Quinine
Product: PKC412
Identifier : DBSNPE003115
Drug : DB00468 (Quinine)
Interacting Gene/Enzyme : Glucose-6-phosphate 1-dehydrogenase
Gene Name : G6PD
UniProt ID : P11413
Allele Name : Torun
Genotype(s) : Not Available
Type(s) : ADR Inferred
Groups : G6PD deficiency
Description : Increased risk of hemolysis.
References :
- Qualaquin®(quinine sulfate)[package insert]. Philadelphia, Pennsylvania: Mutual Pharmaceutical Company, Inc.; 2014. [Link]
PMID: 11349148
Quinine
Product: FH1
Identifier : DBSNPE003116
Drug : DB00468 (Quinine)
Interacting Gene/Enzyme : Glucose-6-phosphate 1-dehydrogenase
Gene Name : G6PD
UniProt ID : P11413
Allele Name : Sunderland
Genotype(s) : Not Available
Type(s) : ADR Inferred
Groups : G6PD deficiency
Description : Increased risk of hemolysis.
References :
- Qualaquin®(quinine sulfate)[package insert]. Philadelphia, Pennsylvania: Mutual Pharmaceutical Company, Inc.; 2014. [Link]
PMID: 11273020
Quinine
Product: Cerdulatinib
Identifier : DBSNPE003117
Drug : DB00468 (Quinine)
Interacting Gene/Enzyme : Glucose-6-phosphate 1-dehydrogenase
Gene Name : G6PD
UniProt ID : P11413
Allele Name : Iwatsuki
Genotype(s) : Not Available
Type(s) : ADR Inferred
Groups : G6PD deficiency
Description : Increased risk of hemolysis.
References :
- Qualaquin®(quinine sulfate)[package insert]. Philadelphia, Pennsylvania: Mutual Pharmaceutical Company, Inc.; 2014. [Link]
PMID: 10965989
Quinine
Product: GSK-J1 (lithium salt)
Identifier : DBSNPE003118
Drug : DB00468 (Quinine)
Interacting Gene/Enzyme : Glucose-6-phosphate 1-dehydrogenase
Gene Name : G6PD
UniProt ID : P11413
Allele Name : Serres
Genotype(s) : Not Available
Type(s) : ADR Inferred
Groups : G6PD deficiency
Description : Increased risk of hemolysis.
References :
- Qualaquin®(quinine sulfate)[package insert]. Philadelphia, Pennsylvania: Mutual Pharmaceutical Company, Inc.; 2014. [Link]
PMID: 22202492
Quinine
Product: ATN-161
Identifier : DBSNPE003119
Drug : DB00468 (Quinine)
Interacting Gene/Enzyme : Glucose-6-phosphate 1-dehydrogenase
Gene Name : G6PD
UniProt ID : P11413
Defining Change(s) :
- 1084_1101delCTGAACGAGCGCAAGGCC
Allele Name : Tondela
Genotype(s) : Not Available
Type(s) : ADR Inferred
Groups : G6PD deficiency
Description : Increased risk of hemolysis.
References :
- Qualaquin®(quinine sulfate)[package insert]. Philadelphia, Pennsylvania: Mutual Pharmaceutical Company, Inc.; 2014. [Link]
PMID: 10652602
Quinine
Product: GSK2110183
Identifier : DBSNPE003120
Drug : DB00468 (Quinine)
Interacting Gene/Enzyme : Glucose-6-phosphate 1-dehydrogenase
Gene Name : G6PD
UniProt ID : P11413
Allele Name : Loma Linda
Genotype(s) : Not Available
Type(s) : ADR Inferred
Groups : G6PD deficiency
Description : Increased risk of hemolysis.
References :
- Qualaquin®(quinine sulfate)[package insert]. Philadelphia, Pennsylvania: Mutual Pharmaceutical Company, Inc.; 2014. [Link]
PMID: 3055919
Quinine
Product: c-di-AMP
Identifier : DBSNPE003121
Drug : DB00468 (Quinine)
Interacting Gene/Enzyme : Glucose-6-phosphate 1-dehydrogenase
Gene Name : G6PD
UniProt ID : P11413
Allele Name : Aachen
Genotype(s) : Not Available
Type(s) : ADR Inferred
Groups : G6PD deficiency
Description : Increased risk of hemolysis.
References :
- Qualaquin®(quinine sulfate)[package insert]. Philadelphia, Pennsylvania: Mutual Pharmaceutical Company, Inc.; 2014. [Link]
PMID: 6933445
Quinine
Product: GSK2194069
Identifier : DBSNPE003122
Drug : DB00468 (Quinine)
Interacting Gene/Enzyme : Glucose-6-phosphate 1-dehydrogenase
Gene Name : G6PD
UniProt ID : P11413
Allele Name : Tenri
Genotype(s) : Not Available
Type(s) : ADR Inferred
Groups : G6PD deficiency
Description : Increased risk of hemolysis.
References :
- Qualaquin®(quinine sulfate)[package insert]. Philadelphia, Pennsylvania: Mutual Pharmaceutical Company, Inc.; 2014. [Link]
PMID: 26501302
Quinine
Product: SB269652
Identifier : DBSNPE003123
Drug : DB00468 (Quinine)
Interacting Gene/Enzyme : Glucose-6-phosphate 1-dehydrogenase
Gene Name : G6PD
UniProt ID : P11413
Allele Name : Montpellier
Genotype(s) : Not Available
Type(s) : ADR Inferred
Groups : G6PD deficiency
Description : Increased risk of hemolysis.
References :
- Qualaquin®(quinine sulfate)[package insert]. Philadelphia, Pennsylvania: Mutual Pharmaceutical Company, Inc.; 2014. [Link]
PMID: 23892605
Quinine
Product: GSK-J1
Identifier : DBSNPE003124
Drug : DB00468 (Quinine)
Interacting Gene/Enzyme : Glucose-6-phosphate 1-dehydrogenase
Gene Name : G6PD
UniProt ID : P11413
Allele Name : Calvo Mackenna
Genotype(s) : Not Available
Type(s) : ADR Inferred
Groups : G6PD deficiency
Description : Increased risk of hemolysis.
References :
- Qualaquin®(quinine sulfate)[package insert]. Philadelphia, Pennsylvania: Mutual Pharmaceutical Company, Inc.; 2014. [Link]
PMID: 11283400
Quinine
Product: Taltobulin
Identifier : DBSNPE003125
Drug : DB00468 (Quinine)
Interacting Gene/Enzyme : Glucose-6-phosphate 1-dehydrogenase
Gene Name : G6PD
UniProt ID : P11413
Allele Name : Riley
Genotype(s) : Not Available
Type(s) : ADR Inferred
Groups : G6PD deficiency
Description : Increased risk of hemolysis.
References :
- Qualaquin®(quinine sulfate)[package insert]. Philadelphia, Pennsylvania: Mutual Pharmaceutical Company, Inc.; 2014. [Link]
PMID: 11408350
Quinine
Product: Pyraclonil
Identifier : DBSNPE003126
Drug : DB00468 (Quinine)
Interacting Gene/Enzyme : Glucose-6-phosphate 1-dehydrogenase
Gene Name : G6PD
UniProt ID : P11413
Allele Name : Olomouc
Genotype(s) : Not Available
Type(s) : ADR Inferred
Groups : G6PD deficiency
Description : Increased risk of hemolysis.
References :
- Qualaquin®(quinine sulfate)[package insert]. Philadelphia, Pennsylvania: Mutual Pharmaceutical Company, Inc.; 2014. [Link]
PMID: 6089762
Quinine
Product: Aldicarb (sulfone)
Identifier : DBSNPE003127
Drug : DB00468 (Quinine)
Interacting Gene/Enzyme : Glucose-6-phosphate 1-dehydrogenase
Gene Name : G6PD
UniProt ID : P11413
Allele Name : Tomah
Genotype(s) : Not Available
Type(s) : ADR Inferred
Groups : G6PD deficiency
Description : Increased risk of hemolysis.
References :
- Qualaquin®(quinine sulfate)[package insert]. Philadelphia, Pennsylvania: Mutual Pharmaceutical Company, Inc.; 2014. [Link]
PMID: 16810078
Quinine
Product: Aldicarb
Identifier : DBSNPE003128
Drug : DB00468 (Quinine)
Interacting Gene/Enzyme : Glucose-6-phosphate 1-dehydrogenase
Gene Name : G6PD
UniProt ID : P11413
Allele Name : Lynwood
Genotype(s) : Not Available
Type(s) : ADR Inferred
Groups : G6PD deficiency
Description : Increased risk of hemolysis.
References :
- Qualaquin®(quinine sulfate)[package insert]. Philadelphia, Pennsylvania: Mutual Pharmaceutical Company, Inc.; 2014. [Link]
PMID: 15854203
Quinine
Product: Cyhalofop
Identifier : DBSNPE003129
Drug : DB00468 (Quinine)
Interacting Gene/Enzyme : Glucose-6-phosphate 1-dehydrogenase
Gene Name : G6PD
UniProt ID : P11413
Allele Name : Madrid
Genotype(s) : Not Available
Type(s) : ADR Inferred
Groups : G6PD deficiency
Description : Increased risk of hemolysis.
References :
- Qualaquin®(quinine sulfate)[package insert]. Philadelphia, Pennsylvania: Mutual Pharmaceutical Company, Inc.; 2014. [Link]
PMID: 9296275
Quinine
Product: Cloxyfonac
Identifier : DBSNPE003130
Drug : DB00468 (Quinine)
Interacting Gene/Enzyme : Glucose-6-phosphate 1-dehydrogenase
Gene Name : G6PD
UniProt ID : P11413
Allele Name : Iowa, Walter Reed, Springfield
Genotype(s) : Not Available
Type(s) : ADR Inferred
Groups : G6PD deficiency
Description : Increased risk of hemolysis.
References :
- Qualaquin®(quinine sulfate)[package insert]. Philadelphia, Pennsylvania: Mutual Pharmaceutical Company, Inc.; 2014. [Link]
PMID: 9509899
Quinine
Product: Bromethalin
Identifier : DBSNPE003131
Drug : DB00468 (Quinine)
Interacting Gene/Enzyme : Glucose-6-phosphate 1-dehydrogenase
Gene Name : G6PD
UniProt ID : P11413
Allele Name : Beverly Hills, Genova, Iwate, Niigata, Yamaguchi
Genotype(s) : Not Available
Type(s) : ADR Inferred
Groups : G6PD deficiency
Description : Increased risk of hemolysis.
References :
- Qualaquin®(quinine sulfate)[package insert]. Philadelphia, Pennsylvania: Mutual Pharmaceutical Company, Inc.; 2014. [Link]
PMID: 12699077
Quinine
Product: Bethoxazin
Identifier : DBSNPE003132
Drug : DB00468 (Quinine)
Interacting Gene/Enzyme : Glucose-6-phosphate 1-dehydrogenase
Gene Name : G6PD
UniProt ID : P11413
Allele Name : Hartford
Genotype(s) : Not Available
Type(s) : ADR Inferred
Groups : G6PD deficiency
Description : Increased risk of hemolysis.
References :
- Qualaquin®(quinine sulfate)[package insert]. Philadelphia, Pennsylvania: Mutual Pharmaceutical Company, Inc.; 2014. [Link]
PMID: 12616706
Quinine
Product: Benoxafos
Identifier : DBSNPE003133
Drug : DB00468 (Quinine)
Interacting Gene/Enzyme : Glucose-6-phosphate 1-dehydrogenase
Gene Name : G6PD
UniProt ID : P11413
Allele Name : Praha
Genotype(s) : Not Available
Type(s) : ADR Inferred
Groups : G6PD deficiency
Description : Increased risk of hemolysis.
References :
- Qualaquin®(quinine sulfate)[package insert]. Philadelphia, Pennsylvania: Mutual Pharmaceutical Company, Inc.; 2014. [Link]
PMID: 11405194
Quinine
Product: Athidathion
Identifier : DBSNPE003134
Drug : DB00468 (Quinine)
Interacting Gene/Enzyme : Glucose-6-phosphate 1-dehydrogenase
Gene Name : G6PD
UniProt ID : P11413
Allele Name : Krakow
Genotype(s) : Not Available
Type(s) : ADR Inferred
Groups : G6PD deficiency
Description : Increased risk of hemolysis.
References :
- Qualaquin®(quinine sulfate)[package insert]. Philadelphia, Pennsylvania: Mutual Pharmaceutical Company, Inc.; 2014. [Link]
PMID: 11563401
Quinine
Product: Meptyldinocap
Identifier : DBSNPE003135
Drug : DB00468 (Quinine)
Interacting Gene/Enzyme : Glucose-6-phosphate 1-dehydrogenase
Gene Name : G6PD
UniProt ID : P11413
Allele Name : Wisconsin
Genotype(s) : Not Available
Type(s) : ADR Inferred
Groups : G6PD deficiency
Description : Increased risk of hemolysis.
References :
- Qualaquin®(quinine sulfate)[package insert]. Philadelphia, Pennsylvania: Mutual Pharmaceutical Company, Inc.; 2014. [Link]
PMID: 17558433
Quinine
Product: Flumorph
Identifier : DBSNPE003136
Drug : DB00468 (Quinine)
Interacting Gene/Enzyme : Glucose-6-phosphate 1-dehydrogenase
Gene Name : G6PD
UniProt ID : P11413
Allele Name : Nashville, Anaheim, Portici
Genotype(s) : Not Available
Type(s) : ADR Inferred
Groups : G6PD deficiency
Description : Increased risk of hemolysis.
References :
- Qualaquin®(quinine sulfate)[package insert]. Philadelphia, Pennsylvania: Mutual Pharmaceutical Company, Inc.; 2014. [Link]
PMID: 17573484
Quinine
Product: PNU-159682
Identifier : DBSNPE003137
Drug : DB00468 (Quinine)
Interacting Gene/Enzyme : Glucose-6-phosphate 1-dehydrogenase
Gene Name : G6PD
UniProt ID : P11413
Allele Name : Alhambra
Genotype(s) : Not Available
Type(s) : ADR Inferred
Groups : G6PD deficiency
Description : Increased risk of hemolysis.
