  1. NegGram® Caplets (Nalidixic acid, USP)[package insert]. Bridgewater, New Jersey: Sanofi-Aventis U.S. LLC; 2012. [Link]

PMID: 9697119

Nalidixic Acid

By

Nalidixic Acid

Product: AZ191

Identifier : DBSNPE002283
Drug : DB00779 (Nalidixic Acid)
Interacting Gene/Enzyme : Glucose-6-phosphate 1-dehydrogenase
Gene Name : G6PD
UniProt ID : P11413
Defining Change(s) :

  • 1187C->T

Allele Name : Bari
Genotype(s) : Not Available
Type(s) : ADR Inferred
Groups : G6PD deficiency
Description : Increased risk of hemolytic anemia.
References :

  1. NegGram® Caplets (Nalidixic acid, USP)[package insert]. Bridgewater, New Jersey: Sanofi-Aventis U.S. LLC; 2012. [Link]

PMID: 9257940

Nalidixic Acid

By

Nalidixic Acid

Product: PH-064

Identifier : DBSNPE002284
Drug : DB00779 (Nalidixic Acid)
Interacting Gene/Enzyme : Glucose-6-phosphate 1-dehydrogenase
Gene Name : G6PD
UniProt ID : P11413
Defining Change(s) :

  • 1192G->A

Allele Name : Puerto Limon
Genotype(s) : Not Available
Type(s) : ADR Inferred
Groups : G6PD deficiency
Description : Increased risk of hemolytic anemia.
References :

  1. NegGram® Caplets (Nalidixic acid, USP)[package insert]. Bridgewater, New Jersey: Sanofi-Aventis U.S. LLC; 2012. [Link]

PMID: 19154422

Nalidixic Acid

By

Nalidixic Acid

Product: Curcumol

Identifier : DBSNPE002285
Drug : DB00779 (Nalidixic Acid)
Interacting Gene/Enzyme : Glucose-6-phosphate 1-dehydrogenase
Gene Name : G6PD
UniProt ID : P11413
Defining Change(s) :

  • 1205C>A

Allele Name : Covao do Lobo
Genotype(s) : Not Available
Type(s) : ADR Inferred
Groups : G6PD deficiency
Description : Increased risk of hemolytic anemia.
References :

  1. NegGram® Caplets (Nalidixic acid, USP)[package insert]. Bridgewater, New Jersey: Sanofi-Aventis U.S. LLC; 2012. [Link]

PMID: 1771215

Nalidixic Acid

By

Nalidixic Acid

Product: 3,4-Dicaffeoylquinic acid

Identifier : DBSNPE002286
Drug : DB00779 (Nalidixic Acid)
Interacting Gene/Enzyme : Glucose-6-phosphate 1-dehydrogenase
Gene Name : G6PD
UniProt ID : P11413
Defining Change(s) :

  • 1215G->A

Allele Name : Clinic
Genotype(s) : Not Available
Type(s) : ADR Inferred
Groups : G6PD deficiency
Description : Increased risk of hemolytic anemia.
References :

  1. NegGram® Caplets (Nalidixic acid, USP)[package insert]. Bridgewater, New Jersey: Sanofi-Aventis U.S. LLC; 2012. [Link]

PMID: 1688947

Nalidixic Acid

By

Nalidixic Acid

Product: Daidzin

Identifier : DBSNPE002287
Drug : DB00779 (Nalidixic Acid)
Interacting Gene/Enzyme : Glucose-6-phosphate 1-dehydrogenase
Gene Name : G6PD
UniProt ID : P11413
Defining Change(s) :

  • 1225C->T

Allele Name : Udivecht
Genotype(s) : Not Available
Type(s) : ADR Inferred
Groups : G6PD deficiency
Description : Increased risk of hemolytic anemia.
References :

  1. NegGram® Caplets (Nalidixic acid, USP)[package insert]. Bridgewater, New Jersey: Sanofi-Aventis U.S. LLC; 2012. [Link]

PMID: 1526248

Nalidixic Acid

By

Nalidixic Acid

Product: Argatroban (monohydrate)

Identifier : DBSNPE002288
Drug : DB00779 (Nalidixic Acid)
Interacting Gene/Enzyme : Glucose-6-phosphate 1-dehydrogenase
Gene Name : G6PD
UniProt ID : P11413
Defining Change(s) :

  • 1226C->G

Allele Name : Suwalki
Genotype(s) : Not Available
Type(s) : ADR Inferred
Groups : G6PD deficiency
Description : Increased risk of hemolytic anemia.
References :

  1. NegGram® Caplets (Nalidixic acid, USP)[package insert]. Bridgewater, New Jersey: Sanofi-Aventis U.S. LLC; 2012. [Link]

PMID: 1912992

Nalidixic Acid

By

Nalidixic Acid

Product: Pexidartinib

Identifier : DBSNPE002289
Drug : DB00779 (Nalidixic Acid)
Interacting Gene/Enzyme : Glucose-6-phosphate 1-dehydrogenase
Gene Name : G6PD
UniProt ID : P11413
Defining Change(s) :

  • 1228G->T

Allele Name : Riverside
Genotype(s) : Not Available
Type(s) : ADR Inferred
Groups : G6PD deficiency
Description : Increased risk of hemolytic anemia.
References :

  1. NegGram® Caplets (Nalidixic acid, USP)[package insert]. Bridgewater, New Jersey: Sanofi-Aventis U.S. LLC; 2012. [Link]

PMID: 3529096

Nalidixic Acid

By

Nalidixic Acid

Product: BS-181 (hydrochloride)

Identifier : DBSNPE002290
Drug : DB00779 (Nalidixic Acid)
Interacting Gene/Enzyme : Glucose-6-phosphate 1-dehydrogenase
Gene Name : G6PD
UniProt ID : P11413
Defining Change(s) :

  • 1229G->A

Allele Name : Japan, Shinagawa
Genotype(s) : Not Available
Type(s) : ADR Inferred
Groups : G6PD deficiency
Description : Increased risk of hemolytic anemia.
References :

  1. NegGram® Caplets (Nalidixic acid, USP)[package insert]. Bridgewater, New Jersey: Sanofi-Aventis U.S. LLC; 2012. [Link]

PMID: 27078878

Nalidixic Acid

By

Nalidixic Acid

Product: NMDA-IN-1

Identifier : DBSNPE002291
Drug : DB00779 (Nalidixic Acid)
Interacting Gene/Enzyme : Glucose-6-phosphate 1-dehydrogenase
Gene Name : G6PD
UniProt ID : P11413
Defining Change(s) :

  • 1229G->C

Allele Name : Kawasaki
Genotype(s) : Not Available
Type(s) : ADR Inferred
Groups : G6PD deficiency
Description : Increased risk of hemolytic anemia.
References :

  1. NegGram® Caplets (Nalidixic acid, USP)[package insert]. Bridgewater, New Jersey: Sanofi-Aventis U.S. LLC; 2012. [Link]

PMID: 25854456

Nalidixic Acid

By

Nalidixic Acid

Product: Glycitein

Identifier : DBSNPE002292
Drug : DB00779 (Nalidixic Acid)
Interacting Gene/Enzyme : Glucose-6-phosphate 1-dehydrogenase
Gene Name : G6PD
UniProt ID : P11413
Defining Change(s) :

  • 1231A->G

Allele Name : Munich
Genotype(s) : Not Available
Type(s) : ADR Inferred
Groups : G6PD deficiency
Description : Increased risk of hemolytic anemia.
References :

  1. NegGram® Caplets (Nalidixic acid, USP)[package insert]. Bridgewater, New Jersey: Sanofi-Aventis U.S. LLC; 2012. [Link]

PMID: 26020793

Nalidixic Acid

By

Nalidixic Acid

Product: Glycitin

Identifier : DBSNPE002293
Drug : DB00779 (Nalidixic Acid)
Interacting Gene/Enzyme : Glucose-6-phosphate 1-dehydrogenase
Gene Name : G6PD
UniProt ID : P11413
Defining Change(s) :

  • 1284C->A

Allele Name : Georgia
Genotype(s) : Not Available
Type(s) : ADR Inferred
Groups : G6PD deficiency
Description : Increased risk of hemolytic anemia.
References :

  1. NegGram® Caplets (Nalidixic acid, USP)[package insert]. Bridgewater, New Jersey: Sanofi-Aventis U.S. LLC; 2012. [Link]

PMID: 25953296

Nalidixic Acid

By

Nalidixic Acid

Product: 5(6)-TAMRA SE

Identifier : DBSNPE002294
Drug : DB00779 (Nalidixic Acid)
Interacting Gene/Enzyme : Glucose-6-phosphate 1-dehydrogenase
Gene Name : G6PD
UniProt ID : P11413
Defining Change(s) :

  • 1292T->G

Allele Name : Sumare
Genotype(s) : Not Available
Type(s) : ADR Inferred
Groups : G6PD deficiency
Description : Increased risk of hemolytic anemia.
References :

  1. NegGram® Caplets (Nalidixic acid, USP)[package insert]. Bridgewater, New Jersey: Sanofi-Aventis U.S. LLC; 2012. [Link]

PMID: 26042007

Nalidixic Acid

By

Nalidixic Acid

Product: 5(6)-CFDA

Identifier : DBSNPE002295
Drug : DB00779 (Nalidixic Acid)
Interacting Gene/Enzyme : Glucose-6-phosphate 1-dehydrogenase
Gene Name : G6PD
UniProt ID : P11413
Defining Change(s) :

  • 1318C->T

Allele Name : Telti/Kobe
Genotype(s) : Not Available
Type(s) : ADR Inferred
Groups : G6PD deficiency
Description : Increased risk of hemolytic anemia.
References :

  1. NegGram® Caplets (Nalidixic acid, USP)[package insert]. Bridgewater, New Jersey: Sanofi-Aventis U.S. LLC; 2012. [Link]

PMID: 25817857

Nalidixic Acid

By

Nalidixic Acid

Product: 6-CFDA

Identifier : DBSNPE002296
Drug : DB00779 (Nalidixic Acid)
Interacting Gene/Enzyme : Glucose-6-phosphate 1-dehydrogenase
Gene Name : G6PD
UniProt ID : P11413
Defining Change(s) :

  • 1339G->A

Allele Name : Santiago de Cuba, Morioka
Genotype(s) : Not Available
Type(s) : ADR Inferred
Groups : G6PD deficiency
Description : Increased risk of hemolytic anemia.
References :

  1. NegGram® Caplets (Nalidixic acid, USP)[package insert]. Bridgewater, New Jersey: Sanofi-Aventis U.S. LLC; 2012. [Link]

PMID: 26074815

Nalidixic Acid

By

Nalidixic Acid

Product: 6-TAMRA-SE

Identifier : DBSNPE002297
Drug : DB00779 (Nalidixic Acid)
Interacting Gene/Enzyme : Glucose-6-phosphate 1-dehydrogenase
Gene Name : G6PD
UniProt ID : P11413
Defining Change(s) :

  • 1358T->A

Allele Name : Harima
Genotype(s) : Not Available
Type(s) : ADR Inferred
Groups : G6PD deficiency
Description : Increased risk of hemolytic anemia.
References :

  1. NegGram® Caplets (Nalidixic acid, USP)[package insert]. Bridgewater, New Jersey: Sanofi-Aventis U.S. LLC; 2012. [Link]

PMID: 24391468

Nalidixic Acid

By

Nalidixic Acid

Product: 5(6)-Aminofluorescein

Identifier : DBSNPE002298
Drug : DB00779 (Nalidixic Acid)
Interacting Gene/Enzyme : Glucose-6-phosphate 1-dehydrogenase
Gene Name : G6PD
UniProt ID : P11413
Defining Change(s) :

  • 1366G->C

Allele Name : Figuera da Foz
Genotype(s) : Not Available
Type(s) : ADR Inferred
Groups : G6PD deficiency
Description : Increased risk of hemolytic anemia.
References :

  1. NegGram® Caplets (Nalidixic acid, USP)[package insert]. Bridgewater, New Jersey: Sanofi-Aventis U.S. LLC; 2012. [Link]

PMID: 22754048

Nalidixic Acid

By

Nalidixic Acid

Product: 6-Aminofluorescein

Identifier : DBSNPE002299
Drug : DB00779 (Nalidixic Acid)
Interacting Gene/Enzyme : Glucose-6-phosphate 1-dehydrogenase
Gene Name : G6PD
UniProt ID : P11413
Defining Change(s) :

  • 1367A>T

Allele Name : Amiens
Genotype(s) : Not Available
Type(s) : ADR Inferred
Groups : G6PD deficiency
Description : Increased risk of hemolytic anemia.
References :

  1. NegGram® Caplets (Nalidixic acid, USP)[package insert]. Bridgewater, New Jersey: Sanofi-Aventis U.S. LLC; 2012. [Link]

PMID: 20164347

Nalidixic Acid

By

Nalidixic Acid

Product: 5-Aminofluorescein

Identifier : DBSNPE002300
Drug : DB00779 (Nalidixic Acid)
Interacting Gene/Enzyme : Glucose-6-phosphate 1-dehydrogenase
Gene Name : G6PD
UniProt ID : P11413
Defining Change(s) :

  • 1376G->T, 1502T->G

Allele Name : Bangkok Noi
Genotype(s) : Not Available
Type(s) : ADR Inferred
Groups : G6PD deficiency
Description : Increased risk of hemolytic anemia.
References :

