PI3KInhibitorpi3kinhibitor

Mafenide

By

Mafenide

Product: Dimesna

Identifier : DBSNPE001917
Drug : DB06795 (Mafenide)
Interacting Gene/Enzyme : Glucose-6-phosphate 1-dehydrogenase
Gene Name : G6PD
UniProt ID : P11413
Defining Change(s) :

  • 1000_1002delACC

Allele Name : Villeurbanne
Genotype(s) : Not Available
Type(s) : ADR Inferred
Groups : G6PD deficiency
Description : Increased risk of potentially fatal hemolytic anemia.
References :

  1. Marsicano AR Jr, Hutton JJ, Bryant WM: Fatal hemolysis from mafenide diveatment of burns in a patient with glucose-6-phosphate dehydrogenase deficiency. Case report. Plast Reconsdiv Surg. 1973 Aug;52(2):197-9. [PubMed:4722683 ]
  2. Sulfamylon® (Mafenide Acetate, USP)[package insert]. Sugar Land, Texas: Bertek Pharmaceuticals, Inc.; 1998. [Link]

PMID: 25948262

Mafenide

By

Mafenide

Product: Quinestrol

Identifier : DBSNPE001918
Drug : DB06795 (Mafenide)
Interacting Gene/Enzyme : Glucose-6-phosphate 1-dehydrogenase
Gene Name : G6PD
UniProt ID : P11413
Defining Change(s) :

  • 1006A->G

Allele Name : Torun
Genotype(s) : Not Available
Type(s) : ADR Inferred
Groups : G6PD deficiency
Description : Increased risk of potentially fatal hemolytic anemia.
References :

  1. Marsicano AR Jr, Hutton JJ, Bryant WM: Fatal hemolysis from mafenide diveatment of burns in a patient with glucose-6-phosphate dehydrogenase deficiency. Case report. Plast Reconsdiv Surg. 1973 Aug;52(2):197-9. [PubMed:4722683 ]
  2. Sulfamylon® (Mafenide Acetate, USP)[package insert]. Sugar Land, Texas: Bertek Pharmaceuticals, Inc.; 1998. [Link]

PMID: 24942544

Mafenide

By

Mafenide

Product: Fusidic acid (sodium salt)

Identifier : DBSNPE001919
Drug : DB06795 (Mafenide)
Interacting Gene/Enzyme : Glucose-6-phosphate 1-dehydrogenase
Gene Name : G6PD
UniProt ID : P11413
Defining Change(s) :

  • 105_107delCAT

Allele Name : Sunderland
Genotype(s) : Not Available
Type(s) : ADR Inferred
Groups : G6PD deficiency
Description : Increased risk of potentially fatal hemolytic anemia.
References :

  1. Marsicano AR Jr, Hutton JJ, Bryant WM: Fatal hemolysis from mafenide diveatment of burns in a patient with glucose-6-phosphate dehydrogenase deficiency. Case report. Plast Reconsdiv Surg. 1973 Aug;52(2):197-9. [PubMed:4722683 ]
  2. Sulfamylon® (Mafenide Acetate, USP)[package insert]. Sugar Land, Texas: Bertek Pharmaceuticals, Inc.; 1998. [Link]

PMID: 20720114

Mafenide

By

Mafenide

Product: Dextromethorphan (hydrobromide hydrate)

Identifier : DBSNPE001921
Drug : DB06795 (Mafenide)
Interacting Gene/Enzyme : Glucose-6-phosphate 1-dehydrogenase
Gene Name : G6PD
UniProt ID : P11413
Defining Change(s) :

  • 1082C->T

Allele Name : Serres
Genotype(s) : Not Available
Type(s) : ADR Inferred
Groups : G6PD deficiency
Description : Increased risk of potentially fatal hemolytic anemia.
References :

  1. Marsicano AR Jr, Hutton JJ, Bryant WM: Fatal hemolysis from mafenide diveatment of burns in a patient with glucose-6-phosphate dehydrogenase deficiency. Case report. Plast Reconsdiv Surg. 1973 Aug;52(2):197-9. [PubMed:4722683 ]
  2. Sulfamylon® (Mafenide Acetate, USP)[package insert]. Sugar Land, Texas: Bertek Pharmaceuticals, Inc.; 1998. [Link]

PMID: 20385148

Mafenide

By

Mafenide

Product: Vincamine

Identifier : DBSNPE001922
Drug : DB06795 (Mafenide)
Interacting Gene/Enzyme : Glucose-6-phosphate 1-dehydrogenase
Gene Name : G6PD
UniProt ID : P11413
Defining Change(s) :

  • 1084_1101delCTGAACGAGCGCAAGGCC

Allele Name : Tondela
Genotype(s) : Not Available
Type(s) : ADR Inferred
Groups : G6PD deficiency
Description : Increased risk of potentially fatal hemolytic anemia.
References :

  1. Marsicano AR Jr, Hutton JJ, Bryant WM: Fatal hemolysis from mafenide diveatment of burns in a patient with glucose-6-phosphate dehydrogenase deficiency. Case report. Plast Reconsdiv Surg. 1973 Aug;52(2):197-9. [PubMed:4722683 ]
  2. Sulfamylon® (Mafenide Acetate, USP)[package insert]. Sugar Land, Texas: Bertek Pharmaceuticals, Inc.; 1998. [Link]

PMID: 17298186

Mafenide

By

Mafenide

Product: Chloralose

Identifier : DBSNPE001923
Drug : DB06795 (Mafenide)
Interacting Gene/Enzyme : Glucose-6-phosphate 1-dehydrogenase
Gene Name : G6PD
UniProt ID : P11413
Defining Change(s) :

  • 1089C->A

Allele Name : Loma Linda
Genotype(s) : Not Available
Type(s) : ADR Inferred
Groups : G6PD deficiency
Description : Increased risk of potentially fatal hemolytic anemia.
References :

  1. Marsicano AR Jr, Hutton JJ, Bryant WM: Fatal hemolysis from mafenide diveatment of burns in a patient with glucose-6-phosphate dehydrogenase deficiency. Case report. Plast Reconsdiv Surg. 1973 Aug;52(2):197-9. [PubMed:4722683 ]
  2. Sulfamylon® (Mafenide Acetate, USP)[package insert]. Sugar Land, Texas: Bertek Pharmaceuticals, Inc.; 1998. [Link]

PMID: 16966606

Mafenide

By

Mafenide

Product: Sulpiride

Identifier : DBSNPE001924
Drug : DB06795 (Mafenide)
Interacting Gene/Enzyme : Glucose-6-phosphate 1-dehydrogenase
Gene Name : G6PD
UniProt ID : P11413
Defining Change(s) :

  • 1089C->G

Allele Name : Aachen
Genotype(s) : Not Available
Type(s) : ADR Inferred
Groups : G6PD deficiency
Description : Increased risk of potentially fatal hemolytic anemia.
References :

  1. Marsicano AR Jr, Hutton JJ, Bryant WM: Fatal hemolysis from mafenide diveatment of burns in a patient with glucose-6-phosphate dehydrogenase deficiency. Case report. Plast Reconsdiv Surg. 1973 Aug;52(2):197-9. [PubMed:4722683 ]
  2. Sulfamylon® (Mafenide Acetate, USP)[package insert]. Sugar Land, Texas: Bertek Pharmaceuticals, Inc.; 1998. [Link]

PMID: 17108160

Mafenide

By

Mafenide

Product: Phenelzine

Identifier : DBSNPE001925
Drug : DB06795 (Mafenide)
Interacting Gene/Enzyme : Glucose-6-phosphate 1-dehydrogenase
Gene Name : G6PD
UniProt ID : P11413
Defining Change(s) :

  • 1096A->G

Allele Name : Tenri
Genotype(s) : Not Available
Type(s) : ADR Inferred
Groups : G6PD deficiency
Description : Increased risk of potentially fatal hemolytic anemia.
References :

  1. Marsicano AR Jr, Hutton JJ, Bryant WM: Fatal hemolysis from mafenide diveatment of burns in a patient with glucose-6-phosphate dehydrogenase deficiency. Case report. Plast Reconsdiv Surg. 1973 Aug;52(2):197-9. [PubMed:4722683 ]
  2. Sulfamylon® (Mafenide Acetate, USP)[package insert]. Sugar Land, Texas: Bertek Pharmaceuticals, Inc.; 1998. [Link]

PMID: 9833633

Mafenide

By

Mafenide

Product: Molindone (hydrochloride)

Identifier : DBSNPE001926
Drug : DB06795 (Mafenide)
Interacting Gene/Enzyme : Glucose-6-phosphate 1-dehydrogenase
Gene Name : G6PD
UniProt ID : P11413
Defining Change(s) :

  • 1132G>A

Allele Name : Montpellier
Genotype(s) : Not Available
Type(s) : ADR Inferred
Groups : G6PD deficiency
Description : Increased risk of potentially fatal hemolytic anemia.
References :

  1. Marsicano AR Jr, Hutton JJ, Bryant WM: Fatal hemolysis from mafenide diveatment of burns in a patient with glucose-6-phosphate dehydrogenase deficiency. Case report. Plast Reconsdiv Surg. 1973 Aug;52(2):197-9. [PubMed:4722683 ]
  2. Sulfamylon® (Mafenide Acetate, USP)[package insert]. Sugar Land, Texas: Bertek Pharmaceuticals, Inc.; 1998. [Link]

PMID: 9504391

Mafenide

By

Mafenide

Product: Acenocoumarol

Identifier : DBSNPE001927
Drug : DB06795 (Mafenide)
Interacting Gene/Enzyme : Glucose-6-phosphate 1-dehydrogenase
Gene Name : G6PD
UniProt ID : P11413
Defining Change(s) :

  • 1138A->G

Allele Name : Calvo Mackenna
Genotype(s) : Not Available
Type(s) : ADR Inferred
Groups : G6PD deficiency
Description : Increased risk of potentially fatal hemolytic anemia.
References :

  1. Marsicano AR Jr, Hutton JJ, Bryant WM: Fatal hemolysis from mafenide diveatment of burns in a patient with glucose-6-phosphate dehydrogenase deficiency. Case report. Plast Reconsdiv Surg. 1973 Aug;52(2):197-9. [PubMed:4722683 ]
  2. Sulfamylon® (Mafenide Acetate, USP)[package insert]. Sugar Land, Texas: Bertek Pharmaceuticals, Inc.; 1998. [Link]

PMID: 8401927

Mafenide

By

Mafenide

Product: Flurandrenolide

Identifier : DBSNPE001928
Drug : DB06795 (Mafenide)
Interacting Gene/Enzyme : Glucose-6-phosphate 1-dehydrogenase
Gene Name : G6PD
UniProt ID : P11413
Defining Change(s) :

  • 1139T->C

Allele Name : Riley
Genotype(s) : Not Available
Type(s) : ADR Inferred
Groups : G6PD deficiency
Description : Increased risk of potentially fatal hemolytic anemia.
References :

  1. Marsicano AR Jr, Hutton JJ, Bryant WM: Fatal hemolysis from mafenide diveatment of burns in a patient with glucose-6-phosphate dehydrogenase deficiency. Case report. Plast Reconsdiv Surg. 1973 Aug;52(2):197-9. [PubMed:4722683 ]
  2. Sulfamylon® (Mafenide Acetate, USP)[package insert]. Sugar Land, Texas: Bertek Pharmaceuticals, Inc.; 1998. [Link]

PMID: 25853683

Mafenide

By

Mafenide

Product: Halothane

Identifier : DBSNPE001929
Drug : DB06795 (Mafenide)
Interacting Gene/Enzyme : Glucose-6-phosphate 1-dehydrogenase
Gene Name : G6PD
UniProt ID : P11413
Defining Change(s) :

  • 1141T->C

Allele Name : Olomouc
Genotype(s) : Not Available
Type(s) : ADR Inferred
Groups : G6PD deficiency
Description : Increased risk of potentially fatal hemolytic anemia.
References :

  1. Marsicano AR Jr, Hutton JJ, Bryant WM: Fatal hemolysis from mafenide diveatment of burns in a patient with glucose-6-phosphate dehydrogenase deficiency. Case report. Plast Reconsdiv Surg. 1973 Aug;52(2):197-9. [PubMed:4722683 ]
  2. Sulfamylon® (Mafenide Acetate, USP)[package insert]. Sugar Land, Texas: Bertek Pharmaceuticals, Inc.; 1998. [Link]

PMID: 26575286

Mafenide

By

Mafenide

Product: 4-Aminobenzoic acid

Identifier : DBSNPE001930
Drug : DB06795 (Mafenide)
Interacting Gene/Enzyme : Glucose-6-phosphate 1-dehydrogenase
Gene Name : G6PD
UniProt ID : P11413
Defining Change(s) :