References :
- Qualaquin®(quinine sulfate)[package insert]. Philadelphia, Pennsylvania: Mutual Pharmaceutical Company, Inc.; 2014. [Link]
PMID: 8662919
Quinine
Product: GNE-9605
Identifier : DBSNPE003138
Drug : DB00468 (Quinine)
Interacting Gene/Enzyme : Glucose-6-phosphate 1-dehydrogenase
Gene Name : G6PD
UniProt ID : P11413
Allele Name : Bari
Genotype(s) : Not Available
Type(s) : ADR Inferred
Groups : G6PD deficiency
Description : Increased risk of hemolysis.
References :
- Qualaquin®(quinine sulfate)[package insert]. Philadelphia, Pennsylvania: Mutual Pharmaceutical Company, Inc.; 2014. [Link]
PMID: 17358052
Quinine
Product: Tildipirosin
Identifier : DBSNPE003139
Drug : DB00468 (Quinine)
Interacting Gene/Enzyme : Glucose-6-phosphate 1-dehydrogenase
Gene Name : G6PD
UniProt ID : P11413
Allele Name : Puerto Limon
Genotype(s) : Not Available
Type(s) : ADR Inferred
Groups : G6PD deficiency
Description : Increased risk of hemolysis.
References :
- Qualaquin®(quinine sulfate)[package insert]. Philadelphia, Pennsylvania: Mutual Pharmaceutical Company, Inc.; 2014. [Link]
PMID: 12522134
Quinine
Product: Rostafuroxin
Identifier : DBSNPE003140
Drug : DB00468 (Quinine)
Interacting Gene/Enzyme : Glucose-6-phosphate 1-dehydrogenase
Gene Name : G6PD
UniProt ID : P11413
Allele Name : Covao do Lobo
Genotype(s) : Not Available
Type(s) : ADR Inferred
Groups : G6PD deficiency
Description : Increased risk of hemolysis.
References :
- Qualaquin®(quinine sulfate)[package insert]. Philadelphia, Pennsylvania: Mutual Pharmaceutical Company, Inc.; 2014. [Link]
PMID: 6818976
Quinine
Product: NSC-41589
Identifier : DBSNPE003141
Drug : DB00468 (Quinine)
Interacting Gene/Enzyme : Glucose-6-phosphate 1-dehydrogenase
Gene Name : G6PD
UniProt ID : P11413
Allele Name : Clinic
Genotype(s) : Not Available
Type(s) : ADR Inferred
Groups : G6PD deficiency
Description : Increased risk of hemolysis.
References :
- Qualaquin®(quinine sulfate)[package insert]. Philadelphia, Pennsylvania: Mutual Pharmaceutical Company, Inc.; 2014. [Link]
PMID: 7143351
Quinine
Product: Penthiopyrad
Identifier : DBSNPE003142
Drug : DB00468 (Quinine)
Interacting Gene/Enzyme : Glucose-6-phosphate 1-dehydrogenase
Gene Name : G6PD
UniProt ID : P11413
Allele Name : Udivecht
Genotype(s) : Not Available
Type(s) : ADR Inferred
Groups : G6PD deficiency
Description : Increased risk of hemolysis.
References :
- Qualaquin®(quinine sulfate)[package insert]. Philadelphia, Pennsylvania: Mutual Pharmaceutical Company, Inc.; 2014. [Link]
PMID: 22434674
Quinine
Product: Novaluron
Identifier : DBSNPE003143
Drug : DB00468 (Quinine)
Interacting Gene/Enzyme : Glucose-6-phosphate 1-dehydrogenase
Gene Name : G6PD
UniProt ID : P11413
Allele Name : Suwalki
Genotype(s) : Not Available
Type(s) : ADR Inferred
Groups : G6PD deficiency
Description : Increased risk of hemolysis.
References :
- Qualaquin®(quinine sulfate)[package insert]. Philadelphia, Pennsylvania: Mutual Pharmaceutical Company, Inc.; 2014. [Link]
PMID: 16480258
Quinine
Product: Valifenalate
Identifier : DBSNPE003144
Drug : DB00468 (Quinine)
Interacting Gene/Enzyme : Glucose-6-phosphate 1-dehydrogenase
Gene Name : G6PD
UniProt ID : P11413
Allele Name : Riverside
Genotype(s) : Not Available
Type(s) : ADR Inferred
Groups : G6PD deficiency
Description : Increased risk of hemolysis.
References :
- Qualaquin®(quinine sulfate)[package insert]. Philadelphia, Pennsylvania: Mutual Pharmaceutical Company, Inc.; 2014. [Link]
PMID: 22616721
Quinine
Product: Tiadinil
Identifier : DBSNPE003145
Drug : DB00468 (Quinine)
Interacting Gene/Enzyme : Glucose-6-phosphate 1-dehydrogenase
Gene Name : G6PD
UniProt ID : P11413
Allele Name : Japan, Shinagawa
Genotype(s) : Not Available
Type(s) : ADR Inferred
Groups : G6PD deficiency
Description : Increased risk of hemolysis.
References :
- Qualaquin®(quinine sulfate)[package insert]. Philadelphia, Pennsylvania: Mutual Pharmaceutical Company, Inc.; 2014. [Link]
PMID: 22435740
Quinine
Product: Tolfenpyrad
Identifier : DBSNPE003146
Drug : DB00468 (Quinine)
Interacting Gene/Enzyme : Glucose-6-phosphate 1-dehydrogenase
Gene Name : G6PD
UniProt ID : P11413
Allele Name : Kawasaki
Genotype(s) : Not Available
Type(s) : ADR Inferred
Groups : G6PD deficiency
Description : Increased risk of hemolysis.
References :
- Qualaquin®(quinine sulfate)[package insert]. Philadelphia, Pennsylvania: Mutual Pharmaceutical Company, Inc.; 2014. [Link]
PMID: 22914621
Quinine
Product: Ipfencarbazone
Identifier : DBSNPE003147
Drug : DB00468 (Quinine)
Interacting Gene/Enzyme : Glucose-6-phosphate 1-dehydrogenase
Gene Name : G6PD
UniProt ID : P11413
Allele Name : Munich
Genotype(s) : Not Available
Type(s) : ADR Inferred
Groups : G6PD deficiency
Description : Increased risk of hemolysis.
References :
- Qualaquin®(quinine sulfate)[package insert]. Philadelphia, Pennsylvania: Mutual Pharmaceutical Company, Inc.; 2014. [Link]
PMID: 16774751
Quinine
Product: Amicarbazone
Identifier : DBSNPE003148
Drug : DB00468 (Quinine)
Interacting Gene/Enzyme : Glucose-6-phosphate 1-dehydrogenase
Gene Name : G6PD
UniProt ID : P11413
Allele Name : Georgia
Genotype(s) : Not Available
Type(s) : ADR Inferred
Groups : G6PD deficiency
Description : Increased risk of hemolysis.
References :
- Qualaquin®(quinine sulfate)[package insert]. Philadelphia, Pennsylvania: Mutual Pharmaceutical Company, Inc.; 2014. [Link]
PMID: 11834614
Quinine
Product: GLPG0634 analog
Identifier : DBSNPE003149
Drug : DB00468 (Quinine)
Interacting Gene/Enzyme : Glucose-6-phosphate 1-dehydrogenase
Gene Name : G6PD
UniProt ID : P11413
Allele Name : Sumare
Genotype(s) : Not Available
Type(s) : ADR Inferred
Groups : G6PD deficiency
Description : Increased risk of hemolysis.
References :
- Qualaquin®(quinine sulfate)[package insert]. Philadelphia, Pennsylvania: Mutual Pharmaceutical Company, Inc.; 2014. [Link]
PMID: 8632424
Quinine
Product: WH-4-023
Identifier : DBSNPE003150
Drug : DB00468 (Quinine)
Interacting Gene/Enzyme : Glucose-6-phosphate 1-dehydrogenase
Gene Name : G6PD
UniProt ID : P11413
Allele Name : Telti/Kobe
Genotype(s) : Not Available
Type(s) : ADR Inferred
Groups : G6PD deficiency
Description : Increased risk of hemolysis.
References :
- Qualaquin®(quinine sulfate)[package insert]. Philadelphia, Pennsylvania: Mutual Pharmaceutical Company, Inc.; 2014. [Link]
PMID: 15545290
Quinine
Product: CL-387785
Identifier : DBSNPE003151
Drug : DB00468 (Quinine)
Interacting Gene/Enzyme : Glucose-6-phosphate 1-dehydrogenase
Gene Name : G6PD
UniProt ID : P11413
Allele Name : Santiago de Cuba, Morioka
Genotype(s) : Not Available
Type(s) : ADR Inferred
Groups : G6PD deficiency
Description : Increased risk of hemolysis.
References :
- Qualaquin®(quinine sulfate)[package insert]. Philadelphia, Pennsylvania: Mutual Pharmaceutical Company, Inc.; 2014. [Link]
PMID: 9228188
Quinine
Product: GKT137831
Identifier : DBSNPE003152
Drug : DB00468 (Quinine)
Interacting Gene/Enzyme : Glucose-6-phosphate 1-dehydrogenase
Gene Name : G6PD
UniProt ID : P11413
Allele Name : Harima
Genotype(s) : Not Available
Type(s) : ADR Inferred
Groups : G6PD deficiency
Description : Increased risk of hemolysis.
References :
- Qualaquin®(quinine sulfate)[package insert]. Philadelphia, Pennsylvania: Mutual Pharmaceutical Company, Inc.; 2014. [Link]
PMID: 10415900
Quinine
Product: SA4503
Identifier : DBSNPE003153
Drug : DB00468 (Quinine)
Interacting Gene/Enzyme : Glucose-6-phosphate 1-dehydrogenase
Gene Name : G6PD
UniProt ID : P11413
Allele Name : Figuera da Foz
Genotype(s) : Not Available
Type(s) : ADR Inferred
Groups : G6PD deficiency
Description : Increased risk of hemolysis.
References :
- Qualaquin®(quinine sulfate)[package insert]. Philadelphia, Pennsylvania: Mutual Pharmaceutical Company, Inc.; 2014. [Link]
PMID: 10415939
Quinine
Product: SA4503 (dihydrochloride)
Identifier : DBSNPE003154
Drug : DB00468 (Quinine)
Interacting Gene/Enzyme : Glucose-6-phosphate 1-dehydrogenase
Gene Name : G6PD
UniProt ID : P11413
Allele Name : Amiens
Genotype(s) : Not Available
Type(s) : ADR Inferred
Groups : G6PD deficiency
Description : Increased risk of hemolysis.
References :
- Qualaquin®(quinine sulfate)[package insert]. Philadelphia, Pennsylvania: Mutual Pharmaceutical Company, Inc.; 2014. [Link]
PMID: 8528553
Quinine
Product: Pixantrone (dimaleate)
Identifier : DBSNPE003155
Drug : DB00468 (Quinine)
Interacting Gene/Enzyme : Glucose-6-phosphate 1-dehydrogenase
Gene Name : G6PD
UniProt ID : P11413
Allele Name : Bangkok Noi
Genotype(s) : Not Available
Type(s) : ADR Inferred
Groups : G6PD deficiency
Description : Increased risk of hemolysis.
References :
- Qualaquin®(quinine sulfate)[package insert]. Philadelphia, Pennsylvania: Mutual Pharmaceutical Company, Inc.; 2014. [Link]
PMID: 22869374
Quinine
Product: WAY-262611
Identifier : DBSNPE003156
Drug : DB00468 (Quinine)
Interacting Gene/Enzyme : Glucose-6-phosphate 1-dehydrogenase
Gene Name : G6PD
UniProt ID : P11413
Allele Name : Fukaya
Genotype(s) : Not Available
Type(s) : ADR Inferred
Groups : G6PD deficiency
Description : Increased risk of hemolysis.
References :
- Qualaquin®(quinine sulfate)[package insert]. Philadelphia, Pennsylvania: Mutual Pharmaceutical Company, Inc.; 2014. [Link]
PMID: 9138700
Quinine
Product: N6-Methyladenosine
Identifier : DBSNPE003157
Drug : DB00468 (Quinine)
Interacting Gene/Enzyme : Glucose-6-phosphate 1-dehydrogenase
Gene Name : G6PD
UniProt ID : P11413
Allele Name : Campinas
Genotype(s) : Not Available
Type(s) : ADR Inferred
Groups : G6PD deficiency
Description : Increased risk of hemolysis.
References :
- Qualaquin®(quinine sulfate)[package insert]. Philadelphia, Pennsylvania: Mutual Pharmaceutical Company, Inc.; 2014. [Link]
PMID: 9453462
Quinine
Product: BX471 (hydrochloride)
Identifier : DBSNPE003158
Drug : DB00468 (Quinine)
Interacting Gene/Enzyme : Glucose-6-phosphate 1-dehydrogenase
Gene Name : G6PD
UniProt ID : P11413
Allele Name : Buenos Aires
Genotype(s) : Not Available
Type(s) : ADR Inferred
Groups : G6PD deficiency
Description : Increased risk of hemolysis.
References :
- Qualaquin®(quinine sulfate)[package insert]. Philadelphia, Pennsylvania: Mutual Pharmaceutical Company, Inc.; 2014. [Link]
PMID: 26836578
Quinine
Product: BX471
Identifier : DBSNPE003159
Drug : DB00468 (Quinine)
Interacting Gene/Enzyme : Glucose-6-phosphate 1-dehydrogenase
Gene Name : G6PD
UniProt ID : P11413
Allele Name : Arakawa
Genotype(s) : Not Available
Type(s) : ADR Inferred
Groups : G6PD deficiency
Description : Increased risk of hemolysis.
References :
- Qualaquin®(quinine sulfate)[package insert]. Philadelphia, Pennsylvania: Mutual Pharmaceutical Company, Inc.; 2014. [Link]
PMID: 26207924
Quinine
Product: AMG 232
Identifier : DBSNPE003160
Drug : DB00468 (Quinine)
Interacting Gene/Enzyme : Glucose-6-phosphate 1-dehydrogenase
Gene Name : G6PD
UniProt ID : P11413
Allele Name : Brighton
Genotype(s) : Not Available
Type(s) : ADR Inferred
Groups : G6PD deficiency
Description : Increased risk of hemolysis.