  1. NegGram® Caplets (Nalidixic acid, USP)[package insert]. Bridgewater, New Jersey: Sanofi-Aventis U.S. LLC; 2012. [Link]

PMID: 19404260

Nalidixic Acid

By

Nalidixic Acid

Product: Pivmecillinam (hydrochloride)

Identifier : DBSNPE002301
Drug : DB00779 (Nalidixic Acid)
Interacting Gene/Enzyme : Glucose-6-phosphate 1-dehydrogenase
Gene Name : G6PD
UniProt ID : P11413
Defining Change(s) :

  • 1462G->A

Allele Name : Fukaya
Genotype(s) : Not Available
Type(s) : ADR Inferred
Groups : G6PD deficiency
Description : Increased risk of hemolytic anemia.
References :

  1. NegGram® Caplets (Nalidixic acid, USP)[package insert]. Bridgewater, New Jersey: Sanofi-Aventis U.S. LLC; 2012. [Link]

PMID: 18844999

Nalidixic Acid

By

Nalidixic Acid

Product: Fenoldopam (mesylate)

Identifier : DBSNPE002302
Drug : DB00779 (Nalidixic Acid)
Interacting Gene/Enzyme : Glucose-6-phosphate 1-dehydrogenase
Gene Name : G6PD
UniProt ID : P11413
Defining Change(s) :

  • 1463G->T

Allele Name : Campinas
Genotype(s) : Not Available
Type(s) : ADR Inferred
Groups : G6PD deficiency
Description : Increased risk of hemolytic anemia.
References :

  1. NegGram® Caplets (Nalidixic acid, USP)[package insert]. Bridgewater, New Jersey: Sanofi-Aventis U.S. LLC; 2012. [Link]

PMID: 15529015

Nalidixic Acid

By

Nalidixic Acid

Product: Trimebutine (maleate)

Identifier : DBSNPE002303
Drug : DB00779 (Nalidixic Acid)
Interacting Gene/Enzyme : Glucose-6-phosphate 1-dehydrogenase
Gene Name : G6PD
UniProt ID : P11413
Defining Change(s) :

  • 1465C>T

Allele Name : Buenos Aires
Genotype(s) : Not Available
Type(s) : ADR Inferred
Groups : G6PD deficiency
Description : Increased risk of hemolytic anemia.
References :

  1. NegGram® Caplets (Nalidixic acid, USP)[package insert]. Bridgewater, New Jersey: Sanofi-Aventis U.S. LLC; 2012. [Link]

PMID: 12490542

Nalidixic Acid

By

Nalidixic Acid

Product: 5(6)-Carboxyfluorescein

Identifier : DBSNPE002304
Drug : DB00779 (Nalidixic Acid)
Interacting Gene/Enzyme : Glucose-6-phosphate 1-dehydrogenase
Gene Name : G6PD
UniProt ID : P11413
Defining Change(s) :

  • 1466C->T

Allele Name : Arakawa
Genotype(s) : Not Available
Type(s) : ADR Inferred
Groups : G6PD deficiency
Description : Increased risk of hemolytic anemia.
References :

  1. NegGram® Caplets (Nalidixic acid, USP)[package insert]. Bridgewater, New Jersey: Sanofi-Aventis U.S. LLC; 2012. [Link]

PMID: 12514118

Nalidixic Acid

By

Nalidixic Acid

Product: Schisantherin A

Identifier : DBSNPE002305
Drug : DB00779 (Nalidixic Acid)
Interacting Gene/Enzyme : Glucose-6-phosphate 1-dehydrogenase
Gene Name : G6PD
UniProt ID : P11413
Defining Change(s) :

  • 1488_1490delGAA

Allele Name : Brighton
Genotype(s) : Not Available
Type(s) : ADR Inferred
Groups : G6PD deficiency
Description : Increased risk of hemolytic anemia.
References :

  1. NegGram® Caplets (Nalidixic acid, USP)[package insert]. Bridgewater, New Jersey: Sanofi-Aventis U.S. LLC; 2012. [Link]

PMID: 10353496

Nalidixic Acid

By

Nalidixic Acid

Product: Schisandrin A

Identifier : DBSNPE002306
Drug : DB00779 (Nalidixic Acid)
Interacting Gene/Enzyme : Glucose-6-phosphate 1-dehydrogenase
Gene Name : G6PD
UniProt ID : P11413
Defining Change(s) :

  • 159G->C

Allele Name : Kozukata
Genotype(s) : Not Available
Type(s) : ADR Inferred
Groups : G6PD deficiency
Description : Increased risk of hemolytic anemia.
References :

  1. NegGram® Caplets (Nalidixic acid, USP)[package insert]. Bridgewater, New Jersey: Sanofi-Aventis U.S. LLC; 2012. [Link]

PMID: 9311667

Nalidixic Acid

By

Nalidixic Acid

Product: Dehydroandrographolide

Identifier : DBSNPE002307
Drug : DB00779 (Nalidixic Acid)
Interacting Gene/Enzyme : Glucose-6-phosphate 1-dehydrogenase
Gene Name : G6PD
UniProt ID : P11413
Defining Change(s) :

  • 180_182delTCT

Allele Name : Amsterdam
Genotype(s) : Not Available
Type(s) : ADR Inferred
Groups : G6PD deficiency
Description : Increased risk of hemolytic anemia.
References :

  1. NegGram® Caplets (Nalidixic acid, USP)[package insert]. Bridgewater, New Jersey: Sanofi-Aventis U.S. LLC; 2012. [Link]

PMID: 11909726

Nalidixic Acid

By

Nalidixic Acid

Product: 3,5-Dicaffeoylquinic acid

Identifier : DBSNPE002308
Drug : DB00779 (Nalidixic Acid)
Interacting Gene/Enzyme : Glucose-6-phosphate 1-dehydrogenase
Gene Name : G6PD
UniProt ID : P11413
Defining Change(s) :

  • 202G->A, 376A->G, 1264C>G

Allele Name : No name
Genotype(s) : Not Available
Type(s) : ADR Inferred
Groups : G6PD deficiency
Description : Increased risk of hemolytic anemia.
References :

  1. NegGram® Caplets (Nalidixic acid, USP)[package insert]. Bridgewater, New Jersey: Sanofi-Aventis U.S. LLC; 2012. [Link]

PMID: 7542607

Nalidixic Acid

By

Nalidixic Acid

Product: Notoginsenoside Fe

Identifier : DBSNPE002309
Drug : DB00779 (Nalidixic Acid)
Interacting Gene/Enzyme : Glucose-6-phosphate 1-dehydrogenase
Gene Name : G6PD
UniProt ID : P11413
Defining Change(s) :

  • 224T->C

Allele Name : Swansea
Genotype(s) : Not Available
Type(s) : ADR Inferred
Groups : G6PD deficiency
Description : Increased risk of hemolytic anemia.
References :

  1. NegGram® Caplets (Nalidixic acid, USP)[package insert]. Bridgewater, New Jersey: Sanofi-Aventis U.S. LLC; 2012. [Link]

PMID: 1532027

Nalidixic Acid

By

Nalidixic Acid

Product: Ginsenoside Rg1

Identifier : DBSNPE002311
Drug : DB00779 (Nalidixic Acid)
Interacting Gene/Enzyme : Glucose-6-phosphate 1-dehydrogenase
Gene Name : G6PD
UniProt ID : P11413
Defining Change(s) :

  • 317C->G544C->T592C->T

Allele Name : Vancouver
Genotype(s) : Not Available
Type(s) : ADR Inferred
Groups : G6PD deficiency
Description : Increased risk of hemolytic anemia.
References :

  1. NegGram® Caplets (Nalidixic acid, USP)[package insert]. Bridgewater, New Jersey: Sanofi-Aventis U.S. LLC; 2012. [Link]

PMID: 26137161

Nalidixic Acid

By

Nalidixic Acid

Product: Ginsenoside Re

Identifier : DBSNPE002312
Drug : DB00779 (Nalidixic Acid)
Interacting Gene/Enzyme : Glucose-6-phosphate 1-dehydrogenase
Gene Name : G6PD
UniProt ID : P11413
Defining Change(s) :

  • 376A->G, 1159C->T

Allele Name : Mt Sinai
Genotype(s) : Not Available
Type(s) : ADR Inferred
Groups : G6PD deficiency
Description : Increased risk of hemolytic anemia.
References :

  1. NegGram® Caplets (Nalidixic acid, USP)[package insert]. Bridgewater, New Jersey: Sanofi-Aventis U.S. LLC; 2012. [Link]

PMID: 9042584

Nalidixic Acid

By

Nalidixic Acid

Product: Ginsenoside Rd

Identifier : DBSNPE002313
Drug : DB00779 (Nalidixic Acid)
Interacting Gene/Enzyme : Glucose-6-phosphate 1-dehydrogenase
Gene Name : G6PD
UniProt ID : P11413
Defining Change(s) :

  • 488G->A

Allele Name : Plymouth
Genotype(s) : Not Available
Type(s) : ADR Inferred
Groups : G6PD deficiency
Description : Increased risk of hemolytic anemia.
References :

  1. NegGram® Caplets (Nalidixic acid, USP)[package insert]. Bridgewater, New Jersey: Sanofi-Aventis U.S. LLC; 2012. [Link]

PMID: 9203533

Nalidixic Acid

By

Nalidixic Acid

Product: Fenoprofen (Calcium hydrate)

Identifier : DBSNPE002314
Drug : DB00779 (Nalidixic Acid)
Interacting Gene/Enzyme : Glucose-6-phosphate 1-dehydrogenase
Gene Name : G6PD
UniProt ID : P11413
Defining Change(s) :

  • 514C->T

Allele Name : Volendam
Genotype(s) : Not Available
Type(s) : ADR Inferred
Groups : G6PD deficiency
Description : Increased risk of hemolytic anemia.
References :

  1. NegGram® Caplets (Nalidixic acid, USP)[package insert]. Bridgewater, New Jersey: Sanofi-Aventis U.S. LLC; 2012. [Link]

PMID: 8355251

Nalidixic Acid

By

Nalidixic Acid

Product: Enoxacin (hydrate)

Identifier : DBSNPE002315
Drug : DB00779 (Nalidixic Acid)
Interacting Gene/Enzyme : Glucose-6-phosphate 1-dehydrogenase
Gene Name : G6PD
UniProt ID : P11413
Defining Change(s) :

  • 527A->G

Allele Name : Shinshu
Genotype(s) : Not Available
Type(s) : ADR Inferred
Groups : G6PD deficiency
Description : Increased risk of hemolytic anemia.
References :

  1. NegGram® Caplets (Nalidixic acid, USP)[package insert]. Bridgewater, New Jersey: Sanofi-Aventis U.S. LLC; 2012. [Link]

PMID: 15721167

Nalidixic Acid

By

Nalidixic Acid

Product: Tegaserod (maleate)

Identifier : DBSNPE002316
Drug : DB00779 (Nalidixic Acid)
Interacting Gene/Enzyme : Glucose-6-phosphate 1-dehydrogenase
Gene Name : G6PD
UniProt ID : P11413
Defining Change(s) :

  • 535A->T

Allele Name : Chikugo
Genotype(s) : Not Available
Type(s) : ADR Inferred
Groups : G6PD deficiency
Description : Increased risk of hemolytic anemia.
References :

  1. NegGram® Caplets (Nalidixic acid, USP)[package insert]. Bridgewater, New Jersey: Sanofi-Aventis U.S. LLC; 2012. [Link]

PMID: 1361408

Nalidixic Acid

By

Nalidixic Acid

Product: Dinoprost (tromethamine salt)

Identifier : DBSNPE002317
Drug : DB00779 (Nalidixic Acid)
Interacting Gene/Enzyme : Glucose-6-phosphate 1-dehydrogenase
Gene Name : G6PD
UniProt ID : P11413
Defining Change(s) :

  • 561_563delCTC

Allele Name : Tsukui
Genotype(s) : Not Available
Type(s) : ADR Inferred
Groups : G6PD deficiency
Description : Increased risk of hemolytic anemia.
References :

  1. NegGram® Caplets (Nalidixic acid, USP)[package insert]. Bridgewater, New Jersey: Sanofi-Aventis U.S. LLC; 2012. [Link]

PMID: 15743930

Nalidixic Acid

By

Nalidixic Acid

Product: Dinoprost

Identifier : DBSNPE002318
Drug : DB00779 (Nalidixic Acid)
Interacting Gene/Enzyme : Glucose-6-phosphate 1-dehydrogenase
Gene Name : G6PD
UniProt ID : P11413
Defining Change(s) :

  • 573C>G

Allele Name : Pedoplis-Ckaro
Genotype(s) : Not Available
Type(s) : ADR Inferred
Groups : G6PD deficiency
Description : Increased risk of hemolytic anemia.
References :

  1. NegGram® Caplets (Nalidixic acid, USP)[package insert]. Bridgewater, New Jersey: Sanofi-Aventis U.S. LLC; 2012. [Link]

PMID: 15801853

Nalidixic Acid

By

Nalidixic Acid

Product: UC-112

Identifier : DBSNPE002319
Drug : DB00779 (Nalidixic Acid)
Interacting Gene/Enzyme : Glucose-6-phosphate 1-dehydrogenase
Gene Name : G6PD
UniProt ID : P11413
Defining Change(s) :