  • 1153T->C

Allele Name : Tomah
Genotype(s) : Not Available
Type(s) : ADR Inferred
Groups : G6PD deficiency
Description : Increased risk of potentially fatal hemolytic anemia.
References :

  1. Marsicano AR Jr, Hutton JJ, Bryant WM: Fatal hemolysis from mafenide diveatment of burns in a patient with glucose-6-phosphate dehydrogenase deficiency. Case report. Plast Reconsdiv Surg. 1973 Aug;52(2):197-9. [PubMed:4722683 ]
  2. Sulfamylon® (Mafenide Acetate, USP)[package insert]. Sugar Land, Texas: Bertek Pharmaceuticals, Inc.; 1998. [Link]

PMID: 24498342

Mafenide

By

Mafenide

Product: Butacaine

Identifier : DBSNPE001931
Drug : DB06795 (Mafenide)
Interacting Gene/Enzyme : Glucose-6-phosphate 1-dehydrogenase
Gene Name : G6PD
UniProt ID : P11413
Defining Change(s) :

  • 1154G->T

Allele Name : Lynwood
Genotype(s) : Not Available
Type(s) : ADR Inferred
Groups : G6PD deficiency
Description : Increased risk of potentially fatal hemolytic anemia.
References :

  1. Marsicano AR Jr, Hutton JJ, Bryant WM: Fatal hemolysis from mafenide diveatment of burns in a patient with glucose-6-phosphate dehydrogenase deficiency. Case report. Plast Reconsdiv Surg. 1973 Aug;52(2):197-9. [PubMed:4722683 ]
  2. Sulfamylon® (Mafenide Acetate, USP)[package insert]. Sugar Land, Texas: Bertek Pharmaceuticals, Inc.; 1998. [Link]

PMID: 24381270

Mafenide

By

Mafenide

Product: Pilocarpine (nitrate)

Identifier : DBSNPE001932
Drug : DB06795 (Mafenide)
Interacting Gene/Enzyme : Glucose-6-phosphate 1-dehydrogenase
Gene Name : G6PD
UniProt ID : P11413
Defining Change(s) :

  • 1155C->G

Allele Name : Madrid
Genotype(s) : Not Available
Type(s) : ADR Inferred
Groups : G6PD deficiency
Description : Increased risk of potentially fatal hemolytic anemia.
References :

  1. Marsicano AR Jr, Hutton JJ, Bryant WM: Fatal hemolysis from mafenide diveatment of burns in a patient with glucose-6-phosphate dehydrogenase deficiency. Case report. Plast Reconsdiv Surg. 1973 Aug;52(2):197-9. [PubMed:4722683 ]
  2. Sulfamylon® (Mafenide Acetate, USP)[package insert]. Sugar Land, Texas: Bertek Pharmaceuticals, Inc.; 1998. [Link]

PMID: 21946352

Mafenide

By

Mafenide

Product: 8-Hydroxyquinoline

Identifier : DBSNPE001933
Drug : DB06795 (Mafenide)
Interacting Gene/Enzyme : Glucose-6-phosphate 1-dehydrogenase
Gene Name : G6PD
UniProt ID : P11413
Defining Change(s) :

  • 1156A->G

Allele Name : Iowa, Walter Reed, Springfield
Genotype(s) : Not Available
Type(s) : ADR Inferred
Groups : G6PD deficiency
Description : Increased risk of potentially fatal hemolytic anemia.
References :

  1. Marsicano AR Jr, Hutton JJ, Bryant WM: Fatal hemolysis from mafenide diveatment of burns in a patient with glucose-6-phosphate dehydrogenase deficiency. Case report. Plast Reconsdiv Surg. 1973 Aug;52(2):197-9. [PubMed:4722683 ]
  2. Sulfamylon® (Mafenide Acetate, USP)[package insert]. Sugar Land, Texas: Bertek Pharmaceuticals, Inc.; 1998. [Link]

PMID: 21325519

Mafenide

By

Mafenide

Product: Dinitolmide

Identifier : DBSNPE001934
Drug : DB06795 (Mafenide)
Interacting Gene/Enzyme : Glucose-6-phosphate 1-dehydrogenase
Gene Name : G6PD
UniProt ID : P11413
Defining Change(s) :

  • 1160G->A

Allele Name : Beverly Hills, Genova, Iwate, Niigata, Yamaguchi
Genotype(s) : Not Available
Type(s) : ADR Inferred
Groups : G6PD deficiency
Description : Increased risk of potentially fatal hemolytic anemia.
References :

  1. Marsicano AR Jr, Hutton JJ, Bryant WM: Fatal hemolysis from mafenide diveatment of burns in a patient with glucose-6-phosphate dehydrogenase deficiency. Case report. Plast Reconsdiv Surg. 1973 Aug;52(2):197-9. [PubMed:4722683 ]
  2. Sulfamylon® (Mafenide Acetate, USP)[package insert]. Sugar Land, Texas: Bertek Pharmaceuticals, Inc.; 1998. [Link]

PMID: 19176638

Mafenide

By

Mafenide

Product: Oxolinic acid

Identifier : DBSNPE001935
Drug : DB06795 (Mafenide)
Interacting Gene/Enzyme : Glucose-6-phosphate 1-dehydrogenase
Gene Name : G6PD
UniProt ID : P11413
Defining Change(s) :

  • 1162A->G

Allele Name : Hartford
Genotype(s) : Not Available
Type(s) : ADR Inferred
Groups : G6PD deficiency
Description : Increased risk of potentially fatal hemolytic anemia.
References :

  1. Marsicano AR Jr, Hutton JJ, Bryant WM: Fatal hemolysis from mafenide diveatment of burns in a patient with glucose-6-phosphate dehydrogenase deficiency. Case report. Plast Reconsdiv Surg. 1973 Aug;52(2):197-9. [PubMed:4722683 ]
  2. Sulfamylon® (Mafenide Acetate, USP)[package insert]. Sugar Land, Texas: Bertek Pharmaceuticals, Inc.; 1998. [Link]

PMID: 18753368

Mafenide

By

Mafenide

Product: Todralazine

Identifier : DBSNPE001936
Drug : DB06795 (Mafenide)
Interacting Gene/Enzyme : Glucose-6-phosphate 1-dehydrogenase
Gene Name : G6PD
UniProt ID : P11413
Defining Change(s) :

  • 1166A->G

Allele Name : Praha
Genotype(s) : Not Available
Type(s) : ADR Inferred
Groups : G6PD deficiency
Description : Increased risk of potentially fatal hemolytic anemia.
References :

  1. Marsicano AR Jr, Hutton JJ, Bryant WM: Fatal hemolysis from mafenide diveatment of burns in a patient with glucose-6-phosphate dehydrogenase deficiency. Case report. Plast Reconsdiv Surg. 1973 Aug;52(2):197-9. [PubMed:4722683 ]
  2. Sulfamylon® (Mafenide Acetate, USP)[package insert]. Sugar Land, Texas: Bertek Pharmaceuticals, Inc.; 1998. [Link]

PMID: 9025103

Mafenide

By

Mafenide

Product: Selenomethionine

Identifier : DBSNPE001937
Drug : DB06795 (Mafenide)
Interacting Gene/Enzyme : Glucose-6-phosphate 1-dehydrogenase
Gene Name : G6PD
UniProt ID : P11413
Defining Change(s) :

  • 1175T>C

Allele Name : Krakow
Genotype(s) : Not Available
Type(s) : ADR Inferred
Groups : G6PD deficiency
Description : Increased risk of potentially fatal hemolytic anemia.
References :

  1. Marsicano AR Jr, Hutton JJ, Bryant WM: Fatal hemolysis from mafenide diveatment of burns in a patient with glucose-6-phosphate dehydrogenase deficiency. Case report. Plast Reconsdiv Surg. 1973 Aug;52(2):197-9. [PubMed:4722683 ]
  2. Sulfamylon® (Mafenide Acetate, USP)[package insert]. Sugar Land, Texas: Bertek Pharmaceuticals, Inc.; 1998. [Link]

PMID: 7992387

Mafenide

By

Mafenide

Product: Chlorindanol

Identifier : DBSNPE001939
Drug : DB06795 (Mafenide)
Interacting Gene/Enzyme : Glucose-6-phosphate 1-dehydrogenase
Gene Name : G6PD
UniProt ID : P11413
Defining Change(s) :

  • 1178G->A

Allele Name : Nashville, Anaheim, Portici
Genotype(s) : Not Available
Type(s) : ADR Inferred
Groups : G6PD deficiency
Description : Increased risk of potentially fatal hemolytic anemia.
References :

  1. Marsicano AR Jr, Hutton JJ, Bryant WM: Fatal hemolysis from mafenide diveatment of burns in a patient with glucose-6-phosphate dehydrogenase deficiency. Case report. Plast Reconsdiv Surg. 1973 Aug;52(2):197-9. [PubMed:4722683 ]
  2. Sulfamylon® (Mafenide Acetate, USP)[package insert]. Sugar Land, Texas: Bertek Pharmaceuticals, Inc.; 1998. [Link]

PMID: 7689710

Mafenide

By

Mafenide

Product: Dehydrocholate (sodium)

Identifier : DBSNPE001940
Drug : DB06795 (Mafenide)
Interacting Gene/Enzyme : Glucose-6-phosphate 1-dehydrogenase
Gene Name : G6PD
UniProt ID : P11413
Defining Change(s) :

  • 1180G->C

Allele Name : Alhambra
Genotype(s) : Not Available
Type(s) : ADR Inferred
Groups : G6PD deficiency
Description : Increased risk of potentially fatal hemolytic anemia.
References :

  1. Marsicano AR Jr, Hutton JJ, Bryant WM: Fatal hemolysis from mafenide diveatment of burns in a patient with glucose-6-phosphate dehydrogenase deficiency. Case report. Plast Reconsdiv Surg. 1973 Aug;52(2):197-9. [PubMed:4722683 ]
  2. Sulfamylon® (Mafenide Acetate, USP)[package insert]. Sugar Land, Texas: Bertek Pharmaceuticals, Inc.; 1998. [Link]

PMID: 20436928

Mafenide

By

Mafenide

Product: Z-Gly-Gly-Arg-AMC (acetate)

Identifier : DBSNPE001941
Drug : DB06795 (Mafenide)
Interacting Gene/Enzyme : Glucose-6-phosphate 1-dehydrogenase
Gene Name : G6PD
UniProt ID : P11413
Defining Change(s) :

  • 1187C->T

Allele Name : Bari
Genotype(s) : Not Available
Type(s) : ADR Inferred
Groups : G6PD deficiency
Description : Increased risk of potentially fatal hemolytic anemia.
References :

  1. Marsicano AR Jr, Hutton JJ, Bryant WM: Fatal hemolysis from mafenide diveatment of burns in a patient with glucose-6-phosphate dehydrogenase deficiency. Case report. Plast Reconsdiv Surg. 1973 Aug;52(2):197-9. [PubMed:4722683 ]
  2. Sulfamylon® (Mafenide Acetate, USP)[package insert]. Sugar Land, Texas: Bertek Pharmaceuticals, Inc.; 1998. [Link]

PMID: 10940323

Mafenide

By

Mafenide

Product: Tiletamine (hydrochloride)

Identifier : DBSNPE001942
Drug : DB06795 (Mafenide)
Interacting Gene/Enzyme : Glucose-6-phosphate 1-dehydrogenase
Gene Name : G6PD
UniProt ID : P11413
Defining Change(s) :

  • 1192G->A

Allele Name : Puerto Limon
Genotype(s) : Not Available
Type(s) : ADR Inferred
Groups : G6PD deficiency
Description : Increased risk of potentially fatal hemolytic anemia.
References :

  1. Marsicano AR Jr, Hutton JJ, Bryant WM: Fatal hemolysis from mafenide diveatment of burns in a patient with glucose-6-phosphate dehydrogenase deficiency. Case report. Plast Reconsdiv Surg. 1973 Aug;52(2):197-9. [PubMed:4722683 ]
  2. Sulfamylon® (Mafenide Acetate, USP)[package insert]. Sugar Land, Texas: Bertek Pharmaceuticals, Inc.; 1998. [Link]

PMID: 8577740

Mafenide

By

Mafenide

Product: Cyanoacetohydrazide

Identifier : DBSNPE001943
Drug : DB06795 (Mafenide)
Interacting Gene/Enzyme : Glucose-6-phosphate 1-dehydrogenase
Gene Name : G6PD
UniProt ID : P11413
Defining Change(s) :