References :
- Qualaquin®(quinine sulfate)[package insert]. Philadelphia, Pennsylvania: Mutual Pharmaceutical Company, Inc.; 2014. [Link]
PMID: 19507862
Quinine
Product: HG6-64-1
Identifier : DBSNPE003161
Drug : DB00468 (Quinine)
Interacting Gene/Enzyme : Glucose-6-phosphate 1-dehydrogenase
Gene Name : G6PD
UniProt ID : P11413
Allele Name : Kozukata
Genotype(s) : Not Available
Type(s) : ADR Inferred
Groups : G6PD deficiency
Description : Increased risk of hemolysis.
References :
- Qualaquin®(quinine sulfate)[package insert]. Philadelphia, Pennsylvania: Mutual Pharmaceutical Company, Inc.; 2014. [Link]
PMID: 26243621
Quinine
Product: AMG 837 (calcium hydrate)
Identifier : DBSNPE003162
Drug : DB00468 (Quinine)
Interacting Gene/Enzyme : Glucose-6-phosphate 1-dehydrogenase
Gene Name : G6PD
UniProt ID : P11413
Allele Name : Amsterdam
Genotype(s) : Not Available
Type(s) : ADR Inferred
Groups : G6PD deficiency
Description : Increased risk of hemolysis.
References :
- Qualaquin®(quinine sulfate)[package insert]. Philadelphia, Pennsylvania: Mutual Pharmaceutical Company, Inc.; 2014. [Link]
PMID: 24587363
Quinine
Product: AMG 837 (sodium salt)
Identifier : DBSNPE003163
Drug : DB00468 (Quinine)
Interacting Gene/Enzyme : Glucose-6-phosphate 1-dehydrogenase
Gene Name : G6PD
UniProt ID : P11413
Defining Change(s) :
- 202G->A, 376A->G, 1264C>G
Allele Name : No name
Genotype(s) : Not Available
Type(s) : ADR Inferred
Groups : G6PD deficiency
Description : Increased risk of hemolysis.
References :
- Qualaquin®(quinine sulfate)[package insert]. Philadelphia, Pennsylvania: Mutual Pharmaceutical Company, Inc.; 2014. [Link]
PMID: 19789352
Quinine
Product: AMG 837
Identifier : DBSNPE003164
Drug : DB00468 (Quinine)
Interacting Gene/Enzyme : Glucose-6-phosphate 1-dehydrogenase
Gene Name : G6PD
UniProt ID : P11413
Allele Name : Swansea
Genotype(s) : Not Available
Type(s) : ADR Inferred
Groups : G6PD deficiency
Description : Increased risk of hemolysis.
References :
- Qualaquin®(quinine sulfate)[package insert]. Philadelphia, Pennsylvania: Mutual Pharmaceutical Company, Inc.; 2014. [Link]
PMID: 19117999
Quinine
Product: Cryptotanshinone
Identifier : DBSNPE003165
Drug : DB00468 (Quinine)
Interacting Gene/Enzyme : Glucose-6-phosphate 1-dehydrogenase
Gene Name : G6PD
UniProt ID : P11413
Allele Name : Urayasu
Genotype(s) : Not Available
Type(s) : ADR Inferred
Groups : G6PD deficiency
Description : Increased risk of hemolysis.
References :
- Qualaquin®(quinine sulfate)[package insert]. Philadelphia, Pennsylvania: Mutual Pharmaceutical Company, Inc.; 2014. [Link]
PMID: 17296734
Quinine
Product: 4SC-202 (free base)
Identifier : DBSNPE003166
Drug : DB00468 (Quinine)
Interacting Gene/Enzyme : Glucose-6-phosphate 1-dehydrogenase
Gene Name : G6PD
UniProt ID : P11413
Allele Name : Vancouver
Genotype(s) : Not Available
Type(s) : ADR Inferred
Groups : G6PD deficiency
Description : Increased risk of hemolysis.
References :
- Qualaquin®(quinine sulfate)[package insert]. Philadelphia, Pennsylvania: Mutual Pharmaceutical Company, Inc.; 2014. [Link]
PMID: 16134929
Quinine
Product: YH239-EE
Identifier : DBSNPE003167
Drug : DB00468 (Quinine)
Interacting Gene/Enzyme : Glucose-6-phosphate 1-dehydrogenase
Gene Name : G6PD
UniProt ID : P11413
Allele Name : Mt Sinai
Genotype(s) : Not Available
Type(s) : ADR Inferred
Groups : G6PD deficiency
Description : Increased risk of hemolysis.
References :
- Qualaquin®(quinine sulfate)[package insert]. Philadelphia, Pennsylvania: Mutual Pharmaceutical Company, Inc.; 2014. [Link]
PMID: 25643582
Quinine
Product: TAS-103
Identifier : DBSNPE003168
Drug : DB00468 (Quinine)
Interacting Gene/Enzyme : Glucose-6-phosphate 1-dehydrogenase
Gene Name : G6PD
UniProt ID : P11413
Allele Name : Plymouth
Genotype(s) : Not Available
Type(s) : ADR Inferred
Groups : G6PD deficiency
Description : Increased risk of hemolysis.
References :
- Qualaquin®(quinine sulfate)[package insert]. Philadelphia, Pennsylvania: Mutual Pharmaceutical Company, Inc.; 2014. [Link]
PMID: 21455580
Quinine
Product: TAS-103 (dihydrochloride)
Identifier : DBSNPE003169
Drug : DB00468 (Quinine)
Interacting Gene/Enzyme : Glucose-6-phosphate 1-dehydrogenase
Gene Name : G6PD
UniProt ID : P11413
Allele Name : Volendam
Genotype(s) : Not Available
Type(s) : ADR Inferred
Groups : G6PD deficiency
Description : Increased risk of hemolysis.
References :
- Qualaquin®(quinine sulfate)[package insert]. Philadelphia, Pennsylvania: Mutual Pharmaceutical Company, Inc.; 2014. [Link]
PMID: 15746061
Quinine
Product: (R)-(+)-Etomoxir (sodium salt)
Identifier : DBSNPE003170
Drug : DB00468 (Quinine)
Interacting Gene/Enzyme : Glucose-6-phosphate 1-dehydrogenase
Gene Name : G6PD
UniProt ID : P11413
Allele Name : Shinshu
Genotype(s) : Not Available
Type(s) : ADR Inferred
Groups : G6PD deficiency
Description : Increased risk of hemolysis.
References :
- Qualaquin®(quinine sulfate)[package insert]. Philadelphia, Pennsylvania: Mutual Pharmaceutical Company, Inc.; 2014. [Link]
PMID: 15141010
Quinine
Product: FR 180204
Identifier : DBSNPE003171
Drug : DB00468 (Quinine)
Interacting Gene/Enzyme : Glucose-6-phosphate 1-dehydrogenase
Gene Name : G6PD
UniProt ID : P11413
Allele Name : Chikugo
Genotype(s) : Not Available
Type(s) : ADR Inferred
Groups : G6PD deficiency
Description : Increased risk of hemolysis.
References :
- Qualaquin®(quinine sulfate)[package insert]. Philadelphia, Pennsylvania: Mutual Pharmaceutical Company, Inc.; 2014. [Link]
PMID: 18515591
Quinine
Product: CYT387 (Mesylate)
Identifier : DBSNPE003172
Drug : DB00468 (Quinine)
Interacting Gene/Enzyme : Glucose-6-phosphate 1-dehydrogenase
Gene Name : G6PD
UniProt ID : P11413
Allele Name : Tsukui
Genotype(s) : Not Available
Type(s) : ADR Inferred
Groups : G6PD deficiency
Description : Increased risk of hemolysis.
References :
- Qualaquin®(quinine sulfate)[package insert]. Philadelphia, Pennsylvania: Mutual Pharmaceutical Company, Inc.; 2014. [Link]
PMID: 16166596
Quinine
Product: Nexturastat A
Identifier : DBSNPE003174
Drug : DB00468 (Quinine)
Interacting Gene/Enzyme : Glucose-6-phosphate 1-dehydrogenase
Gene Name : G6PD
UniProt ID : P11413
Allele Name : Santiago
Genotype(s) : Not Available
Type(s) : ADR Inferred
Groups : G6PD deficiency
Description : Increased risk of hemolysis.
References :
- Qualaquin®(quinine sulfate)[package insert]. Philadelphia, Pennsylvania: Mutual Pharmaceutical Company, Inc.; 2014. [Link]
PMID: 14729630
Quinine
Product: Dictamine
Identifier : DBSNPE003175
Drug : DB00468 (Quinine)
Interacting Gene/Enzyme : Glucose-6-phosphate 1-dehydrogenase
Gene Name : G6PD
UniProt ID : P11413
Allele Name : Minnesota, Marion, Gastonia, LeJeune
Genotype(s) : Not Available
Type(s) : ADR Inferred
Groups : G6PD deficiency
Description : Increased risk of hemolysis.
References :
- Qualaquin®(quinine sulfate)[package insert]. Philadelphia, Pennsylvania: Mutual Pharmaceutical Company, Inc.; 2014. [Link]
PMID: 19148466
Quinine
Product: Arg-Gly-Asp-Ser
Identifier : DBSNPE003176
Drug : DB00468 (Quinine)
Interacting Gene/Enzyme : Glucose-6-phosphate 1-dehydrogenase
Gene Name : G6PD
UniProt ID : P11413
Allele Name : Cincinnati
Genotype(s) : Not Available
Type(s) : ADR Inferred
Groups : G6PD deficiency
Description : Increased risk of hemolysis.
References :
- Qualaquin®(quinine sulfate)[package insert]. Philadelphia, Pennsylvania: Mutual Pharmaceutical Company, Inc.; 2014. [Link]
PMID: 16961415
Quinine
Product: kb-NB77-78
Identifier : DBSNPE003177
Drug : DB00468 (Quinine)
Interacting Gene/Enzyme : Glucose-6-phosphate 1-dehydrogenase
Gene Name : G6PD
UniProt ID : P11413
Allele Name : Harilaou
Genotype(s) : Not Available
Type(s) : ADR Inferred
Groups : G6PD deficiency
Description : Increased risk of hemolysis.
References :
- Qualaquin®(quinine sulfate)[package insert]. Philadelphia, Pennsylvania: Mutual Pharmaceutical Company, Inc.; 2014. [Link]
PMID: 22869525
Quinine
Product: Fabomotizole (hydrochloride)
Identifier : DBSNPE003179
Drug : DB00468 (Quinine)
Interacting Gene/Enzyme : Glucose-6-phosphate 1-dehydrogenase
Gene Name : G6PD
UniProt ID : P11413
Allele Name : Asahikawa
Genotype(s) : Not Available
Type(s) : ADR Inferred
Groups : G6PD deficiency
Description : Increased risk of hemolysis.
References :
- Qualaquin®(quinine sulfate)[package insert]. Philadelphia, Pennsylvania: Mutual Pharmaceutical Company, Inc.; 2014. [Link]
PMID: 21878657
Quinine
Product: Raltegravir (potassium salt)
Identifier : DBSNPE003180
Drug : DB00468 (Quinine)
Interacting Gene/Enzyme : Glucose-6-phosphate 1-dehydrogenase
Gene Name : G6PD
UniProt ID : P11413
Allele Name : Durham
Genotype(s) : Not Available
Type(s) : ADR Inferred
Groups : G6PD deficiency
Description : Increased risk of hemolysis.
References :
- Qualaquin®(quinine sulfate)[package insert]. Philadelphia, Pennsylvania: Mutual Pharmaceutical Company, Inc.; 2014. [Link]
PMID: 21330367
Quinine
Product: GSK2656157
Identifier : DBSNPE003181
Drug : DB00468 (Quinine)
Interacting Gene/Enzyme : Glucose-6-phosphate 1-dehydrogenase
Gene Name : G6PD
UniProt ID : P11413
Allele Name : Stonybrook
Genotype(s) : Not Available
Type(s) : ADR Inferred
Groups : G6PD deficiency
Description : Increased risk of hemolysis.
References :
- Qualaquin®(quinine sulfate)[package insert]. Philadelphia, Pennsylvania: Mutual Pharmaceutical Company, Inc.; 2014. [Link]
PMID: 20207740
Quinine
Product: LY310762
Identifier : DBSNPE003182
Drug : DB00468 (Quinine)
Interacting Gene/Enzyme : Glucose-6-phosphate 1-dehydrogenase
Gene Name : G6PD
UniProt ID : P11413
Allele Name : Wayne
Genotype(s) : Not Available
Type(s) : ADR Inferred
Groups : G6PD deficiency
Description : Increased risk of hemolysis.
References :
- Qualaquin®(quinine sulfate)[package insert]. Philadelphia, Pennsylvania: Mutual Pharmaceutical Company, Inc.; 2014. [Link]
PMID: 17595071
Quinine
Product: GSK-J2
Identifier : DBSNPE003183
Drug : DB00468 (Quinine)
Interacting Gene/Enzyme : Glucose-6-phosphate 1-dehydrogenase
Gene Name : G6PD
UniProt ID : P11413
Allele Name : Aveiro
Genotype(s) : Not Available
Type(s) : ADR Inferred
Groups : G6PD deficiency
Description : Increased risk of hemolysis.
References :
- Qualaquin®(quinine sulfate)[package insert]. Philadelphia, Pennsylvania: Mutual Pharmaceutical Company, Inc.; 2014. [Link]
PMID: 12740809
Quinine
Product: Mutated EGFR-IN-1
Identifier : DBSNPE003184
Drug : DB00468 (Quinine)
Interacting Gene/Enzyme : Glucose-6-phosphate 1-dehydrogenase
Gene Name : G6PD
UniProt ID : P11413
Allele Name : Cleveland Corum
Genotype(s) : Not Available
Type(s) : ADR Inferred
Groups : G6PD deficiency
Description : Increased risk of hemolysis.
References :
- Qualaquin®(quinine sulfate)[package insert]. Philadelphia, Pennsylvania: Mutual Pharmaceutical Company, Inc.; 2014. [Link]
PMID: 11237209
Quinine
Product: WZ4003
Identifier : DBSNPE003185
Drug : DB00468 (Quinine)
Interacting Gene/Enzyme : Glucose-6-phosphate 1-dehydrogenase
Gene Name : G6PD
UniProt ID : P11413
Allele Name : Lille
Genotype(s) : Not Available
Type(s) : ADR Inferred
Groups : G6PD deficiency
Description : Increased risk of hemolysis.