  • 593G->C

Allele Name : Santiago
Genotype(s) : Not Available
Type(s) : ADR Inferred
Groups : G6PD deficiency
Description : Increased risk of hemolytic anemia.
References :

  1. NegGram® Caplets (Nalidixic acid, USP)[package insert]. Bridgewater, New Jersey: Sanofi-Aventis U.S. LLC; 2012. [Link]

PMID: 1435743

Nalidixic Acid

By

Nalidixic Acid

Product: OBA-09

Identifier : DBSNPE002320
Drug : DB00779 (Nalidixic Acid)
Interacting Gene/Enzyme : Glucose-6-phosphate 1-dehydrogenase
Gene Name : G6PD
UniProt ID : P11413
Defining Change(s) :

  • 637G->T

Allele Name : Minnesota, Marion, Gastonia, LeJeune
Genotype(s) : Not Available
Type(s) : ADR Inferred
Groups : G6PD deficiency
Description : Increased risk of hemolytic anemia.
References :

  1. NegGram® Caplets (Nalidixic acid, USP)[package insert]. Bridgewater, New Jersey: Sanofi-Aventis U.S. LLC; 2012. [Link]

PMID: 26282667

Nalidixic Acid

By

Nalidixic Acid

Product: p38 MAPK-IN-1

Identifier : DBSNPE002321
Drug : DB00779 (Nalidixic Acid)
Interacting Gene/Enzyme : Glucose-6-phosphate 1-dehydrogenase
Gene Name : G6PD
UniProt ID : P11413
Defining Change(s) :

  • 637G->T, 1037A->T

Allele Name : Cincinnati
Genotype(s) : Not Available
Type(s) : ADR Inferred
Groups : G6PD deficiency
Description : Increased risk of hemolytic anemia.
References :

  1. NegGram® Caplets (Nalidixic acid, USP)[package insert]. Bridgewater, New Jersey: Sanofi-Aventis U.S. LLC; 2012. [Link]

PMID: 21389220

Nalidixic Acid

By

Nalidixic Acid

Product: Mirk-IN-1

Identifier : DBSNPE002322
Drug : DB00779 (Nalidixic Acid)
Interacting Gene/Enzyme : Glucose-6-phosphate 1-dehydrogenase
Gene Name : G6PD
UniProt ID : P11413
Defining Change(s) :

  • 648T->G

Allele Name : Harilaou
Genotype(s) : Not Available
Type(s) : ADR Inferred
Groups : G6PD deficiency
Description : Increased risk of hemolytic anemia.
References :

  1. NegGram® Caplets (Nalidixic acid, USP)[package insert]. Bridgewater, New Jersey: Sanofi-Aventis U.S. LLC; 2012. [Link]

PMID: 20684595

Nalidixic Acid

By

Nalidixic Acid

Product: EN460

Identifier : DBSNPE002323
Drug : DB00779 (Nalidixic Acid)
Interacting Gene/Enzyme : Glucose-6-phosphate 1-dehydrogenase
Gene Name : G6PD
UniProt ID : P11413
Defining Change(s) :

  • 683_685delACA

Allele Name : North Dallas
Genotype(s) : Not Available
Type(s) : ADR Inferred
Groups : G6PD deficiency
Description : Increased risk of hemolytic anemia.
References :

  1. NegGram® Caplets (Nalidixic acid, USP)[package insert]. Bridgewater, New Jersey: Sanofi-Aventis U.S. LLC; 2012. [Link]

PMID: 11906711

Nalidixic Acid

By

Nalidixic Acid

Product: IFN alpha-IFNAR-IN-1

Identifier : DBSNPE002324
Drug : DB00779 (Nalidixic Acid)
Interacting Gene/Enzyme : Glucose-6-phosphate 1-dehydrogenase
Gene Name : G6PD
UniProt ID : P11413
Defining Change(s) :

  • 695G->A

Allele Name : Asahikawa
Genotype(s) : Not Available
Type(s) : ADR Inferred
Groups : G6PD deficiency
Description : Increased risk of hemolytic anemia.
References :

  1. NegGram® Caplets (Nalidixic acid, USP)[package insert]. Bridgewater, New Jersey: Sanofi-Aventis U.S. LLC; 2012. [Link]

PMID: 8558426

Nalidixic Acid

By

Nalidixic Acid

Product: S1P1 Agonist III

Identifier : DBSNPE002325
Drug : DB00779 (Nalidixic Acid)
Interacting Gene/Enzyme : Glucose-6-phosphate 1-dehydrogenase
Gene Name : G6PD
UniProt ID : P11413
Defining Change(s) :

  • 713A->G

Allele Name : Durham
Genotype(s) : Not Available
Type(s) : ADR Inferred
Groups : G6PD deficiency
Description : Increased risk of hemolytic anemia.
References :

  1. NegGram® Caplets (Nalidixic acid, USP)[package insert]. Bridgewater, New Jersey: Sanofi-Aventis U.S. LLC; 2012. [Link]

PMID: 7486610

Nalidixic Acid

By

Nalidixic Acid

Product: MK2-IN-1

Identifier : DBSNPE002326
Drug : DB00779 (Nalidixic Acid)
Interacting Gene/Enzyme : Glucose-6-phosphate 1-dehydrogenase
Gene Name : G6PD
UniProt ID : P11413
Defining Change(s) :

  • 724_729delGGCACT

Allele Name : Stonybrook
Genotype(s) : Not Available
Type(s) : ADR Inferred
Groups : G6PD deficiency
Description : Increased risk of hemolytic anemia.
References :

  1. NegGram® Caplets (Nalidixic acid, USP)[package insert]. Bridgewater, New Jersey: Sanofi-Aventis U.S. LLC; 2012. [Link]

PMID: 15256539

Nalidixic Acid

By

Nalidixic Acid

Product: AMZ30

Identifier : DBSNPE002327
Drug : DB00779 (Nalidixic Acid)
Interacting Gene/Enzyme : Glucose-6-phosphate 1-dehydrogenase
Gene Name : G6PD
UniProt ID : P11413
Defining Change(s) :

  • 769C->G

Allele Name : Wayne
Genotype(s) : Not Available
Type(s) : ADR Inferred
Groups : G6PD deficiency
Description : Increased risk of hemolytic anemia.
References :

  1. NegGram® Caplets (Nalidixic acid, USP)[package insert]. Bridgewater, New Jersey: Sanofi-Aventis U.S. LLC; 2012. [Link]

PMID: 11290368

Nalidixic Acid

By

Nalidixic Acid

Product: Ampkinone

Identifier : DBSNPE002328
Drug : DB00779 (Nalidixic Acid)
Interacting Gene/Enzyme : Glucose-6-phosphate 1-dehydrogenase
Gene Name : G6PD
UniProt ID : P11413
Defining Change(s) :

  • 806G->A

Allele Name : Aveiro
Genotype(s) : Not Available
Type(s) : ADR Inferred
Groups : G6PD deficiency
Description : Increased risk of hemolytic anemia.
References :

  1. NegGram® Caplets (Nalidixic acid, USP)[package insert]. Bridgewater, New Jersey: Sanofi-Aventis U.S. LLC; 2012. [Link]

PMID: 9400004

Nalidixic Acid

By

Nalidixic Acid

Product: M-110

Identifier : DBSNPE002329
Drug : DB00779 (Nalidixic Acid)
Interacting Gene/Enzyme : Glucose-6-phosphate 1-dehydrogenase
Gene Name : G6PD
UniProt ID : P11413
Defining Change(s) :

  • 820G->A

Allele Name : Cleveland Corum
Genotype(s) : Not Available
Type(s) : ADR Inferred
Groups : G6PD deficiency
Description : Increased risk of hemolytic anemia.
References :

  1. NegGram® Caplets (Nalidixic acid, USP)[package insert]. Bridgewater, New Jersey: Sanofi-Aventis U.S. LLC; 2012. [Link]

PMID: 27538456

Nalidixic Acid

By

Nalidixic Acid

Product: Epimedin A

Identifier : DBSNPE002330
Drug : DB00779 (Nalidixic Acid)
Interacting Gene/Enzyme : Glucose-6-phosphate 1-dehydrogenase
Gene Name : G6PD
UniProt ID : P11413
Defining Change(s) :

  • 821A>T

Allele Name : Lille
Genotype(s) : Not Available
Type(s) : ADR Inferred
Groups : G6PD deficiency
Description : Increased risk of hemolytic anemia.
References :

  1. NegGram® Caplets (Nalidixic acid, USP)[package insert]. Bridgewater, New Jersey: Sanofi-Aventis U.S. LLC; 2012. [Link]

PMID: 26829109

Nalidixic Acid

By

Nalidixic Acid

Product: FG-2216

Identifier : DBSNPE002331
Drug : DB00779 (Nalidixic Acid)
Interacting Gene/Enzyme : Glucose-6-phosphate 1-dehydrogenase
Gene Name : G6PD
UniProt ID : P11413
Defining Change(s) :

  • 825G>C

Allele Name : Bangkok
Genotype(s) : Not Available
Type(s) : ADR Inferred
Groups : G6PD deficiency
Description : Increased risk of hemolytic anemia.
References :

  1. NegGram® Caplets (Nalidixic acid, USP)[package insert]. Bridgewater, New Jersey: Sanofi-Aventis U.S. LLC; 2012. [Link]

PMID: 26489684

Nalidixic Acid

By

Nalidixic Acid

Product: ML204

Identifier : DBSNPE002333
Drug : DB00779 (Nalidixic Acid)
Interacting Gene/Enzyme : Glucose-6-phosphate 1-dehydrogenase
Gene Name : G6PD
UniProt ID : P11413
Defining Change(s) :

  • 832T->C

Allele Name : La Jolla
Genotype(s) : Not Available
Type(s) : ADR Inferred
Groups : G6PD deficiency
Description : Increased risk of hemolytic anemia.
References :

  1. NegGram® Caplets (Nalidixic acid, USP)[package insert]. Bridgewater, New Jersey: Sanofi-Aventis U.S. LLC; 2012. [Link]

PMID: 26085624

Nalidixic Acid

By

Nalidixic Acid

Product: JNJ-42041935

Identifier : DBSNPE002334
Drug : DB00779 (Nalidixic Acid)
Interacting Gene/Enzyme : Glucose-6-phosphate 1-dehydrogenase
Gene Name : G6PD
UniProt ID : P11413
Defining Change(s) :

  • 833C->T

Allele Name : Wexham
Genotype(s) : Not Available
Type(s) : ADR Inferred
Groups : G6PD deficiency
Description : Increased risk of hemolytic anemia.
References :

  1. NegGram® Caplets (Nalidixic acid, USP)[package insert]. Bridgewater, New Jersey: Sanofi-Aventis U.S. LLC; 2012. [Link]

PMID: 25057049

Nalidixic Acid

By

Nalidixic Acid

Product: SR-3306

Identifier : DBSNPE002335
Drug : DB00779 (Nalidixic Acid)
Interacting Gene/Enzyme : Glucose-6-phosphate 1-dehydrogenase
Gene Name : G6PD
UniProt ID : P11413
Defining Change(s) :

  • 851T>C

Allele Name : Piodivkow
Genotype(s) : Not Available
Type(s) : ADR Inferred
Groups : G6PD deficiency
Description : Increased risk of hemolytic anemia.
References :

  1. NegGram® Caplets (Nalidixic acid, USP)[package insert]. Bridgewater, New Jersey: Sanofi-Aventis U.S. LLC; 2012. [Link]

PMID: 24301649

Nalidixic Acid

By

Nalidixic Acid

Product: Mesaconitine

Identifier : DBSNPE002336
Drug : DB00779 (Nalidixic Acid)
Interacting Gene/Enzyme : Glucose-6-phosphate 1-dehydrogenase
Gene Name : G6PD
UniProt ID : P11413
Defining Change(s) :

  • 910G->T

Allele Name : West Virginia
Genotype(s) : Not Available
Type(s) : ADR Inferred
Groups : G6PD deficiency
Description : Increased risk of hemolytic anemia.
References :

  1. NegGram® Caplets (Nalidixic acid, USP)[package insert]. Bridgewater, New Jersey: Sanofi-Aventis U.S. LLC; 2012. [Link]

PMID: 23333502

Nalidixic Acid

By

Nalidixic Acid

Product: 5-TAMRA-SE

Identifier : DBSNPE002337
Drug : DB00779 (Nalidixic Acid)
Interacting Gene/Enzyme : Glucose-6-phosphate 1-dehydrogenase
Gene Name : G6PD
UniProt ID : P11413
Defining Change(s) :

  • 921G->C

Allele Name : Omiya
Genotype(s) : Not Available
Type(s) : ADR Inferred
Groups : G6PD deficiency
Description : Increased risk of hemolytic anemia.
References :

  1. NegGram® Caplets (Nalidixic acid, USP)[package insert]. Bridgewater, New Jersey: Sanofi-Aventis U.S. LLC; 2012. [Link]

PMID: 22723698

Nalidixic Acid

By

Nalidixic Acid

Product: Terbutaline (sulfate)

Identifier : DBSNPE002338
Drug : DB00779 (Nalidixic Acid)
Interacting Gene/Enzyme : Glucose-6-phosphate 1-dehydrogenase
Gene Name : G6PD
UniProt ID : P11413
Defining Change(s) :

  • 953_976delCCACCAAAGGGTACCTGGAC GACC

Allele Name : Nara
Genotype(s) : Not Available
Type(s) : ADR Inferred
Groups : G6PD deficiency
Description : Increased risk of hemolytic anemia.
References :