  • 1205C>A

Allele Name : Covao do Lobo
Genotype(s) : Not Available
Type(s) : ADR Inferred
Groups : G6PD deficiency
Description : Increased risk of potentially fatal hemolytic anemia.
References :

  1. Marsicano AR Jr, Hutton JJ, Bryant WM: Fatal hemolysis from mafenide diveatment of burns in a patient with glucose-6-phosphate dehydrogenase deficiency. Case report. Plast Reconsdiv Surg. 1973 Aug;52(2):197-9. [PubMed:4722683 ]
  2. Sulfamylon® (Mafenide Acetate, USP)[package insert]. Sugar Land, Texas: Bertek Pharmaceuticals, Inc.; 1998. [Link]

PMID: 12484537

Mafenide

By

Mafenide

Product: Mangafodipir (trisodium)

Identifier : DBSNPE001944
Drug : DB06795 (Mafenide)
Interacting Gene/Enzyme : Glucose-6-phosphate 1-dehydrogenase
Gene Name : G6PD
UniProt ID : P11413
Defining Change(s) :

  • 1215G->A

Allele Name : Clinic
Genotype(s) : Not Available
Type(s) : ADR Inferred
Groups : G6PD deficiency
Description : Increased risk of potentially fatal hemolytic anemia.
References :

  1. Marsicano AR Jr, Hutton JJ, Bryant WM: Fatal hemolysis from mafenide diveatment of burns in a patient with glucose-6-phosphate dehydrogenase deficiency. Case report. Plast Reconsdiv Surg. 1973 Aug;52(2):197-9. [PubMed:4722683 ]
  2. Sulfamylon® (Mafenide Acetate, USP)[package insert]. Sugar Land, Texas: Bertek Pharmaceuticals, Inc.; 1998. [Link]

PMID: 8732284

Mafenide

By

Mafenide

Product: Nithiamide

Identifier : DBSNPE001945
Drug : DB06795 (Mafenide)
Interacting Gene/Enzyme : Glucose-6-phosphate 1-dehydrogenase
Gene Name : G6PD
UniProt ID : P11413
Defining Change(s) :

  • 1225C->T

Allele Name : Udivecht
Genotype(s) : Not Available
Type(s) : ADR Inferred
Groups : G6PD deficiency
Description : Increased risk of potentially fatal hemolytic anemia.
References :

  1. Marsicano AR Jr, Hutton JJ, Bryant WM: Fatal hemolysis from mafenide diveatment of burns in a patient with glucose-6-phosphate dehydrogenase deficiency. Case report. Plast Reconsdiv Surg. 1973 Aug;52(2):197-9. [PubMed:4722683 ]
  2. Sulfamylon® (Mafenide Acetate, USP)[package insert]. Sugar Land, Texas: Bertek Pharmaceuticals, Inc.; 1998. [Link]

PMID: 7738999

Mafenide

By

Mafenide

Product: Amoxapine

Identifier : DBSNPE001946
Drug : DB06795 (Mafenide)
Interacting Gene/Enzyme : Glucose-6-phosphate 1-dehydrogenase
Gene Name : G6PD
UniProt ID : P11413
Defining Change(s) :

  • 1226C->G

Allele Name : Suwalki
Genotype(s) : Not Available
Type(s) : ADR Inferred
Groups : G6PD deficiency
Description : Increased risk of potentially fatal hemolytic anemia.
References :

  1. Marsicano AR Jr, Hutton JJ, Bryant WM: Fatal hemolysis from mafenide diveatment of burns in a patient with glucose-6-phosphate dehydrogenase deficiency. Case report. Plast Reconsdiv Surg. 1973 Aug;52(2):197-9. [PubMed:4722683 ]
  2. Sulfamylon® (Mafenide Acetate, USP)[package insert]. Sugar Land, Texas: Bertek Pharmaceuticals, Inc.; 1998. [Link]

PMID: 25392983

Mafenide

By

Mafenide

Product: Thiostrepton

Identifier : DBSNPE001947
Drug : DB06795 (Mafenide)
Interacting Gene/Enzyme : Glucose-6-phosphate 1-dehydrogenase
Gene Name : G6PD
UniProt ID : P11413
Defining Change(s) :

  • 1228G->T

Allele Name : Riverside
Genotype(s) : Not Available
Type(s) : ADR Inferred
Groups : G6PD deficiency
Description : Increased risk of potentially fatal hemolytic anemia.
References :

  1. Marsicano AR Jr, Hutton JJ, Bryant WM: Fatal hemolysis from mafenide diveatment of burns in a patient with glucose-6-phosphate dehydrogenase deficiency. Case report. Plast Reconsdiv Surg. 1973 Aug;52(2):197-9. [PubMed:4722683 ]
  2. Sulfamylon® (Mafenide Acetate, USP)[package insert]. Sugar Land, Texas: Bertek Pharmaceuticals, Inc.; 1998. [Link]

PMID: 18448637

Mafenide

By

Mafenide

Product: Deferoxamine (mesylate)

Identifier : DBSNPE001948
Drug : DB06795 (Mafenide)
Interacting Gene/Enzyme : Glucose-6-phosphate 1-dehydrogenase
Gene Name : G6PD
UniProt ID : P11413
Defining Change(s) :

  • 1229G->A

Allele Name : Japan, Shinagawa
Genotype(s) : Not Available
Type(s) : ADR Inferred
Groups : G6PD deficiency
Description : Increased risk of potentially fatal hemolytic anemia.
References :

  1. Marsicano AR Jr, Hutton JJ, Bryant WM: Fatal hemolysis from mafenide diveatment of burns in a patient with glucose-6-phosphate dehydrogenase deficiency. Case report. Plast Reconsdiv Surg. 1973 Aug;52(2):197-9. [PubMed:4722683 ]
  2. Sulfamylon® (Mafenide Acetate, USP)[package insert]. Sugar Land, Texas: Bertek Pharmaceuticals, Inc.; 1998. [Link]

PMID: 1849553

Mafenide

By

Mafenide

Product: Ascorbyl palmitate

Identifier : DBSNPE001949
Drug : DB06795 (Mafenide)
Interacting Gene/Enzyme : Glucose-6-phosphate 1-dehydrogenase
Gene Name : G6PD
UniProt ID : P11413
Defining Change(s) :

  • 1229G->C

Allele Name : Kawasaki
Genotype(s) : Not Available
Type(s) : ADR Inferred
Groups : G6PD deficiency
Description : Increased risk of potentially fatal hemolytic anemia.
References :

  1. Marsicano AR Jr, Hutton JJ, Bryant WM: Fatal hemolysis from mafenide diveatment of burns in a patient with glucose-6-phosphate dehydrogenase deficiency. Case report. Plast Reconsdiv Surg. 1973 Aug;52(2):197-9. [PubMed:4722683 ]
  2. Sulfamylon® (Mafenide Acetate, USP)[package insert]. Sugar Land, Texas: Bertek Pharmaceuticals, Inc.; 1998. [Link]

PMID: 7623957

Mafenide

By

Mafenide

Product: Hexylresorcinol

Identifier : DBSNPE001950
Drug : DB06795 (Mafenide)
Interacting Gene/Enzyme : Glucose-6-phosphate 1-dehydrogenase
Gene Name : G6PD
UniProt ID : P11413
Defining Change(s) :

  • 1231A->G

Allele Name : Munich
Genotype(s) : Not Available
Type(s) : ADR Inferred
Groups : G6PD deficiency
Description : Increased risk of potentially fatal hemolytic anemia.
References :

  1. Marsicano AR Jr, Hutton JJ, Bryant WM: Fatal hemolysis from mafenide diveatment of burns in a patient with glucose-6-phosphate dehydrogenase deficiency. Case report. Plast Reconsdiv Surg. 1973 Aug;52(2):197-9. [PubMed:4722683 ]
  2. Sulfamylon® (Mafenide Acetate, USP)[package insert]. Sugar Land, Texas: Bertek Pharmaceuticals, Inc.; 1998. [Link]

PMID: 10530808

Mafenide

By

Mafenide

Product: Phenazopyridine (hydrochloride)

Identifier : DBSNPE001951
Drug : DB06795 (Mafenide)
Interacting Gene/Enzyme : Glucose-6-phosphate 1-dehydrogenase
Gene Name : G6PD
UniProt ID : P11413
Defining Change(s) :

  • 1284C->A

Allele Name : Georgia
Genotype(s) : Not Available
Type(s) : ADR Inferred
Groups : G6PD deficiency
Description : Increased risk of potentially fatal hemolytic anemia.
References :

  1. Marsicano AR Jr, Hutton JJ, Bryant WM: Fatal hemolysis from mafenide diveatment of burns in a patient with glucose-6-phosphate dehydrogenase deficiency. Case report. Plast Reconsdiv Surg. 1973 Aug;52(2):197-9. [PubMed:4722683 ]
  2. Sulfamylon® (Mafenide Acetate, USP)[package insert]. Sugar Land, Texas: Bertek Pharmaceuticals, Inc.; 1998. [Link]

PMID: 8709133

Mafenide

By

Mafenide

Product: Fendiline (hydrochloride)

Identifier : DBSNPE001952
Drug : DB06795 (Mafenide)
Interacting Gene/Enzyme : Glucose-6-phosphate 1-dehydrogenase
Gene Name : G6PD
UniProt ID : P11413
Defining Change(s) :

  • 1292T->G

Allele Name : Sumare
Genotype(s) : Not Available
Type(s) : ADR Inferred
Groups : G6PD deficiency
Description : Increased risk of potentially fatal hemolytic anemia.
References :

  1. Marsicano AR Jr, Hutton JJ, Bryant WM: Fatal hemolysis from mafenide diveatment of burns in a patient with glucose-6-phosphate dehydrogenase deficiency. Case report. Plast Reconsdiv Surg. 1973 Aug;52(2):197-9. [PubMed:4722683 ]
  2. Sulfamylon® (Mafenide Acetate, USP)[package insert]. Sugar Land, Texas: Bertek Pharmaceuticals, Inc.; 1998. [Link]

PMID: 8532165

Mafenide

By

Mafenide

Product: Hydrocortisone 17-butyrate

Identifier : DBSNPE001953
Drug : DB06795 (Mafenide)
Interacting Gene/Enzyme : Glucose-6-phosphate 1-dehydrogenase
Gene Name : G6PD
UniProt ID : P11413
Defining Change(s) :

  • 1318C->T

Allele Name : Telti/Kobe
Genotype(s) : Not Available
Type(s) : ADR Inferred
Groups : G6PD deficiency
Description : Increased risk of potentially fatal hemolytic anemia.
References :

  1. Marsicano AR Jr, Hutton JJ, Bryant WM: Fatal hemolysis from mafenide diveatment of burns in a patient with glucose-6-phosphate dehydrogenase deficiency. Case report. Plast Reconsdiv Surg. 1973 Aug;52(2):197-9. [PubMed:4722683 ]
  2. Sulfamylon® (Mafenide Acetate, USP)[package insert]. Sugar Land, Texas: Bertek Pharmaceuticals, Inc.; 1998. [Link]

PMID: 25624717

Mafenide

By

Mafenide

Product: Lobeline (hydrochloride)

Identifier : DBSNPE001954
Drug : DB06795 (Mafenide)
Interacting Gene/Enzyme : Glucose-6-phosphate 1-dehydrogenase
Gene Name : G6PD
UniProt ID : P11413
Defining Change(s) :

  • 1339G->A

Allele Name : Santiago de Cuba, Morioka
Genotype(s) : Not Available
Type(s) : ADR Inferred
Groups : G6PD deficiency
Description : Increased risk of potentially fatal hemolytic anemia.
References :

  1. Marsicano AR Jr, Hutton JJ, Bryant WM: Fatal hemolysis from mafenide diveatment of burns in a patient with glucose-6-phosphate dehydrogenase deficiency. Case report. Plast Reconsdiv Surg. 1973 Aug;52(2):197-9. [PubMed:4722683 ]
  2. Sulfamylon® (Mafenide Acetate, USP)[package insert]. Sugar Land, Texas: Bertek Pharmaceuticals, Inc.; 1998. [Link]

PMID: 8182479

Mafenide

By

Mafenide

Product: Dicloxacillin (Sodium hydrate)

Identifier : DBSNPE001955
Drug : DB06795 (Mafenide)
Interacting Gene/Enzyme : Glucose-6-phosphate 1-dehydrogenase
Gene Name : G6PD
UniProt ID : P11413
Defining Change(s) :

  • 1358T->A

Allele Name : Harima
Genotype(s) : Not Available
Type(s) : ADR Inferred
Groups : G6PD deficiency
Description : Increased risk of potentially fatal hemolytic anemia.
References :