References :
- Qualaquin®(quinine sulfate)[package insert]. Philadelphia, Pennsylvania: Mutual Pharmaceutical Company, Inc.; 2014. [Link]
PMID: 11553687
Quinine
Product: HG-14-10-04
Identifier : DBSNPE003186
Drug : DB00468 (Quinine)
Interacting Gene/Enzyme : Glucose-6-phosphate 1-dehydrogenase
Gene Name : G6PD
UniProt ID : P11413
Allele Name : Bangkok
Genotype(s) : Not Available
Type(s) : ADR Inferred
Groups : G6PD deficiency
Description : Increased risk of hemolysis.
References :
- Qualaquin®(quinine sulfate)[package insert]. Philadelphia, Pennsylvania: Mutual Pharmaceutical Company, Inc.; 2014. [Link]
PMID: 11107083
Quinine
Product: AZD1283
Identifier : DBSNPE003187
Drug : DB00468 (Quinine)
Interacting Gene/Enzyme : Glucose-6-phosphate 1-dehydrogenase
Gene Name : G6PD
UniProt ID : P11413
Allele Name : Sugao
Genotype(s) : Not Available
Type(s) : ADR Inferred
Groups : G6PD deficiency
Description : Increased risk of hemolysis.
References :
- Qualaquin®(quinine sulfate)[package insert]. Philadelphia, Pennsylvania: Mutual Pharmaceutical Company, Inc.; 2014. [Link]
PMID: 19389739
Quinine
Product: UNC2881
Identifier : DBSNPE003188
Drug : DB00468 (Quinine)
Interacting Gene/Enzyme : Glucose-6-phosphate 1-dehydrogenase
Gene Name : G6PD
UniProt ID : P11413
Allele Name : La Jolla
Genotype(s) : Not Available
Type(s) : ADR Inferred
Groups : G6PD deficiency
Description : Increased risk of hemolysis.
References :
- Qualaquin®(quinine sulfate)[package insert]. Philadelphia, Pennsylvania: Mutual Pharmaceutical Company, Inc.; 2014. [Link]
PMID: 12528542
Quinine
Product: Buparvaquone
Identifier : DBSNPE003189
Drug : DB00468 (Quinine)
Interacting Gene/Enzyme : Glucose-6-phosphate 1-dehydrogenase
Gene Name : G6PD
UniProt ID : P11413
Allele Name : Wexham
Genotype(s) : Not Available
Type(s) : ADR Inferred
Groups : G6PD deficiency
Description : Increased risk of hemolysis.
References :
- Qualaquin®(quinine sulfate)[package insert]. Philadelphia, Pennsylvania: Mutual Pharmaceutical Company, Inc.; 2014. [Link]
PMID: 11220495
Quinine
Product: TTNPB
Identifier : DBSNPE003190
Drug : DB00468 (Quinine)
Interacting Gene/Enzyme : Glucose-6-phosphate 1-dehydrogenase
Gene Name : G6PD
UniProt ID : P11413
Allele Name : Piodivkow
Genotype(s) : Not Available
Type(s) : ADR Inferred
Groups : G6PD deficiency
Description : Increased risk of hemolysis.
References :
- Qualaquin®(quinine sulfate)[package insert]. Philadelphia, Pennsylvania: Mutual Pharmaceutical Company, Inc.; 2014. [Link]
PMID: 23995290
Quinine
Product: APD668
Identifier : DBSNPE003191
Drug : DB00468 (Quinine)
Interacting Gene/Enzyme : Glucose-6-phosphate 1-dehydrogenase
Gene Name : G6PD
UniProt ID : P11413
Allele Name : West Virginia
Genotype(s) : Not Available
Type(s) : ADR Inferred
Groups : G6PD deficiency
Description : Increased risk of hemolysis.
References :
- Qualaquin®(quinine sulfate)[package insert]. Philadelphia, Pennsylvania: Mutual Pharmaceutical Company, Inc.; 2014. [Link]
PMID: 21763658
Quinine
Product: AM580
Identifier : DBSNPE003192
Drug : DB00468 (Quinine)
Interacting Gene/Enzyme : Glucose-6-phosphate 1-dehydrogenase
Gene Name : G6PD
UniProt ID : P11413
Allele Name : Omiya
Genotype(s) : Not Available
Type(s) : ADR Inferred
Groups : G6PD deficiency
Description : Increased risk of hemolysis.
References :
- Qualaquin®(quinine sulfate)[package insert]. Philadelphia, Pennsylvania: Mutual Pharmaceutical Company, Inc.; 2014. [Link]
PMID: 19623253
Quinine
Product: Saxagliptin (hydrate)
Identifier : DBSNPE003193
Drug : DB00468 (Quinine)
Interacting Gene/Enzyme : Glucose-6-phosphate 1-dehydrogenase
Gene Name : G6PD
UniProt ID : P11413
Defining Change(s) :
- 953_976delCCACCAAAGGGTACCTGGAC GACC
Allele Name : Nara
Genotype(s) : Not Available
Type(s) : ADR Inferred
Groups : G6PD deficiency
Description : Increased risk of hemolysis.
References :
- Qualaquin®(quinine sulfate)[package insert]. Philadelphia, Pennsylvania: Mutual Pharmaceutical Company, Inc.; 2014. [Link]
PMID: 23690925
Quinine
Product: Fidaxomicin
Identifier : DBSNPE003194
Drug : DB00468 (Quinine)
Interacting Gene/Enzyme : Glucose-6-phosphate 1-dehydrogenase
Gene Name : G6PD
UniProt ID : P11413
Allele Name : Manhattan
Genotype(s) : Not Available
Type(s) : ADR Inferred
Groups : G6PD deficiency
Description : Increased risk of hemolysis.
References :
- Qualaquin®(quinine sulfate)[package insert]. Philadelphia, Pennsylvania: Mutual Pharmaceutical Company, Inc.; 2014. [Link]
PMID: 23513224
Quinine
Product: Micafungin
Identifier : DBSNPE003195
Drug : DB00468 (Quinine)
Interacting Gene/Enzyme : Glucose-6-phosphate 1-dehydrogenase
Gene Name : G6PD
UniProt ID : P11413
Allele Name : Rehevot
Genotype(s) : Not Available
Type(s) : ADR Inferred
Groups : G6PD deficiency
Description : Increased risk of hemolysis.
References :
- Qualaquin®(quinine sulfate)[package insert]. Philadelphia, Pennsylvania: Mutual Pharmaceutical Company, Inc.; 2014. [Link]
PMID: 22621923
Quinine
Product: Pneumocandin B0
Identifier : DBSNPE003196
Drug : DB00468 (Quinine)
Interacting Gene/Enzyme : Glucose-6-phosphate 1-dehydrogenase
Gene Name : G6PD
UniProt ID : P11413
Allele Name : Honiara
Genotype(s) : Not Available
Type(s) : ADR Inferred
Groups : G6PD deficiency
Description : Increased risk of hemolysis.
References :
- Qualaquin®(quinine sulfate)[package insert]. Philadelphia, Pennsylvania: Mutual Pharmaceutical Company, Inc.; 2014. [Link]
PMID: 23293297
Quinine
Product: (R)-(-)-Rolipram
Identifier : DBSNPE003197
Drug : DB00468 (Quinine)
Interacting Gene/Enzyme : Glucose-6-phosphate 1-dehydrogenase
Gene Name : G6PD
UniProt ID : P11413
Allele Name : Tokyo, Fukushima
Genotype(s) : Not Available
Type(s) : ADR Inferred
Groups : G6PD deficiency
Description : Increased risk of hemolysis.
References :
- Qualaquin®(quinine sulfate)[package insert]. Philadelphia, Pennsylvania: Mutual Pharmaceutical Company, Inc.; 2014. [Link]
PMID: 11689087
Quinine
Product: THZ2
Identifier : DBSNPE003198
Drug : DB00468 (Quinine)
Interacting Gene/Enzyme : Glucose-6-phosphate 1-dehydrogenase
Gene Name : G6PD
UniProt ID : P11413
Allele Name : Chatham
Genotype(s) : Not Available
Type(s) : ADR Inferred
Groups : G6PD deficiency
Description : Increased risk of hemolysis.
References :
- Qualaquin®(quinine sulfate)[package insert]. Philadelphia, Pennsylvania: Mutual Pharmaceutical Company, Inc.; 2014. [Link]
PMID: 15756023
Quinine
Product: Pirarubicin (Hydrochloride)
Identifier : DBSNPE003199
Drug : DB00468 (Quinine)
Interacting Gene/Enzyme : Glucose-6-phosphate 1-dehydrogenase
Gene Name : G6PD
UniProt ID : P11413
Allele Name : Fushan
Genotype(s) : Not Available
Type(s) : ADR Inferred
Groups : G6PD deficiency
Description : Increased risk of hemolysis.
References :
- Qualaquin®(quinine sulfate)[package insert]. Philadelphia, Pennsylvania: Mutual Pharmaceutical Company, Inc.; 2014. [Link]
PMID: 25714914
Quinine
Product: NSC 405020
Identifier : DBSNPE003200
Drug : DB00468 (Quinine)
Interacting Gene/Enzyme : Glucose-6-phosphate 1-dehydrogenase
Gene Name : G6PD
UniProt ID : P11413
Allele Name : Partenope
Genotype(s) : Not Available
Type(s) : ADR Inferred
Groups : G6PD deficiency
Description : Increased risk of hemolysis.
References :
- Qualaquin®(quinine sulfate)[package insert]. Philadelphia, Pennsylvania: Mutual Pharmaceutical Company, Inc.; 2014. [Link]
PMID: 26337045
Quinine
Product: Vancomycin
Identifier : DBSNPE003202
Drug : DB00468 (Quinine)
Interacting Gene/Enzyme : Glucose-6-phosphate 1-dehydrogenase
Gene Name : G6PD
UniProt ID : P11413
Allele Name : Anadia
Genotype(s) : Not Available
Type(s) : ADR Inferred
Groups : G6PD deficiency
Description : Increased risk of hemolysis.
References :
- Qualaquin®(quinine sulfate)[package insert]. Philadelphia, Pennsylvania: Mutual Pharmaceutical Company, Inc.; 2014. [Link]
PMID: 24911653
Quinine
Product: 3,3,5-Triiodo-L-thyronine (sodium)
Identifier : DBSNPE003203
Drug : DB00468 (Quinine)
Interacting Gene/Enzyme : Glucose-6-phosphate 1-dehydrogenase
Gene Name : G6PD
UniProt ID : P11413
Allele Name : Abeno
Genotype(s) : Not Available
Type(s) : ADR Inferred
Groups : G6PD deficiency
Description : Increased risk of hemolysis.
References :
- Qualaquin®(quinine sulfate)[package insert]. Philadelphia, Pennsylvania: Mutual Pharmaceutical Company, Inc.; 2014. [Link]
PMID: 20649582
Quinine
Product: Bromosporine
Identifier : DBSNPE003204
Drug : DB00468 (Quinine)
Interacting Gene/Enzyme : Glucose-6-phosphate 1-dehydrogenase
Gene Name : G6PD
UniProt ID : P11413
Allele Name : Surabaya
Genotype(s) : Not Available
Type(s) : ADR Inferred
Groups : G6PD deficiency
Description : Increased risk of hemolysis.
References :
- Qualaquin®(quinine sulfate)[package insert]. Philadelphia, Pennsylvania: Mutual Pharmaceutical Company, Inc.; 2014. [Link]
PMID: 16009742
Quinine
Product: RVX-208
Identifier : DBSNPE003205
Drug : DB00468 (Quinine)
Interacting Gene/Enzyme : Glucose-6-phosphate 1-dehydrogenase
Gene Name : G6PD
UniProt ID : P11413
Allele Name : Pawnee
Genotype(s) : Not Available
Type(s) : ADR Inferred
Groups : G6PD deficiency
Description : Increased risk of hemolysis.
References :
- Qualaquin®(quinine sulfate)[package insert]. Philadelphia, Pennsylvania: Mutual Pharmaceutical Company, Inc.; 2014. [Link]
PMID: 12403772
Quinine
Product: B-Raf IN 1
Identifier : DBSNPE003206
Drug : DB00468 (Quinine)
Interacting Gene/Enzyme : Glucose-6-phosphate 1-dehydrogenase
Gene Name : G6PD
UniProt ID : P11413
Allele Name : S. Antioco
Genotype(s) : Not Available
Type(s) : ADR Inferred
Groups : G6PD deficiency
Description : Increased risk of hemolysis.
References :
- Qualaquin®(quinine sulfate)[package insert]. Philadelphia, Pennsylvania: Mutual Pharmaceutical Company, Inc.; 2014. [Link]
PMID: 16997559
Quinine
Product: BMS-911543
Identifier : DBSNPE003207
Drug : DB00468 (Quinine)
Interacting Gene/Enzyme : Glucose-6-phosphate 1-dehydrogenase
Gene Name : G6PD
UniProt ID : P11413
Allele Name : Cassano
Genotype(s) : Not Available
Type(s) : ADR Inferred
Groups : G6PD deficiency
Description : Increased risk of hemolysis.
References :
- Qualaquin®(quinine sulfate)[package insert]. Philadelphia, Pennsylvania: Mutual Pharmaceutical Company, Inc.; 2014. [Link]
PMID: 16236504
Quinine
Product: Fabomotizole
Identifier : DBSNPE003208
Drug : DB00468 (Quinine)
Interacting Gene/Enzyme : Glucose-6-phosphate 1-dehydrogenase
Gene Name : G6PD
UniProt ID : P11413
Allele Name : Hermoupolis
Genotype(s) : Not Available
Type(s) : ADR Inferred
Groups : G6PD deficiency
Description : Increased risk of hemolysis.
References :
- Qualaquin®(quinine sulfate)[package insert]. Philadelphia, Pennsylvania: Mutual Pharmaceutical Company, Inc.; 2014. [Link]
PMID: 26101953
Quinine
Product: Losmapimod
Identifier : DBSNPE003209
Drug : DB00468 (Quinine)
Interacting Gene/Enzyme : Glucose-6-phosphate 1-dehydrogenase
Gene Name : G6PD
UniProt ID : P11413
Allele Name : Union,Maewo, Chinese-2, Kalo
Genotype(s) : Not Available
Type(s) : ADR Inferred
Groups : G6PD deficiency
Description : Increased risk of hemolysis.