  1. NegGram® Caplets (Nalidixic acid, USP)[package insert]. Bridgewater, New Jersey: Sanofi-Aventis U.S. LLC; 2012. [Link]

PMID: 23100431

Nalidixic Acid

By

Nalidixic Acid

Product: Scopine (hydrochloride)

Identifier : DBSNPE002339
Drug : DB00779 (Nalidixic Acid)
Interacting Gene/Enzyme : Glucose-6-phosphate 1-dehydrogenase
Gene Name : G6PD
UniProt ID : P11413
Defining Change(s) :

  • 962G->A

Allele Name : Manhattan
Genotype(s) : Not Available
Type(s) : ADR Inferred
Groups : G6PD deficiency
Description : Increased risk of hemolytic anemia.
References :

  1. NegGram® Caplets (Nalidixic acid, USP)[package insert]. Bridgewater, New Jersey: Sanofi-Aventis U.S. LLC; 2012. [Link]

PMID: 21383198

Nalidixic Acid

By

Nalidixic Acid

Product: BNC105

Identifier : DBSNPE002340
Drug : DB00779 (Nalidixic Acid)
Interacting Gene/Enzyme : Glucose-6-phosphate 1-dehydrogenase
Gene Name : G6PD
UniProt ID : P11413
Defining Change(s) :

  • 964T->C

Allele Name : Rehevot
Genotype(s) : Not Available
Type(s) : ADR Inferred
Groups : G6PD deficiency
Description : Increased risk of hemolytic anemia.
References :

  1. NegGram® Caplets (Nalidixic acid, USP)[package insert]. Bridgewater, New Jersey: Sanofi-Aventis U.S. LLC; 2012. [Link]

PMID: 22188973

Nalidixic Acid

By

Nalidixic Acid

Product: Sal003

Identifier : DBSNPE002341
Drug : DB00779 (Nalidixic Acid)
Interacting Gene/Enzyme : Glucose-6-phosphate 1-dehydrogenase
Gene Name : G6PD
UniProt ID : P11413
Defining Change(s) :

  • 99A->G
  • 1360C->T

Allele Name : Honiara
Genotype(s) : Not Available
Type(s) : ADR Inferred
Groups : G6PD deficiency
Description : Increased risk of hemolytic anemia.
References :

  1. NegGram® Caplets (Nalidixic acid, USP)[package insert]. Bridgewater, New Jersey: Sanofi-Aventis U.S. LLC; 2012. [Link]

PMID: 19106110

Nalidixic Acid

By

Nalidixic Acid

Product: AZD1981

Identifier : DBSNPE002342
Drug : DB00779 (Nalidixic Acid)
Interacting Gene/Enzyme : Glucose-6-phosphate 1-dehydrogenase
Gene Name : G6PD
UniProt ID : P11413
Defining Change(s) :

  • 1246G->A

Allele Name : Tokyo, Fukushima
Genotype(s) : Not Available
Type(s) : ADR Inferred
Groups : G6PD deficiency
Description : Increased risk of hemolytic anemia.
References :

  1. NegGram® Caplets (Nalidixic acid, USP)[package insert]. Bridgewater, New Jersey: Sanofi-Aventis U.S. LLC; 2012. [Link]

PMID: 9504387

Nalidixic Acid

By

Nalidixic Acid

Product: 5(6)-TAMRA

Identifier : DBSNPE002343
Drug : DB00779 (Nalidixic Acid)
Interacting Gene/Enzyme : Glucose-6-phosphate 1-dehydrogenase
Gene Name : G6PD
UniProt ID : P11413
Defining Change(s) :

  • 1003G->A

Allele Name : Chatham
Genotype(s) : Not Available
Type(s) : ADR Inferred
Groups : G6PD deficiency
Description : Increased risk of hemolytic anemia.
References :

  1. NegGram® Caplets (Nalidixic acid, USP)[package insert]. Bridgewater, New Jersey: Sanofi-Aventis U.S. LLC; 2012. [Link]

PMID: 9729614

Nalidixic Acid

By

Nalidixic Acid

Product: 5(6)-FITC

Identifier : DBSNPE002344
Drug : DB00779 (Nalidixic Acid)
Interacting Gene/Enzyme : Glucose-6-phosphate 1-dehydrogenase
Gene Name : G6PD
UniProt ID : P11413
Defining Change(s) :

  • 1004C->A

Allele Name : Fushan
Genotype(s) : Not Available
Type(s) : ADR Inferred
Groups : G6PD deficiency
Description : Increased risk of hemolytic anemia.
References :

  1. NegGram® Caplets (Nalidixic acid, USP)[package insert]. Bridgewater, New Jersey: Sanofi-Aventis U.S. LLC; 2012. [Link]

PMID: 8887974

Nalidixic Acid

By

Nalidixic Acid

Product: 5(6)-FAM SE

Identifier : DBSNPE002345
Drug : DB00779 (Nalidixic Acid)
Interacting Gene/Enzyme : Glucose-6-phosphate 1-dehydrogenase
Gene Name : G6PD
UniProt ID : P11413
Defining Change(s) :

  • 1052G->T

Allele Name : Partenope
Genotype(s) : Not Available
Type(s) : ADR Inferred
Groups : G6PD deficiency
Description : Increased risk of hemolytic anemia.
References :

  1. NegGram® Caplets (Nalidixic acid, USP)[package insert]. Bridgewater, New Jersey: Sanofi-Aventis U.S. LLC; 2012. [Link]

PMID: 8887975

Nalidixic Acid

By

Nalidixic Acid

Product: GSK2801

Identifier : DBSNPE002346
Drug : DB00779 (Nalidixic Acid)
Interacting Gene/Enzyme : Glucose-6-phosphate 1-dehydrogenase
Gene Name : G6PD
UniProt ID : P11413
Defining Change(s) :

  • 1057C->T

Allele Name : Ierapediva
Genotype(s) : Not Available
Type(s) : ADR Inferred
Groups : G6PD deficiency
Description : Increased risk of hemolytic anemia.
References :

  1. NegGram® Caplets (Nalidixic acid, USP)[package insert]. Bridgewater, New Jersey: Sanofi-Aventis U.S. LLC; 2012. [Link]

PMID: 9918570

Nalidixic Acid

By

Nalidixic Acid

Product: Cevipabulin

Identifier : DBSNPE002347
Drug : DB00779 (Nalidixic Acid)
Interacting Gene/Enzyme : Glucose-6-phosphate 1-dehydrogenase
Gene Name : G6PD
UniProt ID : P11413
Defining Change(s) :

  • 1193A->G

Allele Name : Anadia
Genotype(s) : Not Available
Type(s) : ADR Inferred
Groups : G6PD deficiency
Description : Increased risk of hemolytic anemia.
References :

  1. NegGram® Caplets (Nalidixic acid, USP)[package insert]. Bridgewater, New Jersey: Sanofi-Aventis U.S. LLC; 2012. [Link]

PMID: 1432693

Nalidixic Acid

By

Nalidixic Acid

Product: ML RR-S2 CDA

Identifier : DBSNPE002348
Drug : DB00779 (Nalidixic Acid)
Interacting Gene/Enzyme : Glucose-6-phosphate 1-dehydrogenase
Gene Name : G6PD
UniProt ID : P11413
Defining Change(s) :

  • 1220A->C

Allele Name : Abeno
Genotype(s) : Not Available
Type(s) : ADR Inferred
Groups : G6PD deficiency
Description : Increased risk of hemolytic anemia.
References :

  1. NegGram® Caplets (Nalidixic acid, USP)[package insert]. Bridgewater, New Jersey: Sanofi-Aventis U.S. LLC; 2012. [Link]

PMID: 1658306

Nalidixic Acid

By

Nalidixic Acid

Product: OAC2

Identifier : DBSNPE002349
Drug : DB00779 (Nalidixic Acid)
Interacting Gene/Enzyme : Glucose-6-phosphate 1-dehydrogenase
Gene Name : G6PD
UniProt ID : P11413
Defining Change(s) :

  • 1291G->A

Allele Name : Surabaya
Genotype(s) : Not Available
Type(s) : ADR Inferred
Groups : G6PD deficiency
Description : Increased risk of hemolytic anemia.
References :

  1. NegGram® Caplets (Nalidixic acid, USP)[package insert]. Bridgewater, New Jersey: Sanofi-Aventis U.S. LLC; 2012. [Link]

PMID: 23671067

Nalidixic Acid

By

Nalidixic Acid

Product: PF 05089771

Identifier : DBSNPE002350
Drug : DB00779 (Nalidixic Acid)
Interacting Gene/Enzyme : Glucose-6-phosphate 1-dehydrogenase
Gene Name : G6PD
UniProt ID : P11413
Defining Change(s) :

  • 1316G->C

Allele Name : Pawnee
Genotype(s) : Not Available
Type(s) : ADR Inferred
Groups : G6PD deficiency
Description : Increased risk of hemolytic anemia.
References :

  1. NegGram® Caplets (Nalidixic acid, USP)[package insert]. Bridgewater, New Jersey: Sanofi-Aventis U.S. LLC; 2012. [Link]

PMID: 22579927

Nalidixic Acid

By

Nalidixic Acid

Product: Ifenprodil (tartrate)

Identifier : DBSNPE002351
Drug : DB00779 (Nalidixic Acid)
Interacting Gene/Enzyme : Glucose-6-phosphate 1-dehydrogenase
Gene Name : G6PD
UniProt ID : P11413
Defining Change(s) :

  • 1342A->G

Allele Name : S. Antioco
Genotype(s) : Not Available
Type(s) : ADR Inferred
Groups : G6PD deficiency
Description : Increased risk of hemolytic anemia.
References :

  1. NegGram® Caplets (Nalidixic acid, USP)[package insert]. Bridgewater, New Jersey: Sanofi-Aventis U.S. LLC; 2012. [Link]

PMID: 22553026

Nalidixic Acid

By

Nalidixic Acid

Product: RBC8

Identifier : DBSNPE002352
Drug : DB00779 (Nalidixic Acid)
Interacting Gene/Enzyme : Glucose-6-phosphate 1-dehydrogenase
Gene Name : G6PD
UniProt ID : P11413
Defining Change(s) :

  • 1347G->C

Allele Name : Cassano
Genotype(s) : Not Available
Type(s) : ADR Inferred
Groups : G6PD deficiency
Description : Increased risk of hemolytic anemia.
References :

  1. NegGram® Caplets (Nalidixic acid, USP)[package insert]. Bridgewater, New Jersey: Sanofi-Aventis U.S. LLC; 2012. [Link]

PMID: 22142193

Nalidixic Acid

By

Nalidixic Acid

Product: KH-CB19

Identifier : DBSNPE002353
Drug : DB00779 (Nalidixic Acid)
Interacting Gene/Enzyme : Glucose-6-phosphate 1-dehydrogenase
Gene Name : G6PD
UniProt ID : P11413
Defining Change(s) :

  • 1347G->C
  • 1360C->T

Allele Name : Hermoupolis
Genotype(s) : Not Available
Type(s) : ADR Inferred
Groups : G6PD deficiency
Description : Increased risk of hemolytic anemia.
References :

  1. NegGram® Caplets (Nalidixic acid, USP)[package insert]. Bridgewater, New Jersey: Sanofi-Aventis U.S. LLC; 2012. [Link]

PMID: 20810618

Nalidixic Acid

By

Nalidixic Acid

Product: Sortin1

Identifier : DBSNPE002354
Drug : DB00779 (Nalidixic Acid)
Interacting Gene/Enzyme : Glucose-6-phosphate 1-dehydrogenase
Gene Name : G6PD
UniProt ID : P11413
Defining Change(s) :

  • 1360C->T

Allele Name : Union,Maewo, Chinese-2, Kalo
Genotype(s) : Not Available
Type(s) : ADR Inferred
Groups : G6PD deficiency
Description : Increased risk of hemolytic anemia.
References :

  1. NegGram® Caplets (Nalidixic acid, USP)[package insert]. Bridgewater, New Jersey: Sanofi-Aventis U.S. LLC; 2012. [Link]

PMID: 27857196

Nalidixic Acid

By

Nalidixic Acid

Product: Mcl1-IN-2

Identifier : DBSNPE002355
Drug : DB00779 (Nalidixic Acid)
Interacting Gene/Enzyme : Glucose-6-phosphate 1-dehydrogenase
Gene Name : G6PD
UniProt ID : P11413
Defining Change(s) :

  • 1361G->A

Allele Name : Andalus
Genotype(s) : Not Available
Type(s) : ADR Inferred
Groups : G6PD deficiency
Description : Increased risk of hemolytic anemia.
References :

  1. NegGram® Caplets (Nalidixic acid, USP)[package insert]. Bridgewater, New Jersey: Sanofi-Aventis U.S. LLC; 2012. [Link]

PMID: 25800054

Nalidixic Acid

By

Nalidixic Acid

Product: BHPI

Identifier : DBSNPE002356
Drug : DB00779 (Nalidixic Acid)
Interacting Gene/Enzyme : Glucose-6-phosphate 1-dehydrogenase
Gene Name : G6PD
UniProt ID : P11413
Defining Change(s) :

  • 1376G->C

Allele Name : Cosenza
Genotype(s) : Not Available
Type(s) : ADR Inferred
Groups : G6PD deficiency
Description : Increased risk of hemolytic anemia.
References :