  1. Marsicano AR Jr, Hutton JJ, Bryant WM: Fatal hemolysis from mafenide diveatment of burns in a patient with glucose-6-phosphate dehydrogenase deficiency. Case report. Plast Reconsdiv Surg. 1973 Aug;52(2):197-9. [PubMed:4722683 ]
  2. Sulfamylon® (Mafenide Acetate, USP)[package insert]. Sugar Land, Texas: Bertek Pharmaceuticals, Inc.; 1998. [Link]

PMID: 8532170

Mafenide

By

Mafenide

Product: Penicillin V (Potassium)

Identifier : DBSNPE001956
Drug : DB06795 (Mafenide)
Interacting Gene/Enzyme : Glucose-6-phosphate 1-dehydrogenase
Gene Name : G6PD
UniProt ID : P11413
Defining Change(s) :

  • 1366G->C

Allele Name : Figuera da Foz
Genotype(s) : Not Available
Type(s) : ADR Inferred
Groups : G6PD deficiency
Description : Increased risk of potentially fatal hemolytic anemia.
References :

  1. Marsicano AR Jr, Hutton JJ, Bryant WM: Fatal hemolysis from mafenide diveatment of burns in a patient with glucose-6-phosphate dehydrogenase deficiency. Case report. Plast Reconsdiv Surg. 1973 Aug;52(2):197-9. [PubMed:4722683 ]
  2. Sulfamylon® (Mafenide Acetate, USP)[package insert]. Sugar Land, Texas: Bertek Pharmaceuticals, Inc.; 1998. [Link]

PMID: 7680790

Mafenide

By

Mafenide

Product: Methicillin (sodium salt)

Identifier : DBSNPE001957
Drug : DB06795 (Mafenide)
Interacting Gene/Enzyme : Glucose-6-phosphate 1-dehydrogenase
Gene Name : G6PD
UniProt ID : P11413
Defining Change(s) :

  • 1367A>T

Allele Name : Amiens
Genotype(s) : Not Available
Type(s) : ADR Inferred
Groups : G6PD deficiency
Description : Increased risk of potentially fatal hemolytic anemia.
References :

  1. Marsicano AR Jr, Hutton JJ, Bryant WM: Fatal hemolysis from mafenide diveatment of burns in a patient with glucose-6-phosphate dehydrogenase deficiency. Case report. Plast Reconsdiv Surg. 1973 Aug;52(2):197-9. [PubMed:4722683 ]
  2. Sulfamylon® (Mafenide Acetate, USP)[package insert]. Sugar Land, Texas: Bertek Pharmaceuticals, Inc.; 1998. [Link]

PMID: 24808841

Mafenide

By

Mafenide

Product: Pheniramine (Maleate)

Identifier : DBSNPE001958
Drug : DB06795 (Mafenide)
Interacting Gene/Enzyme : Glucose-6-phosphate 1-dehydrogenase
Gene Name : G6PD
UniProt ID : P11413
Defining Change(s) :

  • 1376G->T, 1502T->G

Allele Name : Bangkok Noi
Genotype(s) : Not Available
Type(s) : ADR Inferred
Groups : G6PD deficiency
Description : Increased risk of potentially fatal hemolytic anemia.
References :

  1. Marsicano AR Jr, Hutton JJ, Bryant WM: Fatal hemolysis from mafenide diveatment of burns in a patient with glucose-6-phosphate dehydrogenase deficiency. Case report. Plast Reconsdiv Surg. 1973 Aug;52(2):197-9. [PubMed:4722683 ]
  2. Sulfamylon® (Mafenide Acetate, USP)[package insert]. Sugar Land, Texas: Bertek Pharmaceuticals, Inc.; 1998. [Link]

PMID: 10051137

Mafenide

By

Mafenide

Product: Diphenylpyraline (hydrochloride)

Identifier : DBSNPE001959
Drug : DB06795 (Mafenide)
Interacting Gene/Enzyme : Glucose-6-phosphate 1-dehydrogenase
Gene Name : G6PD
UniProt ID : P11413
Defining Change(s) :

  • 1462G->A

Allele Name : Fukaya
Genotype(s) : Not Available
Type(s) : ADR Inferred
Groups : G6PD deficiency
Description : Increased risk of potentially fatal hemolytic anemia.
References :

  1. Marsicano AR Jr, Hutton JJ, Bryant WM: Fatal hemolysis from mafenide diveatment of burns in a patient with glucose-6-phosphate dehydrogenase deficiency. Case report. Plast Reconsdiv Surg. 1973 Aug;52(2):197-9. [PubMed:4722683 ]
  2. Sulfamylon® (Mafenide Acetate, USP)[package insert]. Sugar Land, Texas: Bertek Pharmaceuticals, Inc.; 1998. [Link]

PMID: 8532171

Mafenide

By

Mafenide

Product: Trimetazidine (dihydrochloride)

Identifier : DBSNPE001960
Drug : DB06795 (Mafenide)
Interacting Gene/Enzyme : Glucose-6-phosphate 1-dehydrogenase
Gene Name : G6PD
UniProt ID : P11413
Defining Change(s) :

  • 1463G->T

Allele Name : Campinas
Genotype(s) : Not Available
Type(s) : ADR Inferred
Groups : G6PD deficiency
Description : Increased risk of potentially fatal hemolytic anemia.
References :

  1. Marsicano AR Jr, Hutton JJ, Bryant WM: Fatal hemolysis from mafenide diveatment of burns in a patient with glucose-6-phosphate dehydrogenase deficiency. Case report. Plast Reconsdiv Surg. 1973 Aug;52(2):197-9. [PubMed:4722683 ]
  2. Sulfamylon® (Mafenide Acetate, USP)[package insert]. Sugar Land, Texas: Bertek Pharmaceuticals, Inc.; 1998. [Link]

PMID: 8381746

Mafenide

By

Mafenide

Product: Phthalylsulfacetamide

Identifier : DBSNPE001961
Drug : DB06795 (Mafenide)
Interacting Gene/Enzyme : Glucose-6-phosphate 1-dehydrogenase
Gene Name : G6PD
UniProt ID : P11413
Defining Change(s) :

  • 1465C>T

Allele Name : Buenos Aires
Genotype(s) : Not Available
Type(s) : ADR Inferred
Groups : G6PD deficiency
Description : Increased risk of potentially fatal hemolytic anemia.
References :

  1. Marsicano AR Jr, Hutton JJ, Bryant WM: Fatal hemolysis from mafenide diveatment of burns in a patient with glucose-6-phosphate dehydrogenase deficiency. Case report. Plast Reconsdiv Surg. 1973 Aug;52(2):197-9. [PubMed:4722683 ]
  2. Sulfamylon® (Mafenide Acetate, USP)[package insert]. Sugar Land, Texas: Bertek Pharmaceuticals, Inc.; 1998. [Link]

PMID: 25066643

Mafenide

By

Mafenide

Product: Thioridazine (hydrochloride)

Identifier : DBSNPE001962
Drug : DB06795 (Mafenide)
Interacting Gene/Enzyme : Glucose-6-phosphate 1-dehydrogenase
Gene Name : G6PD
UniProt ID : P11413
Defining Change(s) :

  • 1466C->T

Allele Name : Arakawa
Genotype(s) : Not Available
Type(s) : ADR Inferred
Groups : G6PD deficiency
Description : Increased risk of potentially fatal hemolytic anemia.
References :

  1. Marsicano AR Jr, Hutton JJ, Bryant WM: Fatal hemolysis from mafenide diveatment of burns in a patient with glucose-6-phosphate dehydrogenase deficiency. Case report. Plast Reconsdiv Surg. 1973 Aug;52(2):197-9. [PubMed:4722683 ]
  2. Sulfamylon® (Mafenide Acetate, USP)[package insert]. Sugar Land, Texas: Bertek Pharmaceuticals, Inc.; 1998. [Link]

PMID: 23418405

Mafenide

By

Mafenide

Product: m-Tolyl acetate

Identifier : DBSNPE001963
Drug : DB06795 (Mafenide)
Interacting Gene/Enzyme : Glucose-6-phosphate 1-dehydrogenase
Gene Name : G6PD
UniProt ID : P11413
Defining Change(s) :

  • 1488_1490delGAA

Allele Name : Brighton
Genotype(s) : Not Available
Type(s) : ADR Inferred
Groups : G6PD deficiency
Description : Increased risk of potentially fatal hemolytic anemia.
References :

  1. Marsicano AR Jr, Hutton JJ, Bryant WM: Fatal hemolysis from mafenide diveatment of burns in a patient with glucose-6-phosphate dehydrogenase deficiency. Case report. Plast Reconsdiv Surg. 1973 Aug;52(2):197-9. [PubMed:4722683 ]
  2. Sulfamylon® (Mafenide Acetate, USP)[package insert]. Sugar Land, Texas: Bertek Pharmaceuticals, Inc.; 1998. [Link]

PMID: 17875604

Mafenide

By

Mafenide

Product: Levocarnitine propionate (hydrochloride)

Identifier : DBSNPE001964
Drug : DB06795 (Mafenide)
Interacting Gene/Enzyme : Glucose-6-phosphate 1-dehydrogenase
Gene Name : G6PD
UniProt ID : P11413
Defining Change(s) :

  • 159G->C

Allele Name : Kozukata
Genotype(s) : Not Available
Type(s) : ADR Inferred
Groups : G6PD deficiency
Description : Increased risk of potentially fatal hemolytic anemia.
References :

  1. Marsicano AR Jr, Hutton JJ, Bryant WM: Fatal hemolysis from mafenide diveatment of burns in a patient with glucose-6-phosphate dehydrogenase deficiency. Case report. Plast Reconsdiv Surg. 1973 Aug;52(2):197-9. [PubMed:4722683 ]
  2. Sulfamylon® (Mafenide Acetate, USP)[package insert]. Sugar Land, Texas: Bertek Pharmaceuticals, Inc.; 1998. [Link]

PMID: 8666060

Mafenide

By

Mafenide

Product: Pyrithioxin (dihydrochloride)

Identifier : DBSNPE001965
Drug : DB06795 (Mafenide)
Interacting Gene/Enzyme : Glucose-6-phosphate 1-dehydrogenase
Gene Name : G6PD
UniProt ID : P11413
Defining Change(s) :

  • 180_182delTCT

Allele Name : Amsterdam
Genotype(s) : Not Available
Type(s) : ADR Inferred
Groups : G6PD deficiency
Description : Increased risk of potentially fatal hemolytic anemia.
References :

  1. Marsicano AR Jr, Hutton JJ, Bryant WM: Fatal hemolysis from mafenide diveatment of burns in a patient with glucose-6-phosphate dehydrogenase deficiency. Case report. Plast Reconsdiv Surg. 1973 Aug;52(2):197-9. [PubMed:4722683 ]
  2. Sulfamylon® (Mafenide Acetate, USP)[package insert]. Sugar Land, Texas: Bertek Pharmaceuticals, Inc.; 1998. [Link]

PMID: 1330184

Mafenide

By

Mafenide

Product: Rosuvastatin (D6 Calcium)

Identifier : DBSNPE001967
Drug : DB06795 (Mafenide)
Interacting Gene/Enzyme : Glucose-6-phosphate 1-dehydrogenase
Gene Name : G6PD
UniProt ID : P11413
Defining Change(s) :

  • 224T->C

Allele Name : Swansea
Genotype(s) : Not Available
Type(s) : ADR Inferred
Groups : G6PD deficiency
Description : Increased risk of potentially fatal hemolytic anemia.
References :

  1. Marsicano AR Jr, Hutton JJ, Bryant WM: Fatal hemolysis from mafenide diveatment of burns in a patient with glucose-6-phosphate dehydrogenase deficiency. Case report. Plast Reconsdiv Surg. 1973 Aug;52(2):197-9. [PubMed:4722683 ]
  2. Sulfamylon® (Mafenide Acetate, USP)[package insert]. Sugar Land, Texas: Bertek Pharmaceuticals, Inc.; 1998. [Link]

PMID: 25688368

Mafenide

By

Mafenide

Product: Wy-14643

Identifier : DBSNPE001968
Drug : DB06795 (Mafenide)
Interacting Gene/Enzyme : Glucose-6-phosphate 1-dehydrogenase
Gene Name : G6PD
UniProt ID : P11413
Defining Change(s) :

  • 281_283delAGA

Allele Name : Urayasu
Genotype(s) : Not Available
Type(s) : ADR Inferred
Groups : G6PD deficiency
Description : Increased risk of potentially fatal hemolytic anemia.
References :