References :
- Qualaquin®(quinine sulfate)[package insert]. Philadelphia, Pennsylvania: Mutual Pharmaceutical Company, Inc.; 2014. [Link]
PMID: 16397257
Quinine
Product: NSC 23766
Identifier : DBSNPE003210
Drug : DB00468 (Quinine)
Interacting Gene/Enzyme : Glucose-6-phosphate 1-dehydrogenase
Gene Name : G6PD
UniProt ID : P11413
Allele Name : Andalus
Genotype(s) : Not Available
Type(s) : ADR Inferred
Groups : G6PD deficiency
Description : Increased risk of hemolysis.
References :
- Qualaquin®(quinine sulfate)[package insert]. Philadelphia, Pennsylvania: Mutual Pharmaceutical Company, Inc.; 2014. [Link]
PMID: 15194461
Quinine
Product: NSC 23766 (trihydrochloride)
Identifier : DBSNPE003211
Drug : DB00468 (Quinine)
Interacting Gene/Enzyme : Glucose-6-phosphate 1-dehydrogenase
Gene Name : G6PD
UniProt ID : P11413
Allele Name : Cosenza
Genotype(s) : Not Available
Type(s) : ADR Inferred
Groups : G6PD deficiency
Description : Increased risk of hemolysis.
References :
- Qualaquin®(quinine sulfate)[package insert]. Philadelphia, Pennsylvania: Mutual Pharmaceutical Company, Inc.; 2014. [Link]
PMID: 26175947
Quinine
Product: Doxylamine (succinate)
Identifier : DBSNPE003212
Drug : DB00468 (Quinine)
Interacting Gene/Enzyme : Glucose-6-phosphate 1-dehydrogenase
Gene Name : G6PD
UniProt ID : P11413
Allele Name : Canton, Taiwan- Hakka, Gifu-like, Agrigento-like
Genotype(s) : Not Available
Type(s) : ADR Inferred
Groups : G6PD deficiency
Description : Increased risk of hemolysis.
References :
- Qualaquin®(quinine sulfate)[package insert]. Philadelphia, Pennsylvania: Mutual Pharmaceutical Company, Inc.; 2014. [Link]
PMID: 20809973
Quinine
Product: MI 2 (MALT1 inhibitor)
Identifier : DBSNPE003213
Drug : DB00468 (Quinine)
Interacting Gene/Enzyme : Glucose-6-phosphate 1-dehydrogenase
Gene Name : G6PD
UniProt ID : P11413
Allele Name : Flores
Genotype(s) : Not Available
Type(s) : ADR Inferred
Groups : G6PD deficiency
Description : Increased risk of hemolysis.
References :
- Qualaquin®(quinine sulfate)[package insert]. Philadelphia, Pennsylvania: Mutual Pharmaceutical Company, Inc.; 2014. [Link]
PMID: 16687566
Quinine
Product: CID 16020046
Identifier : DBSNPE003214
Drug : DB00468 (Quinine)
Interacting Gene/Enzyme : Glucose-6-phosphate 1-dehydrogenase
Gene Name : G6PD
UniProt ID : P11413
Allele Name : Kaiping, Anant, Dhon, Sapporo-like, Wosera
Genotype(s) : Not Available
Type(s) : ADR Inferred
Groups : G6PD deficiency
Description : Increased risk of hemolysis.
References :
- Qualaquin®(quinine sulfate)[package insert]. Philadelphia, Pennsylvania: Mutual Pharmaceutical Company, Inc.; 2014. [Link]
PMID: 16439676
Quinine
Product: SN 2
Identifier : DBSNPE003215
Drug : DB00468 (Quinine)
Interacting Gene/Enzyme : Glucose-6-phosphate 1-dehydrogenase
Gene Name : G6PD
UniProt ID : P11413
Allele Name : Kamogawa
Genotype(s) : Not Available
Type(s) : ADR Inferred
Groups : G6PD deficiency
Description : Increased risk of hemolysis.
References :
- Qualaquin®(quinine sulfate)[package insert]. Philadelphia, Pennsylvania: Mutual Pharmaceutical Company, Inc.; 2014. [Link]
PMID: 19478133
Quinine
Product: RU-SKI 43
Identifier : DBSNPE003216
Drug : DB00468 (Quinine)
Interacting Gene/Enzyme : Glucose-6-phosphate 1-dehydrogenase
Gene Name : G6PD
UniProt ID : P11413
Allele Name : Costanzo
Genotype(s) : Not Available
Type(s) : ADR Inferred
Groups : G6PD deficiency
Description : Increased risk of hemolysis.
References :
- Qualaquin®(quinine sulfate)[package insert]. Philadelphia, Pennsylvania: Mutual Pharmaceutical Company, Inc.; 2014. [Link]
PMID: 22189654
Quinine
Product: MIM1
Identifier : DBSNPE003217
Drug : DB00468 (Quinine)
Interacting Gene/Enzyme : Glucose-6-phosphate 1-dehydrogenase
Gene Name : G6PD
UniProt ID : P11413
Allele Name : Amazonia
Genotype(s) : Not Available
Type(s) : ADR Inferred
Groups : G6PD deficiency
Description : Increased risk of hemolysis.
References :
- Qualaquin®(quinine sulfate)[package insert]. Philadelphia, Pennsylvania: Mutual Pharmaceutical Company, Inc.; 2014. [Link]
PMID: 17322026
Quinine
Product: BAMB-4
Identifier : DBSNPE003218
Drug : DB00468 (Quinine)
Interacting Gene/Enzyme : Glucose-6-phosphate 1-dehydrogenase
Gene Name : G6PD
UniProt ID : P11413
Allele Name : Songklanagarind
Genotype(s) : Not Available
Type(s) : ADR Inferred
Groups : G6PD deficiency
Description : Increased risk of hemolysis.
References :
- Qualaquin®(quinine sulfate)[package insert]. Philadelphia, Pennsylvania: Mutual Pharmaceutical Company, Inc.; 2014. [Link]
PMID: 12824047
Quinine
Product: LDN-27219
Identifier : DBSNPE003219
Drug : DB00468 (Quinine)
Interacting Gene/Enzyme : Glucose-6-phosphate 1-dehydrogenase
Gene Name : G6PD
UniProt ID : P11413
Allele Name : Hechi
Genotype(s) : Not Available
Type(s) : ADR Inferred
Groups : G6PD deficiency
Description : Increased risk of hemolysis.
References :
- Qualaquin®(quinine sulfate)[package insert]. Philadelphia, Pennsylvania: Mutual Pharmaceutical Company, Inc.; 2014. [Link]
PMID: 11872748
Quinine
Product: ISO-1
Identifier : DBSNPE003220
Drug : DB00468 (Quinine)
Interacting Gene/Enzyme : Glucose-6-phosphate 1-dehydrogenase
Gene Name : G6PD
UniProt ID : P11413
Allele Name : Namouru
Genotype(s) : Not Available
Type(s) : ADR Inferred
Groups : G6PD deficiency
Description : Increased risk of hemolysis.
References :
- Qualaquin®(quinine sulfate)[package insert]. Philadelphia, Pennsylvania: Mutual Pharmaceutical Company, Inc.; 2014. [Link]
PMID: 15997236
Quinine
Product: AK-7
Identifier : DBSNPE003221
Drug : DB00468 (Quinine)
Interacting Gene/Enzyme : Glucose-6-phosphate 1-dehydrogenase
Gene Name : G6PD
UniProt ID : P11413
Allele Name : Bao Loc
Genotype(s) : Not Available
Type(s) : ADR Inferred
Groups : G6PD deficiency
Description : Increased risk of hemolysis.
References :
- Qualaquin®(quinine sulfate)[package insert]. Philadelphia, Pennsylvania: Mutual Pharmaceutical Company, Inc.; 2014. [Link]
PMID: 12813046
Quinine
Product: BTS
Identifier : DBSNPE003222
Drug : DB00468 (Quinine)
Interacting Gene/Enzyme : Glucose-6-phosphate 1-dehydrogenase
Gene Name : G6PD
UniProt ID : P11413
Defining Change(s) :
- 375G->T, 379G->T383T->C384C>T
Allele Name : Crispim
Genotype(s) : Not Available
Type(s) : ADR Inferred
Groups : G6PD deficiency
Description : Increased risk of hemolysis.
References :
- Qualaquin®(quinine sulfate)[package insert]. Philadelphia, Pennsylvania: Mutual Pharmaceutical Company, Inc.; 2014. [Link]
PMID: 25385442
Quinine
Product: Vidofludimus
Identifier : DBSNPE003223
Drug : DB00468 (Quinine)
Interacting Gene/Enzyme : Glucose-6-phosphate 1-dehydrogenase
Gene Name : G6PD
UniProt ID : P11413
Allele Name : Acrokorinthos
Genotype(s) : Not Available
Type(s) : ADR Inferred
Groups : G6PD deficiency
Description : Increased risk of hemolysis.
References :
- Qualaquin®(quinine sulfate)[package insert]. Philadelphia, Pennsylvania: Mutual Pharmaceutical Company, Inc.; 2014. [Link]
PMID: 16517756
Quinine
Product: Aurothioglucose
Identifier : DBSNPE003224
Drug : DB00468 (Quinine)
Interacting Gene/Enzyme : Glucose-6-phosphate 1-dehydrogenase
Gene Name : G6PD
UniProt ID : P11413
Allele Name : Santa Maria
Genotype(s) : Not Available
Type(s) : ADR Inferred
Groups : G6PD deficiency
Description : Increased risk of hemolysis.
References :
- Qualaquin®(quinine sulfate)[package insert]. Philadelphia, Pennsylvania: Mutual Pharmaceutical Company, Inc.; 2014. [Link]
PMID: 16002568
Quinine
Product: VU 0240551
Identifier : DBSNPE003225
Drug : DB00468 (Quinine)
Interacting Gene/Enzyme : Glucose-6-phosphate 1-dehydrogenase
Gene Name : G6PD
UniProt ID : P11413
Allele Name : Ananindeua
Genotype(s) : Not Available
Type(s) : ADR Inferred
Groups : G6PD deficiency
Description : Increased risk of hemolysis.
References :
- Qualaquin®(quinine sulfate)[package insert]. Philadelphia, Pennsylvania: Mutual Pharmaceutical Company, Inc.; 2014. [Link]
PMID: 15316093
Quinine
Product: RU 24969
Identifier : DBSNPE003226
Drug : DB00468 (Quinine)
Interacting Gene/Enzyme : Glucose-6-phosphate 1-dehydrogenase
Gene Name : G6PD
UniProt ID : P11413
Allele Name : Vanua Lava
Genotype(s) : Not Available
Type(s) : ADR Inferred
Groups : G6PD deficiency
Description : Increased risk of hemolysis.
References :
- Qualaquin®(quinine sulfate)[package insert]. Philadelphia, Pennsylvania: Mutual Pharmaceutical Company, Inc.; 2014. [Link]
PMID: 28378740
Quinine
Product: Eltoprazine (hydrochloride)
Identifier : DBSNPE003227
Drug : DB00468 (Quinine)
Interacting Gene/Enzyme : Glucose-6-phosphate 1-dehydrogenase
Gene Name : G6PD
UniProt ID : P11413
Allele Name : Valladolid
Genotype(s) : Not Available
Type(s) : ADR Inferred
Groups : G6PD deficiency
Description : Increased risk of hemolysis.
References :
- Qualaquin®(quinine sulfate)[package insert]. Philadelphia, Pennsylvania: Mutual Pharmaceutical Company, Inc.; 2014. [Link]
PMID: 27560715
Quinine
Product: Eltoprazine
Identifier : DBSNPE003228
Drug : DB00468 (Quinine)
Interacting Gene/Enzyme : Glucose-6-phosphate 1-dehydrogenase
Gene Name : G6PD
UniProt ID : P11413
Allele Name : Belem
Genotype(s) : Not Available
Type(s) : ADR Inferred
Groups : G6PD deficiency
Description : Increased risk of hemolysis.
References :
- Qualaquin®(quinine sulfate)[package insert]. Philadelphia, Pennsylvania: Mutual Pharmaceutical Company, Inc.; 2014. [Link]
PMID: 25803615
Quinine
Product: α-Tocopherol (phosphate)
Identifier : DBSNPE003229
Drug : DB00468 (Quinine)
Interacting Gene/Enzyme : Glucose-6-phosphate 1-dehydrogenase
Gene Name : G6PD
UniProt ID : P11413
Allele Name : Liuzhou
Genotype(s) : Not Available
Type(s) : ADR Inferred
Groups : G6PD deficiency
Description : Increased risk of hemolysis.
References :
- Qualaquin®(quinine sulfate)[package insert]. Philadelphia, Pennsylvania: Mutual Pharmaceutical Company, Inc.; 2014. [Link]
PMID: 24489934
Quinine
Product: Berberine (chloride)
Identifier : DBSNPE003230
Drug : DB00468 (Quinine)
Interacting Gene/Enzyme : Glucose-6-phosphate 1-dehydrogenase
Gene Name : G6PD
UniProt ID : P11413
Allele Name : Shenzen
Genotype(s) : Not Available
Type(s) : ADR Inferred
Groups : G6PD deficiency
Description : Increased risk of hemolysis.
References :
- Qualaquin®(quinine sulfate)[package insert]. Philadelphia, Pennsylvania: Mutual Pharmaceutical Company, Inc.; 2014. [Link]
PMID: 24570002
Quinine
Product: Berberine (chloride hydrate)
Identifier : DBSNPE003231
Drug : DB00468 (Quinine)
Interacting Gene/Enzyme : Glucose-6-phosphate 1-dehydrogenase
Gene Name : G6PD
UniProt ID : P11413
Allele Name : Taipei “Chinese- 3”
Genotype(s) : Not Available
Type(s) : ADR Inferred
Groups : G6PD deficiency
Description : Increased risk of hemolysis.
References :
- Qualaquin®(quinine sulfate)[package insert]. Philadelphia, Pennsylvania: Mutual Pharmaceutical Company, Inc.; 2014. [Link]
PMID: 21850048
Quinine
Product: LDN-212854
Identifier : DBSNPE003232
Drug : DB00468 (Quinine)
Interacting Gene/Enzyme : Glucose-6-phosphate 1-dehydrogenase
Gene Name : G6PD
UniProt ID : P11413
Allele Name : Toledo
Genotype(s) : Not Available
Type(s) : ADR Inferred
Groups : G6PD deficiency
Description : Increased risk of hemolysis.