  1. NegGram® Caplets (Nalidixic acid, USP)[package insert]. Bridgewater, New Jersey: Sanofi-Aventis U.S. LLC; 2012. [Link]

PMID: 25413830

Nalidixic Acid

By

Nalidixic Acid

Product: RNPA1000

Identifier : DBSNPE002357
Drug : DB00779 (Nalidixic Acid)
Interacting Gene/Enzyme : Glucose-6-phosphate 1-dehydrogenase
Gene Name : G6PD
UniProt ID : P11413
Defining Change(s) :

  • 1376G->T

Allele Name : Canton, Taiwan- Hakka, Gifu-like, Agrigento-like
Genotype(s) : Not Available
Type(s) : ADR Inferred
Groups : G6PD deficiency
Description : Increased risk of hemolytic anemia.
References :

  1. NegGram® Caplets (Nalidixic acid, USP)[package insert]. Bridgewater, New Jersey: Sanofi-Aventis U.S. LLC; 2012. [Link]

PMID: 22022974

Nalidixic Acid

By

Nalidixic Acid

Product: PDE10-IN-1

Identifier : DBSNPE002358
Drug : DB00779 (Nalidixic Acid)
Interacting Gene/Enzyme : Glucose-6-phosphate 1-dehydrogenase
Gene Name : G6PD
UniProt ID : P11413
Defining Change(s) :

  • 1387C->A

Allele Name : Flores
Genotype(s) : Not Available
Type(s) : ADR Inferred
Groups : G6PD deficiency
Description : Increased risk of hemolytic anemia.
References :

  1. NegGram® Caplets (Nalidixic acid, USP)[package insert]. Bridgewater, New Jersey: Sanofi-Aventis U.S. LLC; 2012. [Link]

PMID: 24739903

Nalidixic Acid

By

Nalidixic Acid

Product: Autotaxin modulator 1

Identifier : DBSNPE002359
Drug : DB00779 (Nalidixic Acid)
Interacting Gene/Enzyme : Glucose-6-phosphate 1-dehydrogenase
Gene Name : G6PD
UniProt ID : P11413
Defining Change(s) :

  • 1388G->A

Allele Name : Kaiping, Anant, Dhon, Sapporo-like, Wosera
Genotype(s) : Not Available
Type(s) : ADR Inferred
Groups : G6PD deficiency
Description : Increased risk of hemolytic anemia.
References :

  1. NegGram® Caplets (Nalidixic acid, USP)[package insert]. Bridgewater, New Jersey: Sanofi-Aventis U.S. LLC; 2012. [Link]

PMID: 15056006

Nalidixic Acid

By

Nalidixic Acid

Product: EHop-016

Identifier : DBSNPE002361
Drug : DB00779 (Nalidixic Acid)
Interacting Gene/Enzyme : Glucose-6-phosphate 1-dehydrogenase
Gene Name : G6PD
UniProt ID : P11413
Defining Change(s) :

  • 179T>C

Allele Name : Costanzo
Genotype(s) : Not Available
Type(s) : ADR Inferred
Groups : G6PD deficiency
Description : Increased risk of hemolytic anemia.
References :

  1. NegGram® Caplets (Nalidixic acid, USP)[package insert]. Bridgewater, New Jersey: Sanofi-Aventis U.S. LLC; 2012. [Link]

PMID: 14642584

Nalidixic Acid

By

Nalidixic Acid

Product: Optovin

Identifier : DBSNPE002362
Drug : DB00779 (Nalidixic Acid)
Interacting Gene/Enzyme : Glucose-6-phosphate 1-dehydrogenase
Gene Name : G6PD
UniProt ID : P11413
Defining Change(s) :

  • 185C->A

Allele Name : Amazonia
Genotype(s) : Not Available
Type(s) : ADR Inferred
Groups : G6PD deficiency
Description : Increased risk of hemolytic anemia.
References :

  1. NegGram® Caplets (Nalidixic acid, USP)[package insert]. Bridgewater, New Jersey: Sanofi-Aventis U.S. LLC; 2012. [Link]

PMID: 10978188

Nalidixic Acid

By

Nalidixic Acid

Product: STF-118804

Identifier : DBSNPE002363
Drug : DB00779 (Nalidixic Acid)
Interacting Gene/Enzyme : Glucose-6-phosphate 1-dehydrogenase
Gene Name : G6PD
UniProt ID : P11413
Defining Change(s) :

  • 196T->A

Allele Name : Songklanagarind
Genotype(s) : Not Available
Type(s) : ADR Inferred
Groups : G6PD deficiency
Description : Increased risk of hemolytic anemia.
References :

  1. NegGram® Caplets (Nalidixic acid, USP)[package insert]. Bridgewater, New Jersey: Sanofi-Aventis U.S. LLC; 2012. [Link]

PMID: 11450037

Nalidixic Acid

By

Nalidixic Acid

Product: FIPI

Identifier : DBSNPE002364
Drug : DB00779 (Nalidixic Acid)
Interacting Gene/Enzyme : Glucose-6-phosphate 1-dehydrogenase
Gene Name : G6PD
UniProt ID : P11413
Defining Change(s) :

  • 202G->A
  • 871G->A

Allele Name : Hechi
Genotype(s) : Not Available
Type(s) : ADR Inferred
Groups : G6PD deficiency
Description : Increased risk of hemolytic anemia.
References :

  1. NegGram® Caplets (Nalidixic acid, USP)[package insert]. Bridgewater, New Jersey: Sanofi-Aventis U.S. LLC; 2012. [Link]

PMID: 9183359

Nalidixic Acid

By

Nalidixic Acid

Product: AZD5582

Identifier : DBSNPE002365
Drug : DB00779 (Nalidixic Acid)
Interacting Gene/Enzyme : Glucose-6-phosphate 1-dehydrogenase
Gene Name : G6PD
UniProt ID : P11413
Defining Change(s) :

  • 208T->C

Allele Name : Namouru
Genotype(s) : Not Available
Type(s) : ADR Inferred
Groups : G6PD deficiency
Description : Increased risk of hemolytic anemia.
References :

  1. NegGram® Caplets (Nalidixic acid, USP)[package insert]. Bridgewater, New Jersey: Sanofi-Aventis U.S. LLC; 2012. [Link]

PMID: 7850154

Nalidixic Acid

By

Nalidixic Acid

Product: URMC-099

Identifier : DBSNPE002366
Drug : DB00779 (Nalidixic Acid)
Interacting Gene/Enzyme : Glucose-6-phosphate 1-dehydrogenase
Gene Name : G6PD
UniProt ID : P11413
Defining Change(s) :

  • 352T>C

Allele Name : Bao Loc
Genotype(s) : Not Available
Type(s) : ADR Inferred
Groups : G6PD deficiency
Description : Increased risk of hemolytic anemia.
References :

  1. NegGram® Caplets (Nalidixic acid, USP)[package insert]. Bridgewater, New Jersey: Sanofi-Aventis U.S. LLC; 2012. [Link]

PMID: 1722365

Nalidixic Acid

By

Nalidixic Acid

Product: OAC1

Identifier : DBSNPE002367
Drug : DB00779 (Nalidixic Acid)
Interacting Gene/Enzyme : Glucose-6-phosphate 1-dehydrogenase
Gene Name : G6PD
UniProt ID : P11413
Defining Change(s) :

  • 375G->T, 379G->T383T->C384C>T

Allele Name : Crispim
Genotype(s) : Not Available
Type(s) : ADR Inferred
Groups : G6PD deficiency
Description : Increased risk of hemolytic anemia.
References :

  1. NegGram® Caplets (Nalidixic acid, USP)[package insert]. Bridgewater, New Jersey: Sanofi-Aventis U.S. LLC; 2012. [Link]

PMID: 9751179

Nalidixic Acid

By

Nalidixic Acid

Product: Ginsenoside Rc

Identifier : DBSNPE002368
Drug : DB00779 (Nalidixic Acid)
Interacting Gene/Enzyme : Glucose-6-phosphate 1-dehydrogenase
Gene Name : G6PD
UniProt ID : P11413
Defining Change(s) :

  • 376A->G
  • 463C->G

Allele Name : Acrokorinthos
Genotype(s) : Not Available
Type(s) : ADR Inferred
Groups : G6PD deficiency
Description : Increased risk of hemolytic anemia.
References :

  1. NegGram® Caplets (Nalidixic acid, USP)[package insert]. Bridgewater, New Jersey: Sanofi-Aventis U.S. LLC; 2012. [Link]

PMID: 20975674

Nalidixic Acid

By

Nalidixic Acid

Product: Ginsenoside Rb3

Identifier : DBSNPE002369
Drug : DB00779 (Nalidixic Acid)
Interacting Gene/Enzyme : Glucose-6-phosphate 1-dehydrogenase
Gene Name : G6PD
UniProt ID : P11413
Defining Change(s) :

  • 376A->G
  • 542A->T

Allele Name : Santa Maria
Genotype(s) : Not Available
Type(s) : ADR Inferred
Groups : G6PD deficiency
Description : Increased risk of hemolytic anemia.
References :

  1. NegGram® Caplets (Nalidixic acid, USP)[package insert]. Bridgewater, New Jersey: Sanofi-Aventis U.S. LLC; 2012. [Link]

PMID: 12065713

Nalidixic Acid

By

Nalidixic Acid

Product: Ginsenoside Rb2

Identifier : DBSNPE002370
Drug : DB00779 (Nalidixic Acid)
Interacting Gene/Enzyme : Glucose-6-phosphate 1-dehydrogenase
Gene Name : G6PD
UniProt ID : P11413
Defining Change(s) :

  • 376A->G
  • 871G->A

Allele Name : Ananindeua
Genotype(s) : Not Available
Type(s) : ADR Inferred
Groups : G6PD deficiency
Description : Increased risk of hemolytic anemia.
References :

  1. NegGram® Caplets (Nalidixic acid, USP)[package insert]. Bridgewater, New Jersey: Sanofi-Aventis U.S. LLC; 2012. [Link]

PMID: 18586315

Nalidixic Acid

By

Nalidixic Acid

Product: Pivmecillinam

Identifier : DBSNPE002371
Drug : DB00779 (Nalidixic Acid)
Interacting Gene/Enzyme : Glucose-6-phosphate 1-dehydrogenase
Gene Name : G6PD
UniProt ID : P11413
Defining Change(s) :

  • 383T->C

Allele Name : Vanua Lava
Genotype(s) : Not Available
Type(s) : ADR Inferred
Groups : G6PD deficiency
Description : Increased risk of hemolytic anemia.
References :

  1. NegGram® Caplets (Nalidixic acid, USP)[package insert]. Bridgewater, New Jersey: Sanofi-Aventis U.S. LLC; 2012. [Link]

PMID: 27096720

Nalidixic Acid

By

Nalidixic Acid

Product: Nucleoside-Analog-2

Identifier : DBSNPE002372
Drug : DB00779 (Nalidixic Acid)
Interacting Gene/Enzyme : Glucose-6-phosphate 1-dehydrogenase
Gene Name : G6PD
UniProt ID : P11413
Defining Change(s) :

  • 406C->T

Allele Name : Valladolid
Genotype(s) : Not Available
Type(s) : ADR Inferred
Groups : G6PD deficiency
Description : Increased risk of hemolytic anemia.
References :

  1. NegGram® Caplets (Nalidixic acid, USP)[package insert]. Bridgewater, New Jersey: Sanofi-Aventis U.S. LLC; 2012. [Link]

PMID: 20735426

Nalidixic Acid

By

Nalidixic Acid

Product: Nucleoside-Analog-1

Identifier : DBSNPE002373
Drug : DB00779 (Nalidixic Acid)
Interacting Gene/Enzyme : Glucose-6-phosphate 1-dehydrogenase
Gene Name : G6PD
UniProt ID : P11413
Defining Change(s) :

  • 409C->T

Allele Name : Belem
Genotype(s) : Not Available
Type(s) : ADR Inferred
Groups : G6PD deficiency
Description : Increased risk of hemolytic anemia.
References :

  1. NegGram® Caplets (Nalidixic acid, USP)[package insert]. Bridgewater, New Jersey: Sanofi-Aventis U.S. LLC; 2012. [Link]

PMID: 17636008

Nalidixic Acid

By

Nalidixic Acid

Product: PFI-2 (hydrochloride)

Identifier : DBSNPE002374
Drug : DB00779 (Nalidixic Acid)
Interacting Gene/Enzyme : Glucose-6-phosphate 1-dehydrogenase
Gene Name : G6PD
UniProt ID : P11413
Defining Change(s) :

  • 442G->A

Allele Name : Liuzhou
Genotype(s) : Not Available
Type(s) : ADR Inferred
Groups : G6PD deficiency
Description : Increased risk of hemolytic anemia.
References :

  1. NegGram® Caplets (Nalidixic acid, USP)[package insert]. Bridgewater, New Jersey: Sanofi-Aventis U.S. LLC; 2012. [Link]

PMID: 10781100

Nalidixic Acid

By

Nalidixic Acid

Product: PFI-2

Identifier : DBSNPE002375
Drug : DB00779 (Nalidixic Acid)
Interacting Gene/Enzyme : Glucose-6-phosphate 1-dehydrogenase
Gene Name : G6PD
UniProt ID : P11413
Defining Change(s) :