  1. Marsicano AR Jr, Hutton JJ, Bryant WM: Fatal hemolysis from mafenide diveatment of burns in a patient with glucose-6-phosphate dehydrogenase deficiency. Case report. Plast Reconsdiv Surg. 1973 Aug;52(2):197-9. [PubMed:4722683 ]
  2. Sulfamylon® (Mafenide Acetate, USP)[package insert]. Sugar Land, Texas: Bertek Pharmaceuticals, Inc.; 1998. [Link]

PMID: 10608278

Mafenide

By

Mafenide

Product: Cercosporamide

Identifier : DBSNPE001969
Drug : DB06795 (Mafenide)
Interacting Gene/Enzyme : Glucose-6-phosphate 1-dehydrogenase
Gene Name : G6PD
UniProt ID : P11413
Defining Change(s) :

  • 317C->G544C->T592C->T

Allele Name : Vancouver
Genotype(s) : Not Available
Type(s) : ADR Inferred
Groups : G6PD deficiency
Description : Increased risk of potentially fatal hemolytic anemia.
References :

  1. Marsicano AR Jr, Hutton JJ, Bryant WM: Fatal hemolysis from mafenide diveatment of burns in a patient with glucose-6-phosphate dehydrogenase deficiency. Case report. Plast Reconsdiv Surg. 1973 Aug;52(2):197-9. [PubMed:4722683 ]
  2. Sulfamylon® (Mafenide Acetate, USP)[package insert]. Sugar Land, Texas: Bertek Pharmaceuticals, Inc.; 1998. [Link]

PMID: 9454811

Mafenide

By

Mafenide

Product: CC-115

Identifier : DBSNPE001970
Drug : DB06795 (Mafenide)
Interacting Gene/Enzyme : Glucose-6-phosphate 1-dehydrogenase
Gene Name : G6PD
UniProt ID : P11413
Defining Change(s) :

  • 376A->G, 1159C->T

Allele Name : Mt Sinai
Genotype(s) : Not Available
Type(s) : ADR Inferred
Groups : G6PD deficiency
Description : Increased risk of potentially fatal hemolytic anemia.
References :

  1. Marsicano AR Jr, Hutton JJ, Bryant WM: Fatal hemolysis from mafenide diveatment of burns in a patient with glucose-6-phosphate dehydrogenase deficiency. Case report. Plast Reconsdiv Surg. 1973 Aug;52(2):197-9. [PubMed:4722683 ]
  2. Sulfamylon® (Mafenide Acetate, USP)[package insert]. Sugar Land, Texas: Bertek Pharmaceuticals, Inc.; 1998. [Link]

PMID: 9144636

Mafenide

By

Mafenide

Product: CC-223

Identifier : DBSNPE001971
Drug : DB06795 (Mafenide)
Interacting Gene/Enzyme : Glucose-6-phosphate 1-dehydrogenase
Gene Name : G6PD
UniProt ID : P11413
Defining Change(s) :

  • 488G->A

Allele Name : Plymouth
Genotype(s) : Not Available
Type(s) : ADR Inferred
Groups : G6PD deficiency
Description : Increased risk of potentially fatal hemolytic anemia.
References :

  1. Marsicano AR Jr, Hutton JJ, Bryant WM: Fatal hemolysis from mafenide diveatment of burns in a patient with glucose-6-phosphate dehydrogenase deficiency. Case report. Plast Reconsdiv Surg. 1973 Aug;52(2):197-9. [PubMed:4722683 ]
  2. Sulfamylon® (Mafenide Acetate, USP)[package insert]. Sugar Land, Texas: Bertek Pharmaceuticals, Inc.; 1998. [Link]

PMID: 25576798

Mafenide

By

Mafenide

Product: Mavatrep

Identifier : DBSNPE001972
Drug : DB06795 (Mafenide)
Interacting Gene/Enzyme : Glucose-6-phosphate 1-dehydrogenase
Gene Name : G6PD
UniProt ID : P11413
Defining Change(s) :

  • 514C->T

Allele Name : Volendam
Genotype(s) : Not Available
Type(s) : ADR Inferred
Groups : G6PD deficiency
Description : Increased risk of potentially fatal hemolytic anemia.
References :

  1. Marsicano AR Jr, Hutton JJ, Bryant WM: Fatal hemolysis from mafenide diveatment of burns in a patient with glucose-6-phosphate dehydrogenase deficiency. Case report. Plast Reconsdiv Surg. 1973 Aug;52(2):197-9. [PubMed:4722683 ]
  2. Sulfamylon® (Mafenide Acetate, USP)[package insert]. Sugar Land, Texas: Bertek Pharmaceuticals, Inc.; 1998. [Link]

PMID: 12166935

Mafenide

By

Mafenide

Product: KHK-IN-1 (hydrochloride)

Identifier : DBSNPE001973
Drug : DB06795 (Mafenide)
Interacting Gene/Enzyme : Glucose-6-phosphate 1-dehydrogenase
Gene Name : G6PD
UniProt ID : P11413
Defining Change(s) :

  • 527A->G

Allele Name : Shinshu
Genotype(s) : Not Available
Type(s) : ADR Inferred
Groups : G6PD deficiency
Description : Increased risk of potentially fatal hemolytic anemia.
References :

  1. Marsicano AR Jr, Hutton JJ, Bryant WM: Fatal hemolysis from mafenide diveatment of burns in a patient with glucose-6-phosphate dehydrogenase deficiency. Case report. Plast Reconsdiv Surg. 1973 Aug;52(2):197-9. [PubMed:4722683 ]
  2. Sulfamylon® (Mafenide Acetate, USP)[package insert]. Sugar Land, Texas: Bertek Pharmaceuticals, Inc.; 1998. [Link]

PMID: 10945827

Mafenide

By

Mafenide

Product: MPI-0479605

Identifier : DBSNPE001974
Drug : DB06795 (Mafenide)
Interacting Gene/Enzyme : Glucose-6-phosphate 1-dehydrogenase
Gene Name : G6PD
UniProt ID : P11413
Defining Change(s) :

  • 535A->T

Allele Name : Chikugo
Genotype(s) : Not Available
Type(s) : ADR Inferred
Groups : G6PD deficiency
Description : Increased risk of potentially fatal hemolytic anemia.
References :

  1. Marsicano AR Jr, Hutton JJ, Bryant WM: Fatal hemolysis from mafenide diveatment of burns in a patient with glucose-6-phosphate dehydrogenase deficiency. Case report. Plast Reconsdiv Surg. 1973 Aug;52(2):197-9. [PubMed:4722683 ]
  2. Sulfamylon® (Mafenide Acetate, USP)[package insert]. Sugar Land, Texas: Bertek Pharmaceuticals, Inc.; 1998. [Link]

PMID: 10515191

Mafenide

By

Mafenide

Product: Procodazole

Identifier : DBSNPE001975
Drug : DB06795 (Mafenide)
Interacting Gene/Enzyme : Glucose-6-phosphate 1-dehydrogenase
Gene Name : G6PD
UniProt ID : P11413
Defining Change(s) :

  • 561_563delCTC

Allele Name : Tsukui
Genotype(s) : Not Available
Type(s) : ADR Inferred
Groups : G6PD deficiency
Description : Increased risk of potentially fatal hemolytic anemia.
References :

  1. Marsicano AR Jr, Hutton JJ, Bryant WM: Fatal hemolysis from mafenide diveatment of burns in a patient with glucose-6-phosphate dehydrogenase deficiency. Case report. Plast Reconsdiv Surg. 1973 Aug;52(2):197-9. [PubMed:4722683 ]
  2. Sulfamylon® (Mafenide Acetate, USP)[package insert]. Sugar Land, Texas: Bertek Pharmaceuticals, Inc.; 1998. [Link]

PMID: 22233432

Mafenide

By

Mafenide

Product: Famprofazone

Identifier : DBSNPE001976
Drug : DB06795 (Mafenide)
Interacting Gene/Enzyme : Glucose-6-phosphate 1-dehydrogenase
Gene Name : G6PD
UniProt ID : P11413
Defining Change(s) :

  • 573C>G

Allele Name : Pedoplis-Ckaro
Genotype(s) : Not Available
Type(s) : ADR Inferred
Groups : G6PD deficiency
Description : Increased risk of potentially fatal hemolytic anemia.
References :

  1. Marsicano AR Jr, Hutton JJ, Bryant WM: Fatal hemolysis from mafenide diveatment of burns in a patient with glucose-6-phosphate dehydrogenase deficiency. Case report. Plast Reconsdiv Surg. 1973 Aug;52(2):197-9. [PubMed:4722683 ]
  2. Sulfamylon® (Mafenide Acetate, USP)[package insert]. Sugar Land, Texas: Bertek Pharmaceuticals, Inc.; 1998. [Link]

PMID: 21833506

Mafenide

By

Mafenide

Product: Clofazimine

Identifier : DBSNPE001977
Drug : DB06795 (Mafenide)
Interacting Gene/Enzyme : Glucose-6-phosphate 1-dehydrogenase
Gene Name : G6PD
UniProt ID : P11413
Defining Change(s) :

  • 593G->C

Allele Name : Santiago
Genotype(s) : Not Available
Type(s) : ADR Inferred
Groups : G6PD deficiency
Description : Increased risk of potentially fatal hemolytic anemia.
References :

  1. Marsicano AR Jr, Hutton JJ, Bryant WM: Fatal hemolysis from mafenide diveatment of burns in a patient with glucose-6-phosphate dehydrogenase deficiency. Case report. Plast Reconsdiv Surg. 1973 Aug;52(2):197-9. [PubMed:4722683 ]
  2. Sulfamylon® (Mafenide Acetate, USP)[package insert]. Sugar Land, Texas: Bertek Pharmaceuticals, Inc.; 1998. [Link]

PMID: 21779400

Mafenide

By

Mafenide

Product: Idramantone

Identifier : DBSNPE001978
Drug : DB06795 (Mafenide)
Interacting Gene/Enzyme : Glucose-6-phosphate 1-dehydrogenase
Gene Name : G6PD
UniProt ID : P11413
Defining Change(s) :

  • 637G->T

Allele Name : Minnesota, Marion, Gastonia, LeJeune
Genotype(s) : Not Available
Type(s) : ADR Inferred
Groups : G6PD deficiency
Description : Increased risk of potentially fatal hemolytic anemia.
References :

  1. Marsicano AR Jr, Hutton JJ, Bryant WM: Fatal hemolysis from mafenide diveatment of burns in a patient with glucose-6-phosphate dehydrogenase deficiency. Case report. Plast Reconsdiv Surg. 1973 Aug;52(2):197-9. [PubMed:4722683 ]
  2. Sulfamylon® (Mafenide Acetate, USP)[package insert]. Sugar Land, Texas: Bertek Pharmaceuticals, Inc.; 1998. [Link]

PMID: 20072121

Mafenide

By

Mafenide

Product: Ambroxol

Identifier : DBSNPE001979
Drug : DB06795 (Mafenide)
Interacting Gene/Enzyme : Glucose-6-phosphate 1-dehydrogenase
Gene Name : G6PD
UniProt ID : P11413
Defining Change(s) :

  • 637G->T, 1037A->T

Allele Name : Cincinnati
Genotype(s) : Not Available
Type(s) : ADR Inferred
Groups : G6PD deficiency
Description : Increased risk of potentially fatal hemolytic anemia.
References :

  1. Marsicano AR Jr, Hutton JJ, Bryant WM: Fatal hemolysis from mafenide diveatment of burns in a patient with glucose-6-phosphate dehydrogenase deficiency. Case report. Plast Reconsdiv Surg. 1973 Aug;52(2):197-9. [PubMed:4722683 ]
  2. Sulfamylon® (Mafenide Acetate, USP)[package insert]. Sugar Land, Texas: Bertek Pharmaceuticals, Inc.; 1998. [Link]

PMID: 20118184

Mafenide

By

Mafenide

Product: Salbutamol

Identifier : DBSNPE001980
Drug : DB06795 (Mafenide)
Interacting Gene/Enzyme : Glucose-6-phosphate 1-dehydrogenase
Gene Name : G6PD
UniProt ID : P11413
Defining Change(s) :

  • 648T->G

Allele Name : Harilaou
Genotype(s) : Not Available
Type(s) : ADR Inferred
Groups : G6PD deficiency
Description : Increased risk of potentially fatal hemolytic anemia.
References :

  1. Marsicano AR Jr, Hutton JJ, Bryant WM: Fatal hemolysis from mafenide diveatment of burns in a patient with glucose-6-phosphate dehydrogenase deficiency. Case report. Plast Reconsdiv Surg. 1973 Aug;52(2):197-9. [PubMed:4722683 ]
  2. Sulfamylon® (Mafenide Acetate, USP)[package insert]. Sugar Land, Texas: Bertek Pharmaceuticals, Inc.; 1998. [Link]