References :
- Qualaquin®(quinine sulfate)[package insert]. Philadelphia, Pennsylvania: Mutual Pharmaceutical Company, Inc.; 2014. [Link]
PMID: 22899868
Quinine
Product: ML347
Identifier : DBSNPE003233
Drug : DB00468 (Quinine)
Interacting Gene/Enzyme : Glucose-6-phosphate 1-dehydrogenase
Gene Name : G6PD
UniProt ID : P11413
Allele Name : Naone
Genotype(s) : Not Available
Type(s) : ADR Inferred
Groups : G6PD deficiency
Description : Increased risk of hemolysis.
References :
- Qualaquin®(quinine sulfate)[package insert]. Philadelphia, Pennsylvania: Mutual Pharmaceutical Company, Inc.; 2014. [Link]
PMID: 12926553
Quinine
Product: DMH-1
Identifier : DBSNPE003234
Drug : DB00468 (Quinine)
Interacting Gene/Enzyme : Glucose-6-phosphate 1-dehydrogenase
Gene Name : G6PD
UniProt ID : P11413
Allele Name : Nankang
Genotype(s) : Not Available
Type(s) : ADR Inferred
Groups : G6PD deficiency
Description : Increased risk of hemolysis.
References :
- Qualaquin®(quinine sulfate)[package insert]. Philadelphia, Pennsylvania: Mutual Pharmaceutical Company, Inc.; 2014. [Link]
PMID: 8709098
Quinine
Product: TH-237A
Identifier : DBSNPE003235
Drug : DB00468 (Quinine)
Interacting Gene/Enzyme : Glucose-6-phosphate 1-dehydrogenase
Gene Name : G6PD
UniProt ID : P11413
Allele Name : Miaoli
Genotype(s) : Not Available
Type(s) : ADR Inferred
Groups : G6PD deficiency
Description : Increased risk of hemolysis.
References :
- Qualaquin®(quinine sulfate)[package insert]. Philadelphia, Pennsylvania: Mutual Pharmaceutical Company, Inc.; 2014. [Link]
PMID: 20439185
Quinine
Product: CZC-25146 (hydrochloride)
Identifier : DBSNPE003236
Drug : DB00468 (Quinine)
Interacting Gene/Enzyme : Glucose-6-phosphate 1-dehydrogenase
Gene Name : G6PD
UniProt ID : P11413
Allele Name : Mediterranean, Dallas, Panama‚ Sassari, Cagliari, Birmingham
Genotype(s) : Not Available
Type(s) : ADR Inferred
Groups : G6PD deficiency
Description : Increased risk of hemolysis.
References :
- Qualaquin®(quinine sulfate)[package insert]. Philadelphia, Pennsylvania: Mutual Pharmaceutical Company, Inc.; 2014. [Link]
PMID: 11464105
Quinine
Product: CZC-25146
Identifier : DBSNPE003238
Drug : DB00468 (Quinine)
Interacting Gene/Enzyme : Glucose-6-phosphate 1-dehydrogenase
Gene Name : G6PD
UniProt ID : P11413
Allele Name : Nilgiri
Genotype(s) : Not Available
Type(s) : ADR Inferred
Groups : G6PD deficiency
Description : Increased risk of hemolysis.
References :
- Qualaquin®(quinine sulfate)[package insert]. Philadelphia, Pennsylvania: Mutual Pharmaceutical Company, Inc.; 2014. [Link]
PMID: 20558154
Quinine
Product: LY 303511 (hydrochloride)
Identifier : DBSNPE003239
Drug : DB00468 (Quinine)
Interacting Gene/Enzyme : Glucose-6-phosphate 1-dehydrogenase
Gene Name : G6PD
UniProt ID : P11413
Allele Name : Radlowo
Genotype(s) : Not Available
Type(s) : ADR Inferred
Groups : G6PD deficiency
Description : Increased risk of hemolysis.
References :
- Qualaquin®(quinine sulfate)[package insert]. Philadelphia, Pennsylvania: Mutual Pharmaceutical Company, Inc.; 2014. [Link]
PMID: 26337385
Quinine
Product: Canagliflozin (hemihydrate)
Identifier : DBSNPE003240
Drug : DB00468 (Quinine)
Interacting Gene/Enzyme : Glucose-6-phosphate 1-dehydrogenase
Gene Name : G6PD
UniProt ID : P11413
Allele Name : Roubaix
Genotype(s) : Not Available
Type(s) : ADR Inferred
Groups : G6PD deficiency
Description : Increased risk of hemolysis.
References :
- Qualaquin®(quinine sulfate)[package insert]. Philadelphia, Pennsylvania: Mutual Pharmaceutical Company, Inc.; 2014. [Link]
PMID: 11130077
Quinine
Product: AGN 205327
Identifier : DBSNPE003241
Drug : DB00468 (Quinine)
Interacting Gene/Enzyme : Glucose-6-phosphate 1-dehydrogenase
Gene Name : G6PD
UniProt ID : P11413
Allele Name : Haikou
Genotype(s) : Not Available
Type(s) : ADR Inferred
Groups : G6PD deficiency
Description : Increased risk of hemolysis.
References :
- Qualaquin®(quinine sulfate)[package insert]. Philadelphia, Pennsylvania: Mutual Pharmaceutical Company, Inc.; 2014. [Link]
PMID: 9838034
Quinine
Product: AGN 195183
Identifier : DBSNPE003242
Drug : DB00468 (Quinine)
Interacting Gene/Enzyme : Glucose-6-phosphate 1-dehydrogenase
Gene Name : G6PD
UniProt ID : P11413
Allele Name : Chinese-1
Genotype(s) : Not Available
Type(s) : ADR Inferred
Groups : G6PD deficiency
Description : Increased risk of hemolysis.
References :
- Qualaquin®(quinine sulfate)[package insert]. Philadelphia, Pennsylvania: Mutual Pharmaceutical Company, Inc.; 2014. [Link]
PMID: 1662215
Quinine
Product: AGN 205728
Identifier : DBSNPE003243
Drug : DB00468 (Quinine)
Interacting Gene/Enzyme : Glucose-6-phosphate 1-dehydrogenase
Gene Name : G6PD
UniProt ID : P11413
Allele Name : Mizushima
Genotype(s) : Not Available
Type(s) : ADR Inferred
Groups : G6PD deficiency
Description : Increased risk of hemolysis.
References :
- Qualaquin®(quinine sulfate)[package insert]. Philadelphia, Pennsylvania: Mutual Pharmaceutical Company, Inc.; 2014. [Link]
PMID: 9850611
Quinine
Product: AGN 196996
Identifier : DBSNPE003244
Drug : DB00468 (Quinine)
Interacting Gene/Enzyme : Glucose-6-phosphate 1-dehydrogenase
Gene Name : G6PD
UniProt ID : P11413
Allele Name : Osaka
Genotype(s) : Not Available
Type(s) : ADR Inferred
Groups : G6PD deficiency
Description : Increased risk of hemolysis.
References :
- Qualaquin®(quinine sulfate)[package insert]. Philadelphia, Pennsylvania: Mutual Pharmaceutical Company, Inc.; 2014. [Link]
PMID: 8913354
Quinine
Product: AGN 194310
Identifier : DBSNPE003245
Drug : DB00468 (Quinine)
Interacting Gene/Enzyme : Glucose-6-phosphate 1-dehydrogenase
Gene Name : G6PD
UniProt ID : P11413
Allele Name : Viangchan, Jammu
Genotype(s) : Not Available
Type(s) : ADR Inferred
Groups : G6PD deficiency
Description : Increased risk of hemolysis.
References :
- Qualaquin®(quinine sulfate)[package insert]. Philadelphia, Pennsylvania: Mutual Pharmaceutical Company, Inc.; 2014. [Link]
PMID: 6607924
Quinine
Product: INT-777
Identifier : DBSNPE003247
Drug : DB00468 (Quinine)
Interacting Gene/Enzyme : Glucose-6-phosphate 1-dehydrogenase
Gene Name : G6PD
UniProt ID : P11413
Allele Name : Ludhiana
Genotype(s) : Not Available
Type(s) : ADR Inferred
Groups : G6PD deficiency
Description : Increased risk of hemolysis.
References :
- Qualaquin®(quinine sulfate)[package insert]. Philadelphia, Pennsylvania: Mutual Pharmaceutical Company, Inc.; 2014. [Link]
PMID: 9688629
Quinine
Product: Helioxanthin 8-1
Identifier : DBSNPE003248
Drug : DB00468 (Quinine)
Interacting Gene/Enzyme : Glucose-6-phosphate 1-dehydrogenase
Gene Name : G6PD
UniProt ID : P11413
Allele Name : Farroupilha
Genotype(s) : Not Available
Type(s) : ADR Inferred
Groups : G6PD deficiency
Description : Increased risk of hemolysis.
References :
- Qualaquin®(quinine sulfate)[package insert]. Philadelphia, Pennsylvania: Mutual Pharmaceutical Company, Inc.; 2014. [Link]
PMID: 19362242
Quinine
Product: Helioxanthin derivative 5-4-2
Identifier : DBSNPE003249
Drug : DB00468 (Quinine)
Interacting Gene/Enzyme : Glucose-6-phosphate 1-dehydrogenase
Gene Name : G6PD
UniProt ID : P11413
Allele Name : Chinese-5
Genotype(s) : Not Available
Type(s) : ADR Inferred
Groups : G6PD deficiency
Description : Increased risk of hemolysis.
References :
- Qualaquin®(quinine sulfate)[package insert]. Philadelphia, Pennsylvania: Mutual Pharmaceutical Company, Inc.; 2014. [Link]
PMID: 7536162
Quinine
Product: Mofegiline (hydrochloride)
Identifier : DBSNPE003250
Drug : DB00468 (Quinine)
Interacting Gene/Enzyme : Glucose-6-phosphate 1-dehydrogenase
Gene Name : G6PD
UniProt ID : P11413
Allele Name : Rignano
Genotype(s) : Not Available
Type(s) : ADR Inferred
Groups : G6PD deficiency
Description : Increased risk of hemolysis.
References :
- Qualaquin®(quinine sulfate)[package insert]. Philadelphia, Pennsylvania: Mutual Pharmaceutical Company, Inc.; 2014. [Link]
PMID: 7507781
Quinine
Product: 7-Epi-docetaxel
Identifier : DBSNPE003251
Drug : DB00468 (Quinine)
Interacting Gene/Enzyme : Glucose-6-phosphate 1-dehydrogenase
Gene Name : G6PD
UniProt ID : P11413
Allele Name : Orissa
Genotype(s) : Not Available
Type(s) : ADR Inferred
Groups : G6PD deficiency
Description : Increased risk of hemolysis.
References :
- Qualaquin®(quinine sulfate)[package insert]. Philadelphia, Pennsylvania: Mutual Pharmaceutical Company, Inc.; 2014. [Link]
PMID: 16877524
Quinine
Product: 7-Epi-10-oxo-docetaxel
Identifier : DBSNPE003252
Drug : DB00468 (Quinine)
Interacting Gene/Enzyme : Glucose-6-phosphate 1-dehydrogenase
Gene Name : G6PD
UniProt ID : P11413
Allele Name : G6PDNice
Genotype(s) : Not Available
Type(s) : ADR Inferred
Groups : G6PD deficiency
Description : Increased risk of hemolysis.
References :
- Qualaquin®(quinine sulfate)[package insert]. Philadelphia, Pennsylvania: Mutual Pharmaceutical Company, Inc.; 2014. [Link]
PMID: 15845578
Quinine
Product: 10-Oxo Docetaxel
Identifier : DBSNPE003253
Drug : DB00468 (Quinine)
Interacting Gene/Enzyme : Glucose-6-phosphate 1-dehydrogenase
Gene Name : G6PD
UniProt ID : P11413
Allele Name : Kamiube, Keelung
Genotype(s) : Not Available
Type(s) : ADR Inferred
Groups : G6PD deficiency
Description : Increased risk of hemolysis.
References :
- Qualaquin®(quinine sulfate)[package insert]. Philadelphia, Pennsylvania: Mutual Pharmaceutical Company, Inc.; 2014. [Link]
PMID: 7536889
Quinine
Product: PSN632408
Identifier : DBSNPE003254
Drug : DB00468 (Quinine)
Interacting Gene/Enzyme : Glucose-6-phosphate 1-dehydrogenase
Gene Name : G6PD
UniProt ID : P11413
Allele Name : Neapolis
Genotype(s) : Not Available
Type(s) : ADR Inferred
Groups : G6PD deficiency
Description : Increased risk of hemolysis.
References :
- Qualaquin®(quinine sulfate)[package insert]. Philadelphia, Pennsylvania: Mutual Pharmaceutical Company, Inc.; 2014. [Link]
PMID: 26759704
Quinine
Product: T-5224
Identifier : DBSNPE003255
Drug : DB00468 (Quinine)
Interacting Gene/Enzyme : Glucose-6-phosphate 1-dehydrogenase
Gene Name : G6PD
UniProt ID : P11413
Allele Name : Aures
Genotype(s) : Not Available
Type(s) : ADR Inferred
Groups : G6PD deficiency
Description : Increased risk of hemolysis.
References :
- Qualaquin®(quinine sulfate)[package insert]. Philadelphia, Pennsylvania: Mutual Pharmaceutical Company, Inc.; 2014. [Link]
PMID: 10742295
Quinine
Product: AVX 13616
Identifier : DBSNPE003256
Drug : DB00468 (Quinine)
Interacting Gene/Enzyme : Glucose-6-phosphate 1-dehydrogenase
Gene Name : G6PD
UniProt ID : P11413
Allele Name : Split
Genotype(s) : Not Available
Type(s) : ADR Inferred
Groups : G6PD deficiency
Description : Increased risk of hemolysis.