  • 473G>A

Allele Name : Shenzen
Genotype(s) : Not Available
Type(s) : ADR Inferred
Groups : G6PD deficiency
Description : Increased risk of hemolytic anemia.
References :

  1. NegGram® Caplets (Nalidixic acid, USP)[package insert]. Bridgewater, New Jersey: Sanofi-Aventis U.S. LLC; 2012. [Link]

PMID: 9030620

Nalidixic Acid

By

Nalidixic Acid

Product: APY0201

Identifier : DBSNPE002376
Drug : DB00779 (Nalidixic Acid)
Interacting Gene/Enzyme : Glucose-6-phosphate 1-dehydrogenase
Gene Name : G6PD
UniProt ID : P11413
Defining Change(s) :

  • 493A->G

Allele Name : Taipei “Chinese- 3”
Genotype(s) : Not Available
Type(s) : ADR Inferred
Groups : G6PD deficiency
Description : Increased risk of hemolytic anemia.
References :

  1. NegGram® Caplets (Nalidixic acid, USP)[package insert]. Bridgewater, New Jersey: Sanofi-Aventis U.S. LLC; 2012. [Link]

PMID: 19118183

Nalidixic Acid

By

Nalidixic Acid

Product: GSK503

Identifier : DBSNPE002377
Drug : DB00779 (Nalidixic Acid)
Interacting Gene/Enzyme : Glucose-6-phosphate 1-dehydrogenase
Gene Name : G6PD
UniProt ID : P11413
Defining Change(s) :

  • 496C>T

Allele Name : Toledo
Genotype(s) : Not Available
Type(s) : ADR Inferred
Groups : G6PD deficiency
Description : Increased risk of hemolytic anemia.
References :

  1. NegGram® Caplets (Nalidixic acid, USP)[package insert]. Bridgewater, New Jersey: Sanofi-Aventis U.S. LLC; 2012. [Link]

PMID: 8789355

Nalidixic Acid

By

Nalidixic Acid

Product: SAG

Identifier : DBSNPE002378
Drug : DB00779 (Nalidixic Acid)
Interacting Gene/Enzyme : Glucose-6-phosphate 1-dehydrogenase
Gene Name : G6PD
UniProt ID : P11413
Defining Change(s) :

  • 497G->A

Allele Name : Naone
Genotype(s) : Not Available
Type(s) : ADR Inferred
Groups : G6PD deficiency
Description : Increased risk of hemolytic anemia.
References :

  1. NegGram® Caplets (Nalidixic acid, USP)[package insert]. Bridgewater, New Jersey: Sanofi-Aventis U.S. LLC; 2012. [Link]

PMID: 8229795

Nalidixic Acid

By

Nalidixic Acid

Product: Imatinib metabolite N-Desmethyl Imatinib

Identifier : DBSNPE002379
Drug : DB00779 (Nalidixic Acid)
Interacting Gene/Enzyme : Glucose-6-phosphate 1-dehydrogenase
Gene Name : G6PD
UniProt ID : P11413
Defining Change(s) :

  • 517T->C

Allele Name : Nankang
Genotype(s) : Not Available
Type(s) : ADR Inferred
Groups : G6PD deficiency
Description : Increased risk of hemolytic anemia.
References :

  1. NegGram® Caplets (Nalidixic acid, USP)[package insert]. Bridgewater, New Jersey: Sanofi-Aventis U.S. LLC; 2012. [Link]

PMID: 25164663

Nalidixic Acid

By

Nalidixic Acid

Product: Omeprazole metabolite Omeprazole sulfone

Identifier : DBSNPE002380
Drug : DB00779 (Nalidixic Acid)
Interacting Gene/Enzyme : Glucose-6-phosphate 1-dehydrogenase
Gene Name : G6PD
UniProt ID : P11413
Defining Change(s) :

  • 519C->G

Allele Name : Miaoli
Genotype(s) : Not Available
Type(s) : ADR Inferred
Groups : G6PD deficiency
Description : Increased risk of hemolytic anemia.
References :

  1. NegGram® Caplets (Nalidixic acid, USP)[package insert]. Bridgewater, New Jersey: Sanofi-Aventis U.S. LLC; 2012. [Link]

PMID: 21983683

Nalidixic Acid

By

Nalidixic Acid

Product: Omeprazole metabolite Omeprazole sulfide

Identifier : DBSNPE002381
Drug : DB00779 (Nalidixic Acid)
Interacting Gene/Enzyme : Glucose-6-phosphate 1-dehydrogenase
Gene Name : G6PD
UniProt ID : P11413
Defining Change(s) :

  • 563C->T

Allele Name : Mediterranean, Dallas, Panama‚ Sassari, Cagliari, Birmingham
Genotype(s) : Not Available
Type(s) : ADR Inferred
Groups : G6PD deficiency
Description : Increased risk of hemolytic anemia.
References :

  1. NegGram® Caplets (Nalidixic acid, USP)[package insert]. Bridgewater, New Jersey: Sanofi-Aventis U.S. LLC; 2012. [Link]

PMID: 1655472

Nalidixic Acid

By

Nalidixic Acid

Product: Naltrexone metabolite 6β-Naltrexol (hydrochloride)

Identifier : DBSNPE002382
Drug : DB00779 (Nalidixic Acid)
Interacting Gene/Enzyme : Glucose-6-phosphate 1-dehydrogenase
Gene Name : G6PD
UniProt ID : P11413
Defining Change(s) :

  • 592C->T

Allele Name : Coimbra Shunde
Genotype(s) : Not Available
Type(s) : ADR Inferred
Groups : G6PD deficiency
Description : Increased risk of hemolytic anemia.
References :

  1. NegGram® Caplets (Nalidixic acid, USP)[package insert]. Bridgewater, New Jersey: Sanofi-Aventis U.S. LLC; 2012. [Link]

PMID: 7623768

Nalidixic Acid

By

Nalidixic Acid

Product: Norgestimate metabolite Norelgestromin

Identifier : DBSNPE002383
Drug : DB00779 (Nalidixic Acid)
Interacting Gene/Enzyme : Glucose-6-phosphate 1-dehydrogenase
Gene Name : G6PD
UniProt ID : P11413
Defining Change(s) :

  • 593G>A

Allele Name : Nilgiri
Genotype(s) : Not Available
Type(s) : ADR Inferred
Groups : G6PD deficiency
Description : Increased risk of hemolytic anemia.
References :

  1. NegGram® Caplets (Nalidixic acid, USP)[package insert]. Bridgewater, New Jersey: Sanofi-Aventis U.S. LLC; 2012. [Link]

PMID: 7966155

Nalidixic Acid

By

Nalidixic Acid

Product: Duloxetine metabolite Para-Naphthol Duloxetine

Identifier : DBSNPE002384
Drug : DB00779 (Nalidixic Acid)
Interacting Gene/Enzyme : Glucose-6-phosphate 1-dehydrogenase
Gene Name : G6PD
UniProt ID : P11413
Defining Change(s) :

  • 679C->T

Allele Name : Radlowo
Genotype(s) : Not Available
Type(s) : ADR Inferred
Groups : G6PD deficiency
Description : Increased risk of hemolytic anemia.
References :

  1. NegGram® Caplets (Nalidixic acid, USP)[package insert]. Bridgewater, New Jersey: Sanofi-Aventis U.S. LLC; 2012. [Link]

PMID: 2551452

Nalidixic Acid

By

Nalidixic Acid

Product: Acetaminophen metabolite 3-hydroxy-acetaminophen

Identifier : DBSNPE002385
Drug : DB00779 (Nalidixic Acid)
Interacting Gene/Enzyme : Glucose-6-phosphate 1-dehydrogenase
Gene Name : G6PD
UniProt ID : P11413
Defining Change(s) :

  • 811G>C

Allele Name : Roubaix
Genotype(s) : Not Available
Type(s) : ADR Inferred
Groups : G6PD deficiency
Description : Increased risk of hemolytic anemia.
References :

  1. NegGram® Caplets (Nalidixic acid, USP)[package insert]. Bridgewater, New Jersey: Sanofi-Aventis U.S. LLC; 2012. [Link]

PMID: 2564797

Nalidixic Acid

By

Nalidixic Acid

Product: Iloperidone metabolite Hydroxy Iloperidone

Identifier : DBSNPE002386
Drug : DB00779 (Nalidixic Acid)
Interacting Gene/Enzyme : Glucose-6-phosphate 1-dehydrogenase
Gene Name : G6PD
UniProt ID : P11413
Defining Change(s) :

  • 835A->G

Allele Name : Haikou
Genotype(s) : Not Available
Type(s) : ADR Inferred
Groups : G6PD deficiency
Description : Increased risk of hemolytic anemia.
References :

  1. NegGram® Caplets (Nalidixic acid, USP)[package insert]. Bridgewater, New Jersey: Sanofi-Aventis U.S. LLC; 2012. [Link]

PMID: 2827066

Nalidixic Acid

By

Nalidixic Acid

Product: N-acetyl Dapsone D4

Identifier : DBSNPE002387
Drug : DB00779 (Nalidixic Acid)
Interacting Gene/Enzyme : Glucose-6-phosphate 1-dehydrogenase
Gene Name : G6PD
UniProt ID : P11413
Defining Change(s) :

  • 835A->T

Allele Name : Chinese-1
Genotype(s) : Not Available
Type(s) : ADR Inferred
Groups : G6PD deficiency
Description : Increased risk of hemolytic anemia.
References :

  1. NegGram® Caplets (Nalidixic acid, USP)[package insert]. Bridgewater, New Jersey: Sanofi-Aventis U.S. LLC; 2012. [Link]

PMID: 4066844

Nalidixic Acid

By

Nalidixic Acid

Product: Quetiapine metabolite Quetiapine sulfoxide

Identifier : DBSNPE002388
Drug : DB00779 (Nalidixic Acid)
Interacting Gene/Enzyme : Glucose-6-phosphate 1-dehydrogenase
Gene Name : G6PD
UniProt ID : P11413
Defining Change(s) :

  • 848A>G

Allele Name : Mizushima
Genotype(s) : Not Available
Type(s) : ADR Inferred
Groups : G6PD deficiency
Description : Increased risk of hemolytic anemia.
References :

  1. NegGram® Caplets (Nalidixic acid, USP)[package insert]. Bridgewater, New Jersey: Sanofi-Aventis U.S. LLC; 2012. [Link]

PMID: 17705146

Nalidixic Acid

By

Nalidixic Acid

Product: Monohydroxy Netupitant D6

Identifier : DBSNPE002389
Drug : DB00779 (Nalidixic Acid)
Interacting Gene/Enzyme : Glucose-6-phosphate 1-dehydrogenase
Gene Name : G6PD
UniProt ID : P11413
Defining Change(s) :

  • 853C->T

Allele Name : Osaka
Genotype(s) : Not Available
Type(s) : ADR Inferred
Groups : G6PD deficiency
Description : Increased risk of hemolytic anemia.
References :

  1. NegGram® Caplets (Nalidixic acid, USP)[package insert]. Bridgewater, New Jersey: Sanofi-Aventis U.S. LLC; 2012. [Link]

PMID: 12596867

Nalidixic Acid

By

Nalidixic Acid

Product: Netupitant metabolite Monohydroxy Netupitant

Identifier : DBSNPE002390
Drug : DB00779 (Nalidixic Acid)
Interacting Gene/Enzyme : Glucose-6-phosphate 1-dehydrogenase
Gene Name : G6PD
UniProt ID : P11413
Defining Change(s) :

  • 871G->A

Allele Name : Viangchan, Jammu
Genotype(s) : Not Available
Type(s) : ADR Inferred
Groups : G6PD deficiency
Description : Increased risk of hemolytic anemia.
References :

  1. NegGram® Caplets (Nalidixic acid, USP)[package insert]. Bridgewater, New Jersey: Sanofi-Aventis U.S. LLC; 2012. [Link]

PMID: 25548170

Nalidixic Acid

By

Nalidixic Acid

Product: Netupitant N-oxide D6

Identifier : DBSNPE002391
Drug : DB00779 (Nalidixic Acid)
Interacting Gene/Enzyme : Glucose-6-phosphate 1-dehydrogenase
Gene Name : G6PD
UniProt ID : P11413
Defining Change(s) :

  • 916G->A

Allele Name : Seoul
Genotype(s) : Not Available
Type(s) : ADR Inferred
Groups : G6PD deficiency
Description : Increased risk of hemolytic anemia.
References :

  1. NegGram® Caplets (Nalidixic acid, USP)[package insert]. Bridgewater, New Jersey: Sanofi-Aventis U.S. LLC; 2012. [Link]

PMID: 20832746

Nalidixic Acid

By

Nalidixic Acid

Product: Netupitant metabolite Netupitant N-oxide

Identifier : DBSNPE002392
Drug : DB00779 (Nalidixic Acid)
Interacting Gene/Enzyme : Glucose-6-phosphate 1-dehydrogenase
Gene Name : G6PD
UniProt ID : P11413
Defining Change(s) :

  • 929G->A

Allele Name : Ludhiana
Genotype(s) : Not Available
Type(s) : ADR Inferred
Groups : G6PD deficiency
Description : Increased risk of hemolytic anemia.
References :

  1. NegGram® Caplets (Nalidixic acid, USP)[package insert]. Bridgewater, New Jersey: Sanofi-Aventis U.S. LLC; 2012. [Link]