PMID: 15887967

Mafenide

By

Mafenide

Product: Trapidil

Identifier : DBSNPE001981
Drug : DB06795 (Mafenide)
Interacting Gene/Enzyme : Glucose-6-phosphate 1-dehydrogenase
Gene Name : G6PD
UniProt ID : P11413
Defining Change(s) :

  • 683_685delACA

Allele Name : North Dallas
Genotype(s) : Not Available
Type(s) : ADR Inferred
Groups : G6PD deficiency
Description : Increased risk of potentially fatal hemolytic anemia.
References :

  1. Marsicano AR Jr, Hutton JJ, Bryant WM: Fatal hemolysis from mafenide diveatment of burns in a patient with glucose-6-phosphate dehydrogenase deficiency. Case report. Plast Reconsdiv Surg. 1973 Aug;52(2):197-9. [PubMed:4722683 ]
  2. Sulfamylon® (Mafenide Acetate, USP)[package insert]. Sugar Land, Texas: Bertek Pharmaceuticals, Inc.; 1998. [Link]

PMID: 10899918

Mafenide

By

Mafenide

Product: Edoxudine

Identifier : DBSNPE001982
Drug : DB06795 (Mafenide)
Interacting Gene/Enzyme : Glucose-6-phosphate 1-dehydrogenase
Gene Name : G6PD
UniProt ID : P11413
Defining Change(s) :

  • 695G->A

Allele Name : Asahikawa
Genotype(s) : Not Available
Type(s) : ADR Inferred
Groups : G6PD deficiency
Description : Increased risk of potentially fatal hemolytic anemia.
References :

  1. Marsicano AR Jr, Hutton JJ, Bryant WM: Fatal hemolysis from mafenide diveatment of burns in a patient with glucose-6-phosphate dehydrogenase deficiency. Case report. Plast Reconsdiv Surg. 1973 Aug;52(2):197-9. [PubMed:4722683 ]
  2. Sulfamylon® (Mafenide Acetate, USP)[package insert]. Sugar Land, Texas: Bertek Pharmaceuticals, Inc.; 1998. [Link]

PMID: 10991955

Mafenide

By

Mafenide

Product: Hexetidine

Identifier : DBSNPE001983
Drug : DB06795 (Mafenide)
Interacting Gene/Enzyme : Glucose-6-phosphate 1-dehydrogenase
Gene Name : G6PD
UniProt ID : P11413
Defining Change(s) :

  • 713A->G

Allele Name : Durham
Genotype(s) : Not Available
Type(s) : ADR Inferred
Groups : G6PD deficiency
Description : Increased risk of potentially fatal hemolytic anemia.
References :

  1. Marsicano AR Jr, Hutton JJ, Bryant WM: Fatal hemolysis from mafenide diveatment of burns in a patient with glucose-6-phosphate dehydrogenase deficiency. Case report. Plast Reconsdiv Surg. 1973 Aug;52(2):197-9. [PubMed:4722683 ]
  2. Sulfamylon® (Mafenide Acetate, USP)[package insert]. Sugar Land, Texas: Bertek Pharmaceuticals, Inc.; 1998. [Link]

PMID: 9202308

Mafenide

By

Mafenide

Product: Pindolol

Identifier : DBSNPE001984
Drug : DB06795 (Mafenide)
Interacting Gene/Enzyme : Glucose-6-phosphate 1-dehydrogenase
Gene Name : G6PD
UniProt ID : P11413
Defining Change(s) :

  • 724_729delGGCACT

Allele Name : Stonybrook
Genotype(s) : Not Available
Type(s) : ADR Inferred
Groups : G6PD deficiency
Description : Increased risk of potentially fatal hemolytic anemia.
References :

  1. Marsicano AR Jr, Hutton JJ, Bryant WM: Fatal hemolysis from mafenide diveatment of burns in a patient with glucose-6-phosphate dehydrogenase deficiency. Case report. Plast Reconsdiv Surg. 1973 Aug;52(2):197-9. [PubMed:4722683 ]
  2. Sulfamylon® (Mafenide Acetate, USP)[package insert]. Sugar Land, Texas: Bertek Pharmaceuticals, Inc.; 1998. [Link]

PMID: 19383832

Mafenide

By

Mafenide

Product: DEET

Identifier : DBSNPE001985
Drug : DB06795 (Mafenide)
Interacting Gene/Enzyme : Glucose-6-phosphate 1-dehydrogenase
Gene Name : G6PD
UniProt ID : P11413
Defining Change(s) :

  • 769C->G

Allele Name : Wayne
Genotype(s) : Not Available
Type(s) : ADR Inferred
Groups : G6PD deficiency
Description : Increased risk of potentially fatal hemolytic anemia.
References :

  1. Marsicano AR Jr, Hutton JJ, Bryant WM: Fatal hemolysis from mafenide diveatment of burns in a patient with glucose-6-phosphate dehydrogenase deficiency. Case report. Plast Reconsdiv Surg. 1973 Aug;52(2):197-9. [PubMed:4722683 ]
  2. Sulfamylon® (Mafenide Acetate, USP)[package insert]. Sugar Land, Texas: Bertek Pharmaceuticals, Inc.; 1998. [Link]

PMID: 11752112

Mafenide

By

Mafenide

Product: Fenoterol

Identifier : DBSNPE001986
Drug : DB06795 (Mafenide)
Interacting Gene/Enzyme : Glucose-6-phosphate 1-dehydrogenase
Gene Name : G6PD
UniProt ID : P11413
Defining Change(s) :

  • 806G->A

Allele Name : Aveiro
Genotype(s) : Not Available
Type(s) : ADR Inferred
Groups : G6PD deficiency
Description : Increased risk of potentially fatal hemolytic anemia.
References :

  1. Marsicano AR Jr, Hutton JJ, Bryant WM: Fatal hemolysis from mafenide diveatment of burns in a patient with glucose-6-phosphate dehydrogenase deficiency. Case report. Plast Reconsdiv Surg. 1973 Aug;52(2):197-9. [PubMed:4722683 ]
  2. Sulfamylon® (Mafenide Acetate, USP)[package insert]. Sugar Land, Texas: Bertek Pharmaceuticals, Inc.; 1998. [Link]

PMID: 10712449

Mafenide

By

Mafenide

Product: Dibenzothiophene

Identifier : DBSNPE001987
Drug : DB06795 (Mafenide)
Interacting Gene/Enzyme : Glucose-6-phosphate 1-dehydrogenase
Gene Name : G6PD
UniProt ID : P11413
Defining Change(s) :

  • 820G->A

Allele Name : Cleveland Corum
Genotype(s) : Not Available
Type(s) : ADR Inferred
Groups : G6PD deficiency
Description : Increased risk of potentially fatal hemolytic anemia.
References :

  1. Marsicano AR Jr, Hutton JJ, Bryant WM: Fatal hemolysis from mafenide diveatment of burns in a patient with glucose-6-phosphate dehydrogenase deficiency. Case report. Plast Reconsdiv Surg. 1973 Aug;52(2):197-9. [PubMed:4722683 ]
  2. Sulfamylon® (Mafenide Acetate, USP)[package insert]. Sugar Land, Texas: Bertek Pharmaceuticals, Inc.; 1998. [Link]

PMID: 8719814

Mafenide

By

Mafenide

Product: Cresol

Identifier : DBSNPE001988
Drug : DB06795 (Mafenide)
Interacting Gene/Enzyme : Glucose-6-phosphate 1-dehydrogenase
Gene Name : G6PD
UniProt ID : P11413
Defining Change(s) :

  • 821A>T

Allele Name : Lille
Genotype(s) : Not Available
Type(s) : ADR Inferred
Groups : G6PD deficiency
Description : Increased risk of potentially fatal hemolytic anemia.
References :

  1. Marsicano AR Jr, Hutton JJ, Bryant WM: Fatal hemolysis from mafenide diveatment of burns in a patient with glucose-6-phosphate dehydrogenase deficiency. Case report. Plast Reconsdiv Surg. 1973 Aug;52(2):197-9. [PubMed:4722683 ]
  2. Sulfamylon® (Mafenide Acetate, USP)[package insert]. Sugar Land, Texas: Bertek Pharmaceuticals, Inc.; 1998. [Link]

PMID: 7751958

Mafenide

By

Mafenide

Product: Dioxybenzone

Identifier : DBSNPE001989
Drug : DB06795 (Mafenide)
Interacting Gene/Enzyme : Glucose-6-phosphate 1-dehydrogenase
Gene Name : G6PD
UniProt ID : P11413
Defining Change(s) :

  • 825G>C

Allele Name : Bangkok
Genotype(s) : Not Available
Type(s) : ADR Inferred
Groups : G6PD deficiency
Description : Increased risk of potentially fatal hemolytic anemia.
References :

  1. Marsicano AR Jr, Hutton JJ, Bryant WM: Fatal hemolysis from mafenide diveatment of burns in a patient with glucose-6-phosphate dehydrogenase deficiency. Case report. Plast Reconsdiv Surg. 1973 Aug;52(2):197-9. [PubMed:4722683 ]
  2. Sulfamylon® (Mafenide Acetate, USP)[package insert]. Sugar Land, Texas: Bertek Pharmaceuticals, Inc.; 1998. [Link]

PMID: 18568035

Mafenide

By

Mafenide

Product: Mitiglinide (calcium hydrate)

Identifier : DBSNPE001990
Drug : DB06795 (Mafenide)
Interacting Gene/Enzyme : Glucose-6-phosphate 1-dehydrogenase
Gene Name : G6PD
UniProt ID : P11413
Defining Change(s) :

  • 826C->T

Allele Name : Sugao
Genotype(s) : Not Available
Type(s) : ADR Inferred
Groups : G6PD deficiency
Description : Increased risk of potentially fatal hemolytic anemia.
References :

  1. Marsicano AR Jr, Hutton JJ, Bryant WM: Fatal hemolysis from mafenide diveatment of burns in a patient with glucose-6-phosphate dehydrogenase deficiency. Case report. Plast Reconsdiv Surg. 1973 Aug;52(2):197-9. [PubMed:4722683 ]
  2. Sulfamylon® (Mafenide Acetate, USP)[package insert]. Sugar Land, Texas: Bertek Pharmaceuticals, Inc.; 1998. [Link]

PMID: 10489262

Mafenide

By

Mafenide

Product: Phenytoin (sodium)

Identifier : DBSNPE001991
Drug : DB06795 (Mafenide)
Interacting Gene/Enzyme : Glucose-6-phosphate 1-dehydrogenase
Gene Name : G6PD
UniProt ID : P11413
Defining Change(s) :

  • 832T->C

Allele Name : La Jolla
Genotype(s) : Not Available
Type(s) : ADR Inferred
Groups : G6PD deficiency
Description : Increased risk of potentially fatal hemolytic anemia.
References :

  1. Marsicano AR Jr, Hutton JJ, Bryant WM: Fatal hemolysis from mafenide diveatment of burns in a patient with glucose-6-phosphate dehydrogenase deficiency. Case report. Plast Reconsdiv Surg. 1973 Aug;52(2):197-9. [PubMed:4722683 ]
  2. Sulfamylon® (Mafenide Acetate, USP)[package insert]. Sugar Land, Texas: Bertek Pharmaceuticals, Inc.; 1998. [Link]

PMID: 17266540

Mafenide

By

Mafenide

Product: Tandospirone (citrate)

Identifier : DBSNPE001992
Drug : DB06795 (Mafenide)
Interacting Gene/Enzyme : Glucose-6-phosphate 1-dehydrogenase
Gene Name : G6PD
UniProt ID : P11413
Defining Change(s) :

  • 833C->T

Allele Name : Wexham
Genotype(s) : Not Available
Type(s) : ADR Inferred
Groups : G6PD deficiency
Description : Increased risk of potentially fatal hemolytic anemia.
References :

  1. Marsicano AR Jr, Hutton JJ, Bryant WM: Fatal hemolysis from mafenide diveatment of burns in a patient with glucose-6-phosphate dehydrogenase deficiency. Case report. Plast Reconsdiv Surg. 1973 Aug;52(2):197-9. [PubMed:4722683 ]
  2. Sulfamylon® (Mafenide Acetate, USP)[package insert]. Sugar Land, Texas: Bertek Pharmaceuticals, Inc.; 1998. [Link]

PMID: 10465539

Mafenide

By

Mafenide

Product: Amitifadine (hydrochloride)