References :
- Qualaquin®(quinine sulfate)[package insert]. Philadelphia, Pennsylvania: Mutual Pharmaceutical Company, Inc.; 2014. [Link]
PMID: 9391161
Quinine
Product: Antitumor Compound 1
Identifier : DBSNPE003257
Drug : DB00468 (Quinine)
Interacting Gene/Enzyme : Glucose-6-phosphate 1-dehydrogenase
Gene Name : G6PD
UniProt ID : P11413
Allele Name : Kambos
Genotype(s) : Not Available
Type(s) : ADR Inferred
Groups : G6PD deficiency
Description : Increased risk of hemolysis.
References :
- Qualaquin®(quinine sulfate)[package insert]. Philadelphia, Pennsylvania: Mutual Pharmaceutical Company, Inc.; 2014. [Link]
PMID: 19374401
Quinine
Product: Talabostat (mesylate)
Identifier : DBSNPE003258
Drug : DB00468 (Quinine)
Interacting Gene/Enzyme : Glucose-6-phosphate 1-dehydrogenase
Gene Name : G6PD
UniProt ID : P11413
Allele Name : Palesdivina
Genotype(s) : Not Available
Type(s) : ADR Inferred
Groups : G6PD deficiency
Description : Increased risk of hemolysis.
References :
- Qualaquin®(quinine sulfate)[package insert]. Philadelphia, Pennsylvania: Mutual Pharmaceutical Company, Inc.; 2014. [Link]
PMID: 16125426
Quinine
Product: CPI-169
Identifier : DBSNPE003259
Drug : DB00468 (Quinine)
Interacting Gene/Enzyme : Glucose-6-phosphate 1-dehydrogenase
Gene Name : G6PD
UniProt ID : P11413
Allele Name : Metaponto
Genotype(s) : Not Available
Type(s) : ADR Inferred
Groups : G6PD deficiency
Description : Increased risk of hemolysis.
References :
- Qualaquin®(quinine sulfate)[package insert]. Philadelphia, Pennsylvania: Mutual Pharmaceutical Company, Inc.; 2014. [Link]
PMID: 12620067
Quinine
Product: Cardiogreen
Identifier : DBSNPE003260
Drug : DB00468 (Quinine)
Interacting Gene/Enzyme : Glucose-6-phosphate 1-dehydrogenase
Gene Name : G6PD
UniProt ID : P11413
Allele Name : Musashino
Genotype(s) : Not Available
Type(s) : ADR Inferred
Groups : G6PD deficiency
Description : Increased risk of hemolysis.
References :
- Qualaquin®(quinine sulfate)[package insert]. Philadelphia, Pennsylvania: Mutual Pharmaceutical Company, Inc.; 2014. [Link]
PMID: 16368897
Quinine
Product: Oxybenzone
Identifier : DBSNPE003261
Drug : DB00468 (Quinine)
Interacting Gene/Enzyme : Glucose-6-phosphate 1-dehydrogenase
Gene Name : G6PD
UniProt ID : P11413
Allele Name : Asahi
Genotype(s) : Not Available
Type(s) : ADR Inferred
Groups : G6PD deficiency
Description : Increased risk of hemolysis.
References :
- Qualaquin®(quinine sulfate)[package insert]. Philadelphia, Pennsylvania: Mutual Pharmaceutical Company, Inc.; 2014. [Link]
PMID: 8872352
Quinine
Product: CFTR(inh)-172
Identifier : DBSNPE003262
Drug : DB00468 (Quinine)
Interacting Gene/Enzyme : Glucose-6-phosphate 1-dehydrogenase
Gene Name : G6PD
UniProt ID : P11413
Allele Name : A- (202), Ferrara I
Genotype(s) : Not Available
Type(s) : ADR Inferred
Groups : G6PD deficiency
Description : Increased risk of hemolysis.
References :
- Qualaquin®(quinine sulfate)[package insert]. Philadelphia, Pennsylvania: Mutual Pharmaceutical Company, Inc.; 2014. [Link]
PMID: 7523409
Quinine
Product: Dafadine-A
Identifier : DBSNPE003263
Drug : DB00468 (Quinine)
Interacting Gene/Enzyme : Glucose-6-phosphate 1-dehydrogenase
Gene Name : G6PD
UniProt ID : P11413
Allele Name : Murcia Oristano
Genotype(s) : Not Available
Type(s) : ADR Inferred
Groups : G6PD deficiency
Description : Increased risk of hemolysis.
References :
- Qualaquin®(quinine sulfate)[package insert]. Philadelphia, Pennsylvania: Mutual Pharmaceutical Company, Inc.; 2014. [Link]
PMID: 8576908
Quinine
Product: Mcl1-IN-1
Identifier : DBSNPE003264
Drug : DB00468 (Quinine)
Interacting Gene/Enzyme : Glucose-6-phosphate 1-dehydrogenase
Gene Name : G6PD
UniProt ID : P11413
Allele Name : Ube Konan
Genotype(s) : Not Available
Type(s) : ADR Inferred
Groups : G6PD deficiency
Description : Increased risk of hemolysis.
References :
- Qualaquin®(quinine sulfate)[package insert]. Philadelphia, Pennsylvania: Mutual Pharmaceutical Company, Inc.; 2014. [Link]
PMID: 8719415
Quinine
Product: Tolazoline
Identifier : DBSNPE003265
Drug : DB00468 (Quinine)
Interacting Gene/Enzyme : Glucose-6-phosphate 1-dehydrogenase
Gene Name : G6PD
UniProt ID : P11413
Allele Name : Lagosanto
Genotype(s) : Not Available
Type(s) : ADR Inferred
Groups : G6PD deficiency
Description : Increased risk of hemolysis.
References :
- Qualaquin®(quinine sulfate)[package insert]. Philadelphia, Pennsylvania: Mutual Pharmaceutical Company, Inc.; 2014. [Link]
PMID: 9283697
Quinine
Product: HLM006474
Identifier : DBSNPE003266
Drug : DB00468 (Quinine)
Interacting Gene/Enzyme : Glucose-6-phosphate 1-dehydrogenase
Gene Name : G6PD
UniProt ID : P11413
Allele Name : Guangzhou
Genotype(s) : Not Available
Type(s) : ADR Inferred
Groups : G6PD deficiency
Description : Increased risk of hemolysis.
References :
- Qualaquin®(quinine sulfate)[package insert]. Philadelphia, Pennsylvania: Mutual Pharmaceutical Company, Inc.; 2014. [Link]
PMID: 7533622
Quinine
Product: 3CAI
Identifier : DBSNPE003267
Drug : DB00468 (Quinine)
Interacting Gene/Enzyme : Glucose-6-phosphate 1-dehydrogenase
Gene Name : G6PD
UniProt ID : P11413
Allele Name : Hammersmith
Genotype(s) : Not Available
Type(s) : ADR Inferred
Groups : G6PD deficiency
Description : Increased risk of hemolysis.
References :
- Qualaquin®(quinine sulfate)[package insert]. Philadelphia, Pennsylvania: Mutual Pharmaceutical Company, Inc.; 2014. [Link]
PMID: 7537678
Quinine
Product: iCRT 14
Identifier : DBSNPE003268
Drug : DB00468 (Quinine)
Interacting Gene/Enzyme : Glucose-6-phosphate 1-dehydrogenase
Gene Name : G6PD
UniProt ID : P11413
Allele Name : Sinnai
Genotype(s) : Not Available
Type(s) : ADR Inferred
Groups : G6PD deficiency
Description : Increased risk of hemolysis.
References :
- Qualaquin®(quinine sulfate)[package insert]. Philadelphia, Pennsylvania: Mutual Pharmaceutical Company, Inc.; 2014. [Link]
PMID: 7525961
Quinine
Product: SJ-172550
Identifier : DBSNPE003269
Drug : DB00468 (Quinine)
Interacting Gene/Enzyme : Glucose-6-phosphate 1-dehydrogenase
Gene Name : G6PD
UniProt ID : P11413
Allele Name : A- (680)
Genotype(s) : Not Available
Type(s) : ADR Inferred
Groups : G6PD deficiency
Description : Increased risk of hemolysis.
References :
- Qualaquin®(quinine sulfate)[package insert]. Philadelphia, Pennsylvania: Mutual Pharmaceutical Company, Inc.; 2014. [Link]
PMID: 24367256
Quinine
Product: ITX3
Identifier : DBSNPE003270
Drug : DB00468 (Quinine)
Interacting Gene/Enzyme : Glucose-6-phosphate 1-dehydrogenase
Gene Name : G6PD
UniProt ID : P11413
Allele Name : A- (968), Betica,Selma, Guantanamo
Genotype(s) : Not Available
Type(s) : ADR Inferred
Groups : G6PD deficiency
Description : Increased risk of hemolysis.
References :
- Qualaquin®(quinine sulfate)[package insert]. Philadelphia, Pennsylvania: Mutual Pharmaceutical Company, Inc.; 2014. [Link]
PMID: 10385257
Quinine
Product: 4E1RCat
Identifier : DBSNPE003271
Drug : DB00468 (Quinine)
Interacting Gene/Enzyme : Glucose-6-phosphate 1-dehydrogenase
Gene Name : G6PD
UniProt ID : P11413
Allele Name : Salerno Pyrgos
Genotype(s) : Not Available
Type(s) : ADR Inferred
Groups : G6PD deficiency
Description : Increased risk of hemolysis.
References :
- Qualaquin®(quinine sulfate)[package insert]. Philadelphia, Pennsylvania: Mutual Pharmaceutical Company, Inc.; 2014. [Link]
PMID: 9030556
Quinine
Product: Oncrasin-1
Identifier : DBSNPE003272
Drug : DB00468 (Quinine)
Interacting Gene/Enzyme : Glucose-6-phosphate 1-dehydrogenase
Gene Name : G6PD
UniProt ID : P11413
Allele Name : Quing Yan
Genotype(s) : Not Available
Type(s) : ADR Inferred
Groups : G6PD deficiency
Description : Increased risk of hemolysis.
References :
- Qualaquin®(quinine sulfate)[package insert]. Philadelphia, Pennsylvania: Mutual Pharmaceutical Company, Inc.; 2014. [Link]
PMID: 9242464
Quinine
Product: Skp2 Inhibitor C1
Identifier : DBSNPE003273
Drug : DB00468 (Quinine)
Interacting Gene/Enzyme : Glucose-6-phosphate 1-dehydrogenase
Gene Name : G6PD
UniProt ID : P11413
Allele Name : Lages
Genotype(s) : Not Available
Type(s) : ADR Inferred
Groups : G6PD deficiency
Description : Increased risk of hemolysis.
References :
- Qualaquin®(quinine sulfate)[package insert]. Philadelphia, Pennsylvania: Mutual Pharmaceutical Company, Inc.; 2014. [Link]
PMID: 23028862
Quinine
Product: Roquinimex
Identifier : DBSNPE003274
Drug : DB00468 (Quinine)
Interacting Gene/Enzyme : Glucose-6-phosphate 1-dehydrogenase
Gene Name : G6PD
UniProt ID : P11413
Allele Name : Ilesha
Genotype(s) : Not Available
Type(s) : ADR Inferred
Groups : G6PD deficiency
Description : Increased risk of hemolysis.
References :
- Qualaquin®(quinine sulfate)[package insert]. Philadelphia, Pennsylvania: Mutual Pharmaceutical Company, Inc.; 2014. [Link]
PMID: 21375526
Quinine
Product: THZ1 (Hydrochloride)
Identifier : DBSNPE003275
Drug : DB00468 (Quinine)
Interacting Gene/Enzyme : Glucose-6-phosphate 1-dehydrogenase
Gene Name : G6PD
UniProt ID : P11413
Allele Name : Mahidol
Genotype(s) : Not Available
Type(s) : ADR Inferred
Groups : G6PD deficiency
Description : Increased risk of hemolysis.
References :
- Qualaquin®(quinine sulfate)[package insert]. Philadelphia, Pennsylvania: Mutual Pharmaceutical Company, Inc.; 2014. [Link]
PMID: 12460901
Quinine
Product: THZ1
Identifier : DBSNPE003276
Drug : DB00468 (Quinine)
Interacting Gene/Enzyme : Glucose-6-phosphate 1-dehydrogenase
Gene Name : G6PD
UniProt ID : P11413
Allele Name : Malaga
Genotype(s) : Not Available
Type(s) : ADR Inferred
Groups : G6PD deficiency
Description : Increased risk of hemolysis.
References :
- Qualaquin®(quinine sulfate)[package insert]. Philadelphia, Pennsylvania: Mutual Pharmaceutical Company, Inc.; 2014. [Link]
PMID: 11507084
Quinine
Product: LY451395
Identifier : DBSNPE003277
Drug : DB00468 (Quinine)
Interacting Gene/Enzyme : Glucose-6-phosphate 1-dehydrogenase
Gene Name : G6PD
UniProt ID : P11413
Allele Name : Sibari
Genotype(s) : Not Available
Type(s) : ADR Inferred
Groups : G6PD deficiency
Description : Increased risk of hemolysis.
References :
- Qualaquin®(quinine sulfate)[package insert]. Philadelphia, Pennsylvania: Mutual Pharmaceutical Company, Inc.; 2014. [Link]
PMID: 9261113
Quinine
Product: KX1-004
Identifier : DBSNPE003278
Drug : DB00468 (Quinine)
Interacting Gene/Enzyme : Glucose-6-phosphate 1-dehydrogenase
Gene Name : G6PD
UniProt ID : P11413
Allele Name : Mexico City
Genotype(s) : Not Available
Type(s) : ADR Inferred
Groups : G6PD deficiency
Description : Increased risk of hemolysis.
References :
- Qualaquin®(quinine sulfate)[package insert]. Philadelphia, Pennsylvania: Mutual Pharmaceutical Company, Inc.; 2014. [Link]
PMID: 25816133
Quinine
Product: AS-252424
Identifier : DBSNPE003279
Drug : DB00468 (Quinine)
Interacting Gene/Enzyme : Glucose-6-phosphate 1-dehydrogenase
Gene Name : G6PD
UniProt ID : P11413
Allele Name : Nanning
Genotype(s) : Not Available
Type(s) : ADR Inferred
Groups : G6PD deficiency
Description : Increased risk of hemolysis.