PMID: 20832749

Nalidixic Acid

By

Nalidixic Acid

Product: N-desmethyl Netupitant D6

Identifier : DBSNPE002393
Drug : DB00779 (Nalidixic Acid)
Interacting Gene/Enzyme : Glucose-6-phosphate 1-dehydrogenase
Gene Name : G6PD
UniProt ID : P11413
Defining Change(s) :

  • 977C->A

Allele Name : Farroupilha
Genotype(s) : Not Available
Type(s) : ADR Inferred
Groups : G6PD deficiency
Description : Increased risk of hemolytic anemia.
References :

  1. NegGram® Caplets (Nalidixic acid, USP)[package insert]. Bridgewater, New Jersey: Sanofi-Aventis U.S. LLC; 2012. [Link]

PMID: 22225880

Nalidixic Acid

By

Nalidixic Acid

Product: Netupitant metabolite N-desmethyl Netupitant

Identifier : DBSNPE002394
Drug : DB00779 (Nalidixic Acid)
Interacting Gene/Enzyme : Glucose-6-phosphate 1-dehydrogenase
Gene Name : G6PD
UniProt ID : P11413
Defining Change(s) :

  • 1024C->T

Allele Name : Chinese-5
Genotype(s) : Not Available
Type(s) : ADR Inferred
Groups : G6PD deficiency
Description : Increased risk of hemolytic anemia.
References :

  1. NegGram® Caplets (Nalidixic acid, USP)[package insert]. Bridgewater, New Jersey: Sanofi-Aventis U.S. LLC; 2012. [Link]

PMID: 23151085

Nalidixic Acid

By

Nalidixic Acid

Product: Ritonavir metabolite Desthiazolylmethyloxycarbonyl Ritonavir

Identifier : DBSNPE002395
Drug : DB00779 (Nalidixic Acid)
Interacting Gene/Enzyme : Glucose-6-phosphate 1-dehydrogenase
Gene Name : G6PD
UniProt ID : P11413
Defining Change(s) :

  • 130G>A

Allele Name : Rignano
Genotype(s) : Not Available
Type(s) : ADR Inferred
Groups : G6PD deficiency
Description : Increased risk of hemolytic anemia.
References :

  1. NegGram® Caplets (Nalidixic acid, USP)[package insert]. Bridgewater, New Jersey: Sanofi-Aventis U.S. LLC; 2012. [Link]

PMID: 22049910

Nalidixic Acid

By

Nalidixic Acid

Product: Mebeverine metabolite O-desmethyl Mebeverine alcohol

Identifier : DBSNPE002396
Drug : DB00779 (Nalidixic Acid)
Interacting Gene/Enzyme : Glucose-6-phosphate 1-dehydrogenase
Gene Name : G6PD
UniProt ID : P11413
Defining Change(s) :

  • 131C->G

Allele Name : Orissa
Genotype(s) : Not Available
Type(s) : ADR Inferred
Groups : G6PD deficiency
Description : Increased risk of hemolytic anemia.
References :

  1. NegGram® Caplets (Nalidixic acid, USP)[package insert]. Bridgewater, New Jersey: Sanofi-Aventis U.S. LLC; 2012. [Link]

PMID: 10213162

Nalidixic Acid

By

Nalidixic Acid

Product: Lurasidone Metabolite 14326 D8

Identifier : DBSNPE002397
Drug : DB00779 (Nalidixic Acid)
Interacting Gene/Enzyme : Glucose-6-phosphate 1-dehydrogenase
Gene Name : G6PD
UniProt ID : P11413
Defining Change(s) :

  • 1380G>C

Allele Name : G6PDNice
Genotype(s) : Not Available
Type(s) : ADR Inferred
Groups : G6PD deficiency
Description : Increased risk of hemolytic anemia.
References :

  1. NegGram® Caplets (Nalidixic acid, USP)[package insert]. Bridgewater, New Jersey: Sanofi-Aventis U.S. LLC; 2012. [Link]

PMID: 10484070

Nalidixic Acid

By

Nalidixic Acid

Product: Lurasidone metabolite 14326

Identifier : DBSNPE002398
Drug : DB00779 (Nalidixic Acid)
Interacting Gene/Enzyme : Glucose-6-phosphate 1-dehydrogenase
Gene Name : G6PD
UniProt ID : P11413
Defining Change(s) :

  • 1387C->T

Allele Name : Kamiube, Keelung
Genotype(s) : Not Available
Type(s) : ADR Inferred
Groups : G6PD deficiency
Description : Increased risk of hemolytic anemia.
References :

  1. NegGram® Caplets (Nalidixic acid, USP)[package insert]. Bridgewater, New Jersey: Sanofi-Aventis U.S. LLC; 2012. [Link]

PMID: 8632336

Nalidixic Acid

By

Nalidixic Acid

Product: Lurasidone Metabolite 14283 D8

Identifier : DBSNPE002399
Drug : DB00779 (Nalidixic Acid)
Interacting Gene/Enzyme : Glucose-6-phosphate 1-dehydrogenase
Gene Name : G6PD
UniProt ID : P11413
Defining Change(s) :

  • 1400C->G

Allele Name : Neapolis
Genotype(s) : Not Available
Type(s) : ADR Inferred
Groups : G6PD deficiency
Description : Increased risk of hemolytic anemia.
References :

  1. NegGram® Caplets (Nalidixic acid, USP)[package insert]. Bridgewater, New Jersey: Sanofi-Aventis U.S. LLC; 2012. [Link]

PMID: 7214140

Nalidixic Acid

By

Nalidixic Acid

Product: Oxaprozin D4

Identifier : DBSNPE002400
Drug : DB00779 (Nalidixic Acid)
Interacting Gene/Enzyme : Glucose-6-phosphate 1-dehydrogenase
Gene Name : G6PD
UniProt ID : P11413
Defining Change(s) :

  • 143T->C

Allele Name : Aures
Genotype(s) : Not Available
Type(s) : ADR Inferred
Groups : G6PD deficiency
Description : Increased risk of hemolytic anemia.
References :

  1. NegGram® Caplets (Nalidixic acid, USP)[package insert]. Bridgewater, New Jersey: Sanofi-Aventis U.S. LLC; 2012. [Link]

PMID: 11723250

Nalidixic Acid

By

Nalidixic Acid

Product: Prochlorperazine D8

Identifier : DBSNPE002401
Drug : DB00779 (Nalidixic Acid)
Interacting Gene/Enzyme : Glucose-6-phosphate 1-dehydrogenase
Gene Name : G6PD
UniProt ID : P11413
Defining Change(s) :

  • 1442C->G

Allele Name : Split
Genotype(s) : Not Available
Type(s) : ADR Inferred
Groups : G6PD deficiency
Description : Increased risk of hemolytic anemia.
References :

  1. NegGram® Caplets (Nalidixic acid, USP)[package insert]. Bridgewater, New Jersey: Sanofi-Aventis U.S. LLC; 2012. [Link]

PMID: 27874011

Nalidixic Acid

By

Nalidixic Acid

Product: Proguanil D6

Identifier : DBSNPE002402
Drug : DB00779 (Nalidixic Acid)
Interacting Gene/Enzyme : Glucose-6-phosphate 1-dehydrogenase
Gene Name : G6PD
UniProt ID : P11413
Defining Change(s) :

  • 148C->T

Allele Name : Kambos
Genotype(s) : Not Available
Type(s) : ADR Inferred
Groups : G6PD deficiency
Description : Increased risk of hemolytic anemia.
References :

  1. NegGram® Caplets (Nalidixic acid, USP)[package insert]. Bridgewater, New Jersey: Sanofi-Aventis U.S. LLC; 2012. [Link]

PMID: 22542656

Nalidixic Acid

By

Nalidixic Acid

Product: Oxycodone D3

Identifier : DBSNPE002403
Drug : DB00779 (Nalidixic Acid)
Interacting Gene/Enzyme : Glucose-6-phosphate 1-dehydrogenase
Gene Name : G6PD
UniProt ID : P11413
Defining Change(s) :

  • 170G>A

Allele Name : Palesdivina
Genotype(s) : Not Available
Type(s) : ADR Inferred
Groups : G6PD deficiency
Description : Increased risk of hemolytic anemia.
References :

  1. NegGram® Caplets (Nalidixic acid, USP)[package insert]. Bridgewater, New Jersey: Sanofi-Aventis U.S. LLC; 2012. [Link]

PMID: 18602930

Nalidixic Acid

By

Nalidixic Acid

Product: Nadolol D9

Identifier : DBSNPE002404
Drug : DB00779 (Nalidixic Acid)
Interacting Gene/Enzyme : Glucose-6-phosphate 1-dehydrogenase
Gene Name : G6PD
UniProt ID : P11413
Defining Change(s) :

  • 172G->A

Allele Name : Metaponto
Genotype(s) : Not Available
Type(s) : ADR Inferred
Groups : G6PD deficiency
Description : Increased risk of hemolytic anemia.
References :

  1. NegGram® Caplets (Nalidixic acid, USP)[package insert]. Bridgewater, New Jersey: Sanofi-Aventis U.S. LLC; 2012. [Link]

PMID: 12941372

Nalidixic Acid

By

Nalidixic Acid

Product: Tetrabenazine D6

Identifier : DBSNPE002405
Drug : DB00779 (Nalidixic Acid)
Interacting Gene/Enzyme : Glucose-6-phosphate 1-dehydrogenase
Gene Name : G6PD
UniProt ID : P11413
Defining Change(s) :

  • 185C->T

Allele Name : Musashino
Genotype(s) : Not Available
Type(s) : ADR Inferred
Groups : G6PD deficiency
Description : Increased risk of hemolytic anemia.
References :

  1. NegGram® Caplets (Nalidixic acid, USP)[package insert]. Bridgewater, New Jersey: Sanofi-Aventis U.S. LLC; 2012. [Link]

PMID: 23194655

Nalidixic Acid

By

Nalidixic Acid

Product: Clomipramine D3

Identifier : DBSNPE002406
Drug : DB00779 (Nalidixic Acid)
Interacting Gene/Enzyme : Glucose-6-phosphate 1-dehydrogenase
Gene Name : G6PD
UniProt ID : P11413
Defining Change(s) :

  • 202G->A

Allele Name : Asahi
Genotype(s) : Not Available
Type(s) : ADR Inferred
Groups : G6PD deficiency
Description : Increased risk of hemolytic anemia.
References :

  1. NegGram® Caplets (Nalidixic acid, USP)[package insert]. Bridgewater, New Jersey: Sanofi-Aventis U.S. LLC; 2012. [Link]

PMID: 11454468

Nalidixic Acid

By

Nalidixic Acid

Product: Propafenone (D7 hydrochloride)

Identifier : DBSNPE002407
Drug : DB00779 (Nalidixic Acid)
Interacting Gene/Enzyme : Glucose-6-phosphate 1-dehydrogenase
Gene Name : G6PD
UniProt ID : P11413
Defining Change(s) :

  • 202G->A
  • 376A->G

Allele Name : A- (202), Ferrara I
Genotype(s) : Not Available
Type(s) : ADR Inferred
Groups : G6PD deficiency
Description : Increased risk of hemolytic anemia.
References :

  1. NegGram® Caplets (Nalidixic acid, USP)[package insert]. Bridgewater, New Jersey: Sanofi-Aventis U.S. LLC; 2012. [Link]

PMID: 18632945

Nalidixic Acid

By

Nalidixic Acid

Product: Chlorpromazine (D6 hydrochloride)

Identifier : DBSNPE002408
Drug : DB00779 (Nalidixic Acid)
Interacting Gene/Enzyme : Glucose-6-phosphate 1-dehydrogenase
Gene Name : G6PD
UniProt ID : P11413
Defining Change(s) :

  • 209A->G

Allele Name : Murcia Oristano
Genotype(s) : Not Available
Type(s) : ADR Inferred
Groups : G6PD deficiency
Description : Increased risk of hemolytic anemia.
References :

  1. NegGram® Caplets (Nalidixic acid, USP)[package insert]. Bridgewater, New Jersey: Sanofi-Aventis U.S. LLC; 2012. [Link]

PMID: 15235081

Nalidixic Acid

By

Nalidixic Acid

Product: Praziquantel D11

Identifier : DBSNPE002409
Drug : DB00779 (Nalidixic Acid)
Interacting Gene/Enzyme : Glucose-6-phosphate 1-dehydrogenase
Gene Name : G6PD
UniProt ID : P11413
Defining Change(s) :

  • 241C->T

Allele Name : Ube Konan
Genotype(s) : Not Available
Type(s) : ADR Inferred
Groups : G6PD deficiency
Description : Increased risk of hemolytic anemia.
References :

  1. NegGram® Caplets (Nalidixic acid, USP)[package insert]. Bridgewater, New Jersey: Sanofi-Aventis U.S. LLC; 2012. [Link]

PMID: 18448867

Nalidixic Acid

By

Nalidixic Acid

Product: Enalaprilat D5 (Sodium Salt)

Identifier : DBSNPE002410
Drug : DB00779 (Nalidixic Acid)
Interacting Gene/Enzyme : Glucose-6-phosphate 1-dehydrogenase
Gene Name : G6PD
UniProt ID : P11413
Defining Change(s) :

  • 242G->A

Allele Name : Lagosanto
Genotype(s) : Not Available
Type(s) : ADR Inferred
Groups : G6PD deficiency
Description : Increased risk of hemolytic anemia.
References :

  1. NegGram® Caplets (Nalidixic acid, USP)[package insert]. Bridgewater, New Jersey: Sanofi-Aventis U.S. LLC; 2012. [Link]