Identifier : DBSNPE001994
Drug : DB06795 (Mafenide)
Interacting Gene/Enzyme : Glucose-6-phosphate 1-dehydrogenase
Gene Name : G6PD
UniProt ID : P11413
Defining Change(s) :

  • 910G->T

Allele Name : West Virginia
Genotype(s) : Not Available
Type(s) : ADR Inferred
Groups : G6PD deficiency
Description : Increased risk of potentially fatal hemolytic anemia.
References :

  1. Marsicano AR Jr, Hutton JJ, Bryant WM: Fatal hemolysis from mafenide diveatment of burns in a patient with glucose-6-phosphate dehydrogenase deficiency. Case report. Plast Reconsdiv Surg. 1973 Aug;52(2):197-9. [PubMed:4722683 ]
  2. Sulfamylon® (Mafenide Acetate, USP)[package insert]. Sugar Land, Texas: Bertek Pharmaceuticals, Inc.; 1998. [Link]

PMID: 17526600

Mafenide

By

Mafenide

Product: TG6-10-1

Identifier : DBSNPE001995
Drug : DB06795 (Mafenide)
Interacting Gene/Enzyme : Glucose-6-phosphate 1-dehydrogenase
Gene Name : G6PD
UniProt ID : P11413
Defining Change(s) :

  • 921G->C

Allele Name : Omiya
Genotype(s) : Not Available
Type(s) : ADR Inferred
Groups : G6PD deficiency
Description : Increased risk of potentially fatal hemolytic anemia.
References :

  1. Marsicano AR Jr, Hutton JJ, Bryant WM: Fatal hemolysis from mafenide diveatment of burns in a patient with glucose-6-phosphate dehydrogenase deficiency. Case report. Plast Reconsdiv Surg. 1973 Aug;52(2):197-9. [PubMed:4722683 ]
  2. Sulfamylon® (Mafenide Acetate, USP)[package insert]. Sugar Land, Texas: Bertek Pharmaceuticals, Inc.; 1998. [Link]

PMID: 16046122

Mafenide

By

Mafenide

Product: SH-4-54

Identifier : DBSNPE001996
Drug : DB06795 (Mafenide)
Interacting Gene/Enzyme : Glucose-6-phosphate 1-dehydrogenase
Gene Name : G6PD
UniProt ID : P11413
Defining Change(s) :

  • 953_976delCCACCAAAGGGTACCTGGAC GACC

Allele Name : Nara
Genotype(s) : Not Available
Type(s) : ADR Inferred
Groups : G6PD deficiency
Description : Increased risk of potentially fatal hemolytic anemia.
References :

  1. Marsicano AR Jr, Hutton JJ, Bryant WM: Fatal hemolysis from mafenide diveatment of burns in a patient with glucose-6-phosphate dehydrogenase deficiency. Case report. Plast Reconsdiv Surg. 1973 Aug;52(2):197-9. [PubMed:4722683 ]
  2. Sulfamylon® (Mafenide Acetate, USP)[package insert]. Sugar Land, Texas: Bertek Pharmaceuticals, Inc.; 1998. [Link]

PMID: 19951716

Mafenide

By

Mafenide

Product: Presatovir

Identifier : DBSNPE001997
Drug : DB06795 (Mafenide)
Interacting Gene/Enzyme : Glucose-6-phosphate 1-dehydrogenase
Gene Name : G6PD
UniProt ID : P11413
Defining Change(s) :

  • 962G->A

Allele Name : Manhattan
Genotype(s) : Not Available
Type(s) : ADR Inferred
Groups : G6PD deficiency
Description : Increased risk of potentially fatal hemolytic anemia.
References :

  1. Marsicano AR Jr, Hutton JJ, Bryant WM: Fatal hemolysis from mafenide diveatment of burns in a patient with glucose-6-phosphate dehydrogenase deficiency. Case report. Plast Reconsdiv Surg. 1973 Aug;52(2):197-9. [PubMed:4722683 ]
  2. Sulfamylon® (Mafenide Acetate, USP)[package insert]. Sugar Land, Texas: Bertek Pharmaceuticals, Inc.; 1998. [Link]

PMID: 15717213

Mafenide

By

Mafenide

Product: SJG-136

Identifier : DBSNPE001998
Drug : DB06795 (Mafenide)
Interacting Gene/Enzyme : Glucose-6-phosphate 1-dehydrogenase
Gene Name : G6PD
UniProt ID : P11413
Defining Change(s) :

  • 964T->C

Allele Name : Rehevot
Genotype(s) : Not Available
Type(s) : ADR Inferred
Groups : G6PD deficiency
Description : Increased risk of potentially fatal hemolytic anemia.
References :

  1. Marsicano AR Jr, Hutton JJ, Bryant WM: Fatal hemolysis from mafenide diveatment of burns in a patient with glucose-6-phosphate dehydrogenase deficiency. Case report. Plast Reconsdiv Surg. 1973 Aug;52(2):197-9. [PubMed:4722683 ]
  2. Sulfamylon® (Mafenide Acetate, USP)[package insert]. Sugar Land, Texas: Bertek Pharmaceuticals, Inc.; 1998. [Link]

PMID: 21159998

Mafenide

By

Mafenide

Product: Quinacrine (dihydrochloride)

Identifier : DBSNPE001999
Drug : DB06795 (Mafenide)
Interacting Gene/Enzyme : Glucose-6-phosphate 1-dehydrogenase
Gene Name : G6PD
UniProt ID : P11413
Defining Change(s) :

  • 99A->G
  • 1360C->T

Allele Name : Honiara
Genotype(s) : Not Available
Type(s) : ADR Inferred
Groups : G6PD deficiency
Description : Increased risk of potentially fatal hemolytic anemia.
References :

  1. Marsicano AR Jr, Hutton JJ, Bryant WM: Fatal hemolysis from mafenide diveatment of burns in a patient with glucose-6-phosphate dehydrogenase deficiency. Case report. Plast Reconsdiv Surg. 1973 Aug;52(2):197-9. [PubMed:4722683 ]
  2. Sulfamylon® (Mafenide Acetate, USP)[package insert]. Sugar Land, Texas: Bertek Pharmaceuticals, Inc.; 1998. [Link]

PMID: 20739457

Mafenide

By

Mafenide

Product: Nandrolone decanoate

Identifier : DBSNPE002000
Drug : DB06795 (Mafenide)
Interacting Gene/Enzyme : Glucose-6-phosphate 1-dehydrogenase
Gene Name : G6PD
UniProt ID : P11413
Defining Change(s) :

  • 1246G->A

Allele Name : Tokyo, Fukushima
Genotype(s) : Not Available
Type(s) : ADR Inferred
Groups : G6PD deficiency
Description : Increased risk of potentially fatal hemolytic anemia.
References :

  1. Marsicano AR Jr, Hutton JJ, Bryant WM: Fatal hemolysis from mafenide diveatment of burns in a patient with glucose-6-phosphate dehydrogenase deficiency. Case report. Plast Reconsdiv Surg. 1973 Aug;52(2):197-9. [PubMed:4722683 ]
  2. Sulfamylon® (Mafenide Acetate, USP)[package insert]. Sugar Land, Texas: Bertek Pharmaceuticals, Inc.; 1998. [Link]

PMID: 15993439

Mafenide

By

Mafenide

Product: MK-0354

Identifier : DBSNPE002001
Drug : DB06795 (Mafenide)
Interacting Gene/Enzyme : Glucose-6-phosphate 1-dehydrogenase
Gene Name : G6PD
UniProt ID : P11413
Defining Change(s) :

  • 1003G->A

Allele Name : Chatham
Genotype(s) : Not Available
Type(s) : ADR Inferred
Groups : G6PD deficiency
Description : Increased risk of potentially fatal hemolytic anemia.
References :

  1. Marsicano AR Jr, Hutton JJ, Bryant WM: Fatal hemolysis from mafenide diveatment of burns in a patient with glucose-6-phosphate dehydrogenase deficiency. Case report. Plast Reconsdiv Surg. 1973 Aug;52(2):197-9. [PubMed:4722683 ]
  2. Sulfamylon® (Mafenide Acetate, USP)[package insert]. Sugar Land, Texas: Bertek Pharmaceuticals, Inc.; 1998. [Link]

PMID: 12852748

Mafenide

By

Mafenide

Product: Spautin-1

Identifier : DBSNPE002002
Drug : DB06795 (Mafenide)
Interacting Gene/Enzyme : Glucose-6-phosphate 1-dehydrogenase
Gene Name : G6PD
UniProt ID : P11413
Defining Change(s) :

  • 1004C->A

Allele Name : Fushan
Genotype(s) : Not Available
Type(s) : ADR Inferred
Groups : G6PD deficiency
Description : Increased risk of potentially fatal hemolytic anemia.
References :

  1. Marsicano AR Jr, Hutton JJ, Bryant WM: Fatal hemolysis from mafenide diveatment of burns in a patient with glucose-6-phosphate dehydrogenase deficiency. Case report. Plast Reconsdiv Surg. 1973 Aug;52(2):197-9. [PubMed:4722683 ]
  2. Sulfamylon® (Mafenide Acetate, USP)[package insert]. Sugar Land, Texas: Bertek Pharmaceuticals, Inc.; 1998. [Link]

PMID: 14500736

Mafenide

By

Mafenide

Product: KHK-IN-1

Identifier : DBSNPE002003
Drug : DB06795 (Mafenide)
Interacting Gene/Enzyme : Glucose-6-phosphate 1-dehydrogenase
Gene Name : G6PD
UniProt ID : P11413
Defining Change(s) :

  • 1052G->T

Allele Name : Partenope
Genotype(s) : Not Available
Type(s) : ADR Inferred
Groups : G6PD deficiency
Description : Increased risk of potentially fatal hemolytic anemia.
References :

  1. Marsicano AR Jr, Hutton JJ, Bryant WM: Fatal hemolysis from mafenide diveatment of burns in a patient with glucose-6-phosphate dehydrogenase deficiency. Case report. Plast Reconsdiv Surg. 1973 Aug;52(2):197-9. [PubMed:4722683 ]
  2. Sulfamylon® (Mafenide Acetate, USP)[package insert]. Sugar Land, Texas: Bertek Pharmaceuticals, Inc.; 1998. [Link]

PMID: 26496940

Mafenide

By

Mafenide

Product: IFN alpha-IFNAR-IN-1 (hydrochloride)

Identifier : DBSNPE002004
Drug : DB06795 (Mafenide)
Interacting Gene/Enzyme : Glucose-6-phosphate 1-dehydrogenase
Gene Name : G6PD
UniProt ID : P11413
Defining Change(s) :

  • 1057C->T

Allele Name : Ierapediva
Genotype(s) : Not Available
Type(s) : ADR Inferred
Groups : G6PD deficiency
Description : Increased risk of potentially fatal hemolytic anemia.
References :

  1. Marsicano AR Jr, Hutton JJ, Bryant WM: Fatal hemolysis from mafenide diveatment of burns in a patient with glucose-6-phosphate dehydrogenase deficiency. Case report. Plast Reconsdiv Surg. 1973 Aug;52(2):197-9. [PubMed:4722683 ]
  2. Sulfamylon® (Mafenide Acetate, USP)[package insert]. Sugar Land, Texas: Bertek Pharmaceuticals, Inc.; 1998. [Link]

PMID: 22607673

Mafenide

By

Mafenide

Product: A-366

Identifier : DBSNPE002005
Drug : DB06795 (Mafenide)
Interacting Gene/Enzyme : Glucose-6-phosphate 1-dehydrogenase
Gene Name : G6PD
UniProt ID : P11413
Defining Change(s) :

  • 1193A->G

Allele Name : Anadia
Genotype(s) : Not Available
Type(s) : ADR Inferred
Groups : G6PD deficiency
Description : Increased risk of potentially fatal hemolytic anemia.
References :

  1. Marsicano AR Jr, Hutton JJ, Bryant WM: Fatal hemolysis from mafenide diveatment of burns in a patient with glucose-6-phosphate dehydrogenase deficiency. Case report. Plast Reconsdiv Surg. 1973 Aug;52(2):197-9. [PubMed:4722683 ]
  2. Sulfamylon® (Mafenide Acetate, USP)[package insert]. Sugar Land, Texas: Bertek Pharmaceuticals, Inc.; 1998. [Link]

PMID: 23718281

Mafenide

By

Mafenide

Product: CDK9-IN-6

Identifier : DBSNPE002006
Drug : DB06795 (Mafenide)
Interacting Gene/Enzyme : Glucose-6-phosphate 1-dehydrogenase
Gene Name : G6PD
UniProt ID : P11413
Defining Change(s) :

  • 1220A->C

Allele Name : Abeno
Genotype(s) : Not Available
Type(s) : ADR Inferred
Groups : G6PD deficiency
Description : Increased risk of potentially fatal hemolytic anemia.
References :

  1. Marsicano AR Jr, Hutton JJ, Bryant WM: Fatal hemolysis from mafenide diveatment of burns in a patient with glucose-6-phosphate dehydrogenase deficiency. Case report. Plast Reconsdiv Surg. 1973 Aug;52(2):197-9. [PubMed:4722683 ]
  2. Sulfamylon® (Mafenide Acetate, USP)[package insert]. Sugar Land, Texas: Bertek Pharmaceuticals, Inc.; 1998. [Link]

PMID: 17416742

Mafenide

By

Mafenide

Product: Chikusetsusaponin Iva

Identifier : DBSNPE002007
Drug : DB06795 (Mafenide)
Interacting Gene/Enzyme : Glucose-6-phosphate 1-dehydrogenase
Gene Name : G6PD
UniProt ID : P11413
Defining Change(s) :

  • 1291G->A

Allele Name : Surabaya
Genotype(s) : Not Available
Type(s) : ADR Inferred
Groups : G6PD deficiency
Description : Increased risk of potentially fatal hemolytic anemia.
References :

  1. Marsicano AR Jr, Hutton JJ, Bryant WM: Fatal hemolysis from mafenide diveatment of burns in a patient with glucose-6-phosphate dehydrogenase deficiency. Case report. Plast Reconsdiv Surg. 1973 Aug;52(2):197-9. [PubMed:4722683 ]
  2. Sulfamylon® (Mafenide Acetate, USP)[package insert]. Sugar Land, Texas: Bertek Pharmaceuticals, Inc.; 1998. [Link]

PMID: 25277141

Mafenide

By

Mafenide

Product: Resibufogenin

Identifier : DBSNPE002008
Drug : DB06795 (Mafenide)
Interacting Gene/Enzyme : Glucose-6-phosphate 1-dehydrogenase
Gene Name : G6PD
UniProt ID : P11413
Defining Change(s) :

  • 1316G->C

Allele Name : Pawnee
Genotype(s) : Not Available
Type(s) : ADR Inferred
Groups : G6PD deficiency
Description : Increased risk of potentially fatal hemolytic anemia.
References :

  1. Marsicano AR Jr, Hutton JJ, Bryant WM: Fatal hemolysis from mafenide diveatment of burns in a patient with glucose-6-phosphate dehydrogenase deficiency. Case report. Plast Reconsdiv Surg. 1973 Aug;52(2):197-9. [PubMed:4722683 ]
  2. Sulfamylon® (Mafenide Acetate, USP)[package insert]. Sugar Land, Texas: Bertek Pharmaceuticals, Inc.; 1998. [Link]

PMID: 17070835

Mafenide

By

Mafenide

Product: Protopanaxatriol

Identifier : DBSNPE002009
Drug : DB06795 (Mafenide)
Interacting Gene/Enzyme : Glucose-6-phosphate 1-dehydrogenase
Gene Name : G6PD
UniProt ID : P11413
Defining Change(s) :

  • 1342A->G

Allele Name : S. Antioco
Genotype(s) : Not Available
Type(s) : ADR Inferred
Groups : G6PD deficiency
Description : Increased risk of potentially fatal hemolytic anemia.
References :

  1. Marsicano AR Jr, Hutton JJ, Bryant WM: Fatal hemolysis from mafenide diveatment of burns in a patient with glucose-6-phosphate dehydrogenase deficiency. Case report. Plast Reconsdiv Surg. 1973 Aug;52(2):197-9. [PubMed:4722683 ]
  2. Sulfamylon® (Mafenide Acetate, USP)[package insert]. Sugar Land, Texas: Bertek Pharmaceuticals, Inc.; 1998. [Link]

PMID: 11743947

Mafenide

By

Mafenide

Product: Protopine

Identifier : DBSNPE002010
Drug : DB06795 (Mafenide)
Interacting Gene/Enzyme : Glucose-6-phosphate 1-dehydrogenase
Gene Name : G6PD
UniProt ID : P11413
Defining Change(s) :

  • 1347G->C

Allele Name : Cassano
Genotype(s) : Not Available
Type(s) : ADR Inferred
Groups : G6PD deficiency
Description : Increased risk of potentially fatal hemolytic anemia.
References :

  1. Marsicano AR Jr, Hutton JJ, Bryant WM: Fatal hemolysis from mafenide diveatment of burns in a patient with glucose-6-phosphate dehydrogenase deficiency. Case report. Plast Reconsdiv Surg. 1973 Aug;52(2):197-9. [PubMed:4722683 ]
  2. Sulfamylon® (Mafenide Acetate, USP)[package insert]. Sugar Land, Texas: Bertek Pharmaceuticals, Inc.; 1998. [Link]

PMID: 10530818

Mafenide

By

Mafenide

Product: Anisodamine

Identifier : DBSNPE002011
Drug : DB06795 (Mafenide)
Interacting Gene/Enzyme : Glucose-6-phosphate 1-dehydrogenase
Gene Name : G6PD
UniProt ID : P11413
Defining Change(s) :

  • 1347G->C
  • 1360C->T

Allele Name : Hermoupolis
Genotype(s) : Not Available
Type(s) : ADR Inferred
Groups : G6PD deficiency
Description : Increased risk of potentially fatal hemolytic anemia.
References :

  1. Marsicano AR Jr, Hutton JJ, Bryant WM: Fatal hemolysis from mafenide diveatment of burns in a patient with glucose-6-phosphate dehydrogenase deficiency. Case report. Plast Reconsdiv Surg. 1973 Aug;52(2):197-9. [PubMed:4722683 ]
  2. Sulfamylon® (Mafenide Acetate, USP)[package insert]. Sugar Land, Texas: Bertek Pharmaceuticals, Inc.; 1998. [Link]

PMID: 9144665

Mafenide

By

Mafenide

Product: Hydroxysafflor yellow A

Identifier : DBSNPE002012
Drug : DB06795 (Mafenide)
Interacting Gene/Enzyme : Glucose-6-phosphate 1-dehydrogenase
Gene Name : G6PD
UniProt ID : P11413
Defining Change(s) :

  • 1360C->T

Allele Name : Union,Maewo, Chinese-2, Kalo
Genotype(s) : Not Available
Type(s) : ADR Inferred
Groups : G6PD deficiency
Description : Increased risk of potentially fatal hemolytic anemia.
References :

  1. Marsicano AR Jr, Hutton JJ, Bryant WM: Fatal hemolysis from mafenide diveatment of burns in a patient with glucose-6-phosphate dehydrogenase deficiency. Case report. Plast Reconsdiv Surg. 1973 Aug;52(2):197-9. [PubMed:4722683 ]
  2. Sulfamylon® (Mafenide Acetate, USP)[package insert]. Sugar Land, Texas: Bertek Pharmaceuticals, Inc.; 1998. [Link]

PMID: 22916181

Mafenide

By

Mafenide

Product: Digoxigenin

Identifier : DBSNPE002013
Drug : DB06795 (Mafenide)
Interacting Gene/Enzyme : Glucose-6-phosphate 1-dehydrogenase
Gene Name : G6PD
UniProt ID : P11413
Defining Change(s) :

  • 1361G->A

Allele Name : Andalus
Genotype(s) : Not Available
Type(s) : ADR Inferred
Groups : G6PD deficiency
Description : Increased risk of potentially fatal hemolytic anemia.
References :

  1. Marsicano AR Jr, Hutton JJ, Bryant WM: Fatal hemolysis from mafenide diveatment of burns in a patient with glucose-6-phosphate dehydrogenase deficiency. Case report. Plast Reconsdiv Surg. 1973 Aug;52(2):197-9. [PubMed:4722683 ]
  2. Sulfamylon® (Mafenide Acetate, USP)[package insert]. Sugar Land, Texas: Bertek Pharmaceuticals, Inc.; 1998. [Link]

PMID: 22642439

Mafenide

By

Mafenide

Product: Carzenide

Identifier : DBSNPE002014
Drug : DB06795 (Mafenide)
Interacting Gene/Enzyme : Glucose-6-phosphate 1-dehydrogenase
Gene Name : G6PD
UniProt ID : P11413
Defining Change(s) :

  • 1376G->C

Allele Name : Cosenza
Genotype(s) : Not Available
Type(s) : ADR Inferred
Groups : G6PD deficiency
Description : Increased risk of potentially fatal hemolytic anemia.
References :

  1. Marsicano AR Jr, Hutton JJ, Bryant WM: Fatal hemolysis from mafenide diveatment of burns in a patient with glucose-6-phosphate dehydrogenase deficiency. Case report. Plast Reconsdiv Surg. 1973 Aug;52(2):197-9. [PubMed:4722683 ]
  2. Sulfamylon® (Mafenide Acetate, USP)[package insert]. Sugar Land, Texas: Bertek Pharmaceuticals, Inc.; 1998. [Link]

PMID: 19670441

Mafenide

By

Mafenide

Product: Cinchophen

Identifier : DBSNPE002015
Drug : DB06795 (Mafenide)
Interacting Gene/Enzyme : Glucose-6-phosphate 1-dehydrogenase
Gene Name : G6PD
UniProt ID : P11413
Defining Change(s) :

  • 1376G->T

Allele Name : Canton, Taiwan- Hakka, Gifu-like, Agrigento-like
Genotype(s) : Not Available
Type(s) : ADR Inferred
Groups : G6PD deficiency
Description : Increased risk of potentially fatal hemolytic anemia.
References :

  1. Marsicano AR Jr, Hutton JJ, Bryant WM: Fatal hemolysis from mafenide diveatment of burns in a patient with glucose-6-phosphate dehydrogenase deficiency. Case report. Plast Reconsdiv Surg. 1973 Aug;52(2):197-9. [PubMed:4722683 ]
  2. Sulfamylon® (Mafenide Acetate, USP)[package insert]. Sugar Land, Texas: Bertek Pharmaceuticals, Inc.; 1998. [Link]

PMID: 19832997

Mafenide

By

Mafenide

Product: Riboflavin (phosphate sodium)

Identifier : DBSNPE002016
Drug : DB06795 (Mafenide)
Interacting Gene/Enzyme : Glucose-6-phosphate 1-dehydrogenase
Gene Name : G6PD
UniProt ID : P11413
Defining Change(s) :

  • 1387C->A

Allele Name : Flores
Genotype(s) : Not Available
Type(s) : ADR Inferred
Groups : G6PD deficiency
Description : Increased risk of potentially fatal hemolytic anemia.
References :

  1. Marsicano AR Jr, Hutton JJ, Bryant WM: Fatal hemolysis from mafenide diveatment of burns in a patient with glucose-6-phosphate dehydrogenase deficiency. Case report. Plast Reconsdiv Surg. 1973 Aug;52(2):197-9. [PubMed:4722683 ]
  2. Sulfamylon® (Mafenide Acetate, USP)[package insert]. Sugar Land, Texas: Bertek Pharmaceuticals, Inc.; 1998. [Link]

PMID: 9504400

Mafenide

By

Mafenide

Product: Cloxiquine

Identifier : DBSNPE002017
Drug : DB06795 (Mafenide)
Interacting Gene/Enzyme : Glucose-6-phosphate 1-dehydrogenase
Gene Name : G6PD
UniProt ID : P11413
Defining Change(s) :

  • 1388G->A

Allele Name : Kaiping, Anant, Dhon, Sapporo-like, Wosera
Genotype(s) : Not Available
Type(s) : ADR Inferred
Groups : G6PD deficiency
Description : Increased risk of potentially fatal hemolytic anemia.
References :

  1. Marsicano AR Jr, Hutton JJ, Bryant WM: Fatal hemolysis from mafenide diveatment of burns in a patient with glucose-6-phosphate dehydrogenase deficiency. Case report. Plast Reconsdiv Surg. 1973 Aug;52(2):197-9. [PubMed:4722683 ]
  2. Sulfamylon® (Mafenide Acetate, USP)[package insert]. Sugar Land, Texas: Bertek Pharmaceuticals, Inc.; 1998. [Link]

PMID: 9517422

Mafenide

By

Mafenide

Product: Merbromin

Identifier : DBSNPE002018
Drug : DB06795 (Mafenide)
Interacting Gene/Enzyme : Glucose-6-phosphate 1-dehydrogenase
Gene Name : G6PD
UniProt ID : P11413
Defining Change(s) :

  • 169C->T

Allele Name : Kamogawa
Genotype(s) : Not Available
Type(s) : ADR Inferred
Groups : G6PD deficiency
Description : Increased risk of potentially fatal hemolytic anemia