References :
- Qualaquin®(quinine sulfate)[package insert]. Philadelphia, Pennsylvania: Mutual Pharmaceutical Company, Inc.; 2014. [Link]
PMID: 23404867
Quinine
Product: Pantoprazole
Identifier : DBSNPE003280
Drug : DB00468 (Quinine)
Interacting Gene/Enzyme : Glucose-6-phosphate 1-dehydrogenase
Gene Name : G6PD
UniProt ID : P11413
Allele Name : Seattle, Lodi, Modena, Ferrara II, Athens-like
Genotype(s) : Not Available
Type(s) : ADR Inferred
Groups : G6PD deficiency
Description : Increased risk of hemolysis.
References :
- Qualaquin®(quinine sulfate)[package insert]. Philadelphia, Pennsylvania: Mutual Pharmaceutical Company, Inc.; 2014. [Link]
PMID: 22768179
Quinine
Product: Entecavir
Identifier : DBSNPE003281
Drug : DB00468 (Quinine)
Interacting Gene/Enzyme : Glucose-6-phosphate 1-dehydrogenase
Gene Name : G6PD
UniProt ID : P11413
Allele Name : Bajo Maumere
Genotype(s) : Not Available
Type(s) : ADR Inferred
Groups : G6PD deficiency
Description : Increased risk of hemolysis.
References :
- Qualaquin®(quinine sulfate)[package insert]. Philadelphia, Pennsylvania: Mutual Pharmaceutical Company, Inc.; 2014. [Link]
PMID: 23441730
Quinine
Product: Metoprolol
Identifier : DBSNPE003282
Drug : DB00468 (Quinine)
Interacting Gene/Enzyme : Glucose-6-phosphate 1-dehydrogenase
Gene Name : G6PD
UniProt ID : P11413
Allele Name : Montalbano
Genotype(s) : Not Available
Type(s) : ADR Inferred
Groups : G6PD deficiency
Description : Increased risk of hemolysis.
References :
- Qualaquin®(quinine sulfate)[package insert]. Philadelphia, Pennsylvania: Mutual Pharmaceutical Company, Inc.; 2014. [Link]
PMID: 12176906
Quinine
Product: Metoprolol (Succinate)
Identifier : DBSNPE003283
Drug : DB00468 (Quinine)
Interacting Gene/Enzyme : Glucose-6-phosphate 1-dehydrogenase
Gene Name : G6PD
UniProt ID : P11413
Allele Name : Kalyan-Kerala, Jamnaga, Rohini
Genotype(s) : Not Available
Type(s) : ADR Inferred
Groups : G6PD deficiency
Description : Increased risk of hemolysis.
References :
- Qualaquin®(quinine sulfate)[package insert]. Philadelphia, Pennsylvania: Mutual Pharmaceutical Company, Inc.; 2014. [Link]
PMID: 25257174
Quinine
Product: AP1903
Identifier : DBSNPE003284
Drug : DB00468 (Quinine)
Interacting Gene/Enzyme : Glucose-6-phosphate 1-dehydrogenase
Gene Name : G6PD
UniProt ID : P11413
Allele Name : Gaohe
Genotype(s) : Not Available
Type(s) : ADR Inferred
Groups : G6PD deficiency
Description : Increased risk of hemolysis.
References :
- Qualaquin®(quinine sulfate)[package insert]. Philadelphia, Pennsylvania: Mutual Pharmaceutical Company, Inc.; 2014. [Link]
PMID: 21705340
Quinine
Product: 3CAI
Identifier : DBSNPE003267
Drug : DB00468 (Quinine)
Interacting Gene/Enzyme : Glucose-6-phosphate 1-dehydrogenase
Gene Name : G6PD
UniProt ID : P11413
Allele Name : Hammersmith
Genotype(s) : Not Available
Type(s) : ADR Inferred
Groups : G6PD deficiency
Description : Increased risk of hemolysis.
References :
- Qualaquin®(quinine sulfate)[package insert]. Philadelphia, Pennsylvania: Mutual Pharmaceutical Company, Inc.; 2014. [Link]
PMID: 7537678
Quinine
Product: iCRT 14
Identifier : DBSNPE003268
Drug : DB00468 (Quinine)
Interacting Gene/Enzyme : Glucose-6-phosphate 1-dehydrogenase
Gene Name : G6PD
UniProt ID : P11413
Allele Name : Sinnai
Genotype(s) : Not Available
Type(s) : ADR Inferred
Groups : G6PD deficiency
Description : Increased risk of hemolysis.
References :
- Qualaquin®(quinine sulfate)[package insert]. Philadelphia, Pennsylvania: Mutual Pharmaceutical Company, Inc.; 2014. [Link]
PMID: 7525961
Quinine
Product: SJ-172550
Identifier : DBSNPE003269
Drug : DB00468 (Quinine)
Interacting Gene/Enzyme : Glucose-6-phosphate 1-dehydrogenase
Gene Name : G6PD
UniProt ID : P11413
Allele Name : A- (680)
Genotype(s) : Not Available
Type(s) : ADR Inferred
Groups : G6PD deficiency
Description : Increased risk of hemolysis.
References :
- Qualaquin®(quinine sulfate)[package insert]. Philadelphia, Pennsylvania: Mutual Pharmaceutical Company, Inc.; 2014. [Link]
PMID: 24367256
Quinine
Product: ITX3
Identifier : DBSNPE003270
Drug : DB00468 (Quinine)
Interacting Gene/Enzyme : Glucose-6-phosphate 1-dehydrogenase
Gene Name : G6PD
UniProt ID : P11413
Allele Name : A- (968), Betica,Selma, Guantanamo
Genotype(s) : Not Available
Type(s) : ADR Inferred
Groups : G6PD deficiency
Description : Increased risk of hemolysis.
References :
- Qualaquin®(quinine sulfate)[package insert]. Philadelphia, Pennsylvania: Mutual Pharmaceutical Company, Inc.; 2014. [Link]
PMID: 10385257
Quinine
Product: 4E1RCat
Identifier : DBSNPE003271
Drug : DB00468 (Quinine)
Interacting Gene/Enzyme : Glucose-6-phosphate 1-dehydrogenase
Gene Name : G6PD
UniProt ID : P11413
Allele Name : Salerno Pyrgos
Genotype(s) : Not Available
Type(s) : ADR Inferred
Groups : G6PD deficiency
Description : Increased risk of hemolysis.
References :
- Qualaquin®(quinine sulfate)[package insert]. Philadelphia, Pennsylvania: Mutual Pharmaceutical Company, Inc.; 2014. [Link]
PMID: 9030556
Quinine
Product: Oncrasin-1
Identifier : DBSNPE003272
Drug : DB00468 (Quinine)
Interacting Gene/Enzyme : Glucose-6-phosphate 1-dehydrogenase
Gene Name : G6PD
UniProt ID : P11413
Allele Name : Quing Yan
Genotype(s) : Not Available
Type(s) : ADR Inferred
Groups : G6PD deficiency
Description : Increased risk of hemolysis.
References :
- Qualaquin®(quinine sulfate)[package insert]. Philadelphia, Pennsylvania: Mutual Pharmaceutical Company, Inc.; 2014. [Link]
PMID: 9242464
Quinine
Product: Skp2 Inhibitor C1
Identifier : DBSNPE003273
Drug : DB00468 (Quinine)
Interacting Gene/Enzyme : Glucose-6-phosphate 1-dehydrogenase
Gene Name : G6PD
UniProt ID : P11413
Allele Name : Lages
Genotype(s) : Not Available
Type(s) : ADR Inferred
Groups : G6PD deficiency
Description : Increased risk of hemolysis.
References :
- Qualaquin®(quinine sulfate)[package insert]. Philadelphia, Pennsylvania: Mutual Pharmaceutical Company, Inc.; 2014. [Link]
PMID: 23028862
Quinine
Product: Roquinimex
Identifier : DBSNPE003274
Drug : DB00468 (Quinine)
Interacting Gene/Enzyme : Glucose-6-phosphate 1-dehydrogenase
Gene Name : G6PD
UniProt ID : P11413
Allele Name : Ilesha
Genotype(s) : Not Available
Type(s) : ADR Inferred
Groups : G6PD deficiency
Description : Increased risk of hemolysis.
References :
- Qualaquin®(quinine sulfate)[package insert]. Philadelphia, Pennsylvania: Mutual Pharmaceutical Company, Inc.; 2014. [Link]
PMID: 21375526
Quinine
Product: THZ1 (Hydrochloride)
Identifier : DBSNPE003275
Drug : DB00468 (Quinine)
Interacting Gene/Enzyme : Glucose-6-phosphate 1-dehydrogenase
Gene Name : G6PD
UniProt ID : P11413
Allele Name : Mahidol
Genotype(s) : Not Available
Type(s) : ADR Inferred
Groups : G6PD deficiency
Description : Increased risk of hemolysis.
References :
- Qualaquin®(quinine sulfate)[package insert]. Philadelphia, Pennsylvania: Mutual Pharmaceutical Company, Inc.; 2014. [Link]
PMID: 12460901
Quinine
Product: THZ1
Identifier : DBSNPE003276
Drug : DB00468 (Quinine)
Interacting Gene/Enzyme : Glucose-6-phosphate 1-dehydrogenase
Gene Name : G6PD
UniProt ID : P11413
Allele Name : Malaga
Genotype(s) : Not Available
Type(s) : ADR Inferred
Groups : G6PD deficiency
Description : Increased risk of hemolysis.
References :
- Qualaquin®(quinine sulfate)[package insert]. Philadelphia, Pennsylvania: Mutual Pharmaceutical Company, Inc.; 2014. [Link]
PMID: 11507084
Quinine
Product: LY451395
Identifier : DBSNPE003277
Drug : DB00468 (Quinine)
Interacting Gene/Enzyme : Glucose-6-phosphate 1-dehydrogenase
Gene Name : G6PD
UniProt ID : P11413
Allele Name : Sibari
Genotype(s) : Not Available
Type(s) : ADR Inferred
Groups : G6PD deficiency
Description : Increased risk of hemolysis.
References :
- Qualaquin®(quinine sulfate)[package insert]. Philadelphia, Pennsylvania: Mutual Pharmaceutical Company, Inc.; 2014. [Link]
PMID: 9261113
Quinine
Product: KX1-004
Identifier : DBSNPE003278
Drug : DB00468 (Quinine)
Interacting Gene/Enzyme : Glucose-6-phosphate 1-dehydrogenase
Gene Name : G6PD
UniProt ID : P11413
Allele Name : Mexico City
Genotype(s) : Not Available
Type(s) : ADR Inferred
Groups : G6PD deficiency
Description : Increased risk of hemolysis.
References :
- Qualaquin®(quinine sulfate)[package insert]. Philadelphia, Pennsylvania: Mutual Pharmaceutical Company, Inc.; 2014. [Link]
PMID: 25816133
Quinine
Product: AS-252424
Identifier : DBSNPE003279
Drug : DB00468 (Quinine)
Interacting Gene/Enzyme : Glucose-6-phosphate 1-dehydrogenase
Gene Name : G6PD
UniProt ID : P11413
Allele Name : Nanning
Genotype(s) : Not Available
Type(s) : ADR Inferred
Groups : G6PD deficiency
Description : Increased risk of hemolysis.
References :
- Qualaquin®(quinine sulfate)[package insert]. Philadelphia, Pennsylvania: Mutual Pharmaceutical Company, Inc.; 2014. [Link]
PMID: 23404867
Quinine
Product: Pantoprazole
Identifier : DBSNPE003280
Drug : DB00468 (Quinine)
Interacting Gene/Enzyme : Glucose-6-phosphate 1-dehydrogenase
Gene Name : G6PD
UniProt ID : P11413
Allele Name : Seattle, Lodi, Modena, Ferrara II, Athens-like
Genotype(s) : Not Available
Type(s) : ADR Inferred
Groups : G6PD deficiency
Description : Increased risk of hemolysis.
References :
- Qualaquin®(quinine sulfate)[package insert]. Philadelphia, Pennsylvania: Mutual Pharmaceutical Company, Inc.; 2014. [Link]
PMID: 22768179
Quinine
Product: Entecavir
Identifier : DBSNPE003281
Drug : DB00468 (Quinine)
Interacting Gene/Enzyme : Glucose-6-phosphate 1-dehydrogenase
Gene Name : G6PD
UniProt ID : P11413
Allele Name : Bajo Maumere
Genotype(s) : Not Available
Type(s) : ADR Inferred
Groups : G6PD deficiency
Description : Increased risk of hemolysis.
References :
- Qualaquin®(quinine sulfate)[package insert]. Philadelphia, Pennsylvania: Mutual Pharmaceutical Company, Inc.; 2014. [Link]
PMID: 23441730
Quinine
Product: Metoprolol
Identifier : DBSNPE003282
Drug : DB00468 (Quinine)
Interacting Gene/Enzyme : Glucose-6-phosphate 1-dehydrogenase
Gene Name : G6PD
UniProt ID : P11413
Allele Name : Montalbano
Genotype(s) : Not Available
Type(s) : ADR Inferred
Groups : G6PD deficiency
Description : Increased risk of hemolysis.
References :
- Qualaquin®(quinine sulfate)[package insert]. Philadelphia, Pennsylvania: Mutual Pharmaceutical Company, Inc.; 2014. [Link]
PMID: 12176906
Quinine
Product: Metoprolol (Succinate)
Identifier : DBSNPE003283
Drug : DB00468 (Quinine)
Interacting Gene/Enzyme : Glucose-6-phosphate 1-dehydrogenase
Gene Name : G6PD
UniProt ID : P11413
Allele Name : Kalyan-Kerala, Jamnaga, Rohini
Genotype(s) : Not Available
Type(s) : ADR Inferred
Groups : G6PD deficiency
Description : Increased risk of hemolysis.
References :
- Qualaquin®(quinine sulfate)[package insert]. Philadelphia, Pennsylvania: Mutual Pharmaceutical Company, Inc.; 2014. [Link]
PMID: 25257174
Quinine
Product: AP1903
Identifier : DBSNPE003284
Drug : DB00468 (Quinine)
Interacting Gene/Enzyme : Glucose-6-phosphate 1-dehydrogenase
Gene Name : G6PD
UniProt ID : P11413
Allele Name : Gaohe
Genotype(s) : Not Available
Type(s) : ADR Inferred
Groups : G6PD deficiency
Description : Increased risk of hemolysis.
References :
- Qualaquin®(quinine sulfate)[package insert]. Philadelphia, Pennsylvania: Mutual Pharmaceutical Company, Inc.; 2014. [Link]
PMID: 21705340