PMID: 11495577

Nalidixic Acid

By

Nalidixic Acid

Product: Nitazoxanide D4

Identifier : DBSNPE002411
Drug : DB00779 (Nalidixic Acid)
Interacting Gene/Enzyme : Glucose-6-phosphate 1-dehydrogenase
Gene Name : G6PD
UniProt ID : P11413
Defining Change(s) :

  • 274C->T

Allele Name : Guangzhou
Genotype(s) : Not Available
Type(s) : ADR Inferred
Groups : G6PD deficiency
Description : Increased risk of hemolytic anemia.
References :

  1. NegGram® Caplets (Nalidixic acid, USP)[package insert]. Bridgewater, New Jersey: Sanofi-Aventis U.S. LLC; 2012. [Link]

PMID: 21936588

Nalidixic Acid

By

Nalidixic Acid

Product: Pyridostigmine (D6 bromide)

Identifier : DBSNPE002412
Drug : DB00779 (Nalidixic Acid)
Interacting Gene/Enzyme : Glucose-6-phosphate 1-dehydrogenase
Gene Name : G6PD
UniProt ID : P11413
Defining Change(s) :

  • 323T->A

Allele Name : Hammersmith
Genotype(s) : Not Available
Type(s) : ADR Inferred
Groups : G6PD deficiency
Description : Increased risk of hemolytic anemia.
References :

  1. NegGram® Caplets (Nalidixic acid, USP)[package insert]. Bridgewater, New Jersey: Sanofi-Aventis U.S. LLC; 2012. [Link]

PMID: 15023571

Nalidixic Acid

By

Nalidixic Acid

Product: Candesartan D4

Identifier : DBSNPE002413
Drug : DB00779 (Nalidixic Acid)
Interacting Gene/Enzyme : Glucose-6-phosphate 1-dehydrogenase
Gene Name : G6PD
UniProt ID : P11413
Defining Change(s) :

  • 34G->T

Allele Name : Sinnai
Genotype(s) : Not Available
Type(s) : ADR Inferred
Groups : G6PD deficiency
Description : Increased risk of hemolytic anemia.
References :

  1. NegGram® Caplets (Nalidixic acid, USP)[package insert]. Bridgewater, New Jersey: Sanofi-Aventis U.S. LLC; 2012. [Link]

PMID: 22341128

Nalidixic Acid

By

Nalidixic Acid

Product: Naratriptan (D3 Hydrochloride)

Identifier : DBSNPE002414
Drug : DB00779 (Nalidixic Acid)
Interacting Gene/Enzyme : Glucose-6-phosphate 1-dehydrogenase
Gene Name : G6PD
UniProt ID : P11413
Defining Change(s) :

  • 376A->G
  • 680G->T

Allele Name : A- (680)
Genotype(s) : Not Available
Type(s) : ADR Inferred
Groups : G6PD deficiency
Description : Increased risk of hemolytic anemia.
References :

  1. NegGram® Caplets (Nalidixic acid, USP)[package insert]. Bridgewater, New Jersey: Sanofi-Aventis U.S. LLC; 2012. [Link]

PMID: 17251391

Nalidixic Acid

By

Nalidixic Acid

Product: Ivabradine (D3 Hydrochloride)

Identifier : DBSNPE002415
Drug : DB00779 (Nalidixic Acid)
Interacting Gene/Enzyme : Glucose-6-phosphate 1-dehydrogenase
Gene Name : G6PD
UniProt ID : P11413
Defining Change(s) :

  • 376A->G
  • 968T->C

Allele Name : A- (968), Betica,Selma, Guantanamo
Genotype(s) : Not Available
Type(s) : ADR Inferred
Groups : G6PD deficiency
Description : Increased risk of hemolytic anemia.
References :

  1. NegGram® Caplets (Nalidixic acid, USP)[package insert]. Bridgewater, New Jersey: Sanofi-Aventis U.S. LLC; 2012. [Link]

PMID: 17016495

Nalidixic Acid

By

Nalidixic Acid

Product: Ivabradine (D6 hydrochloride)

Identifier : DBSNPE002416
Drug : DB00779 (Nalidixic Acid)
Interacting Gene/Enzyme : Glucose-6-phosphate 1-dehydrogenase
Gene Name : G6PD
UniProt ID : P11413
Defining Change(s) :

  • 383T>G

Allele Name : Salerno Pyrgos
Genotype(s) : Not Available
Type(s) : ADR Inferred
Groups : G6PD deficiency
Description : Increased risk of hemolytic anemia.
References :

  1. NegGram® Caplets (Nalidixic acid, USP)[package insert]. Bridgewater, New Jersey: Sanofi-Aventis U.S. LLC; 2012. [Link]

PMID: 16046314

Nalidixic Acid

By

Nalidixic Acid

Product: Lurasidone (D8 Hydrochloride)

Identifier : DBSNPE002417
Drug : DB00779 (Nalidixic Acid)
Interacting Gene/Enzyme : Glucose-6-phosphate 1-dehydrogenase
Gene Name : G6PD
UniProt ID : P11413
Defining Change(s) :

  • 392G->T

Allele Name : Quing Yan
Genotype(s) : Not Available
Type(s) : ADR Inferred
Groups : G6PD deficiency
Description : Increased risk of hemolytic anemia.
References :

  1. NegGram® Caplets (Nalidixic acid, USP)[package insert]. Bridgewater, New Jersey: Sanofi-Aventis U.S. LLC; 2012. [Link]

PMID: 17934512

Nalidixic Acid

By

Nalidixic Acid

Product: Mebeverine (D6 Hydrochloride)

Identifier : DBSNPE002418
Drug : DB00779 (Nalidixic Acid)
Interacting Gene/Enzyme : Glucose-6-phosphate 1-dehydrogenase
Gene Name : G6PD
UniProt ID : P11413
Defining Change(s) :

  • 40G->A

Allele Name : Lages
Genotype(s) : Not Available
Type(s) : ADR Inferred
Groups : G6PD deficiency
Description : Increased risk of hemolytic anemia.
References :

  1. NegGram® Caplets (Nalidixic acid, USP)[package insert]. Bridgewater, New Jersey: Sanofi-Aventis U.S. LLC; 2012. [Link]

PMID: 20030405

Nalidixic Acid

By

Nalidixic Acid

Product: Perphenazine (D8 Dihydrochloride)

Identifier : DBSNPE002419
Drug : DB00779 (Nalidixic Acid)
Interacting Gene/Enzyme : Glucose-6-phosphate 1-dehydrogenase
Gene Name : G6PD
UniProt ID : P11413
Defining Change(s) :

  • 466G->A

Allele Name : Ilesha
Genotype(s) : Not Available
Type(s) : ADR Inferred
Groups : G6PD deficiency
Description : Increased risk of hemolytic anemia.
References :

  1. NegGram® Caplets (Nalidixic acid, USP)[package insert]. Bridgewater, New Jersey: Sanofi-Aventis U.S. LLC; 2012. [Link]

PMID: 19823752

Nalidixic Acid

By

Nalidixic Acid

Product: Rotigotine (D7 Hydrochloride)

Identifier : DBSNPE002421
Drug : DB00779 (Nalidixic Acid)
Interacting Gene/Enzyme : Glucose-6-phosphate 1-dehydrogenase
Gene Name : G6PD
UniProt ID : P11413
Defining Change(s) :

  • 542A->T

Allele Name : Malaga
Genotype(s) : Not Available
Type(s) : ADR Inferred
Groups : G6PD deficiency
Description : Increased risk of hemolytic anemia.
References :

  1. NegGram® Caplets (Nalidixic acid, USP)[package insert]. Bridgewater, New Jersey: Sanofi-Aventis U.S. LLC; 2012. [Link]

PMID: 15315719

Nalidixic Acid

By

Nalidixic Acid

Product: Methylnaltrexone D3 (Bromide)

Identifier : DBSNPE002422
Drug : DB00779 (Nalidixic Acid)
Interacting Gene/Enzyme : Glucose-6-phosphate 1-dehydrogenase
Gene Name : G6PD
UniProt ID : P11413
Defining Change(s) :

  • 634A->G

Allele Name : Sibari
Genotype(s) : Not Available
Type(s) : ADR Inferred
Groups : G6PD deficiency
Description : Increased risk of hemolytic anemia.
References :

  1. NegGram® Caplets (Nalidixic acid, USP)[package insert]. Bridgewater, New Jersey: Sanofi-Aventis U.S. LLC; 2012. [Link]

PMID: 12928438

Nalidixic Acid

By

Nalidixic Acid

Product: PSI-6206 13CD3

Identifier : DBSNPE002423
Drug : DB00779 (Nalidixic Acid)
Interacting Gene/Enzyme : Glucose-6-phosphate 1-dehydrogenase
Gene Name : G6PD
UniProt ID : P11413
Defining Change(s) :

  • 680G->A

Allele Name : Mexico City
Genotype(s) : Not Available
Type(s) : ADR Inferred
Groups : G6PD deficiency
Description : Increased risk of hemolytic anemia.
References :

  1. NegGram® Caplets (Nalidixic acid, USP)[package insert]. Bridgewater, New Jersey: Sanofi-Aventis U.S. LLC; 2012. [Link]

PMID: 12566926

Nalidixic Acid

By

Nalidixic Acid

Product: Sofosbuvir 13CD3

Identifier : DBSNPE002424
Drug : DB00779 (Nalidixic Acid)
Interacting Gene/Enzyme : Glucose-6-phosphate 1-dehydrogenase
Gene Name : G6PD
UniProt ID : P11413
Defining Change(s) :

  • 703C->T

Allele Name : Nanning
Genotype(s) : Not Available
Type(s) : ADR Inferred
Groups : G6PD deficiency
Description : Increased risk of hemolytic anemia.
References :

  1. NegGram® Caplets (Nalidixic acid, USP)[package insert]. Bridgewater, New Jersey: Sanofi-Aventis U.S. LLC; 2012. [Link]

PMID: 25764078

Nalidixic Acid

By

Nalidixic Acid

Product: Rasagiline 13C3 (mesylate racemic)

Identifier : DBSNPE002425
Drug : DB00779 (Nalidixic Acid)
Interacting Gene/Enzyme : Glucose-6-phosphate 1-dehydrogenase
Gene Name : G6PD
UniProt ID : P11413
Defining Change(s) :

  • 844G->C

Allele Name : Seattle, Lodi, Modena, Ferrara II, Athens-like
Genotype(s) : Not Available
Type(s) : ADR Inferred
Groups : G6PD deficiency
Description : Increased risk of hemolytic anemia.
References :

  1. NegGram® Caplets (Nalidixic acid, USP)[package insert]. Bridgewater, New Jersey: Sanofi-Aventis U.S. LLC; 2012. [Link]

PMID: 19525962

Nalidixic Acid

By

Nalidixic Acid

Product: Bendamustine D4

Identifier : DBSNPE002426
Drug : DB00779 (Nalidixic Acid)
Interacting Gene/Enzyme : Glucose-6-phosphate 1-dehydrogenase
Gene Name : G6PD
UniProt ID : P11413
Defining Change(s) :

  • 844G->T

Allele Name : Bajo Maumere
Genotype(s) : Not Available
Type(s) : ADR Inferred
Groups : G6PD deficiency
Description : Increased risk of hemolytic anemia.
References :

  1. NegGram® Caplets (Nalidixic acid, USP)[package insert]. Bridgewater, New Jersey: Sanofi-Aventis U.S. LLC; 2012. [Link]

PMID: 22540008

Nalidixic Acid

By

Nalidixic Acid

Product: 6-beta-Naloxol (D5 hydrochloride)

Identifier : DBSNPE002427
Drug : DB00779 (Nalidixic Acid)
Interacting Gene/Enzyme : Glucose-6-phosphate 1-dehydrogenase
Gene Name : G6PD
UniProt ID : P11413
Defining Change(s) :

  • 854G->A

Allele Name : Montalbano
Genotype(s) : Not Available
Type(s) : ADR Inferred
Groups : G6PD deficiency
Description : Increased risk of hemolytic anemia.
References :

  1. NegGram® Caplets (Nalidixic acid, USP)[package insert]. Bridgewater, New Jersey: Sanofi-Aventis U.S. LLC; 2012. [Link]

PMID: 21389981

Nalidixic Acid

By

Nalidixic Acid

Product: N-Demethyl Ivabradine (D6 Hydrochloride)

Identifier : DBSNPE002429
Drug : DB00779 (Nalidixic Acid)
Interacting Gene/Enzyme : Glucose-6-phosphate 1-dehydrogenase
Gene Name : G6PD
UniProt ID : P11413
Defining Change(s) :

  • 95A->G

Allele Name : Gaohe
Genotype(s) : Not Available
Type(s) : ADR Inferred
Groups : G6PD deficiency
Description : Increased risk of hemolytic anemia.
References :

  1. NegGram® Caplets (Nalidixic acid, USP)[package insert]. Bridgewater, New Jersey: Sanofi-Aventis U.S. LLC; 2012. [Link]

PMID: 12606497

By

Related Post

You Missed

Uncategorized

actin binding LIM protein 1

Uncategorized

STOML2 Monoclonal Antibody (OTI1G6), TrueMAB™

Uncategorized

fms related tyrosine kinase 4

Uncategorized

STAT6 Monoclonal Antibody (2E5B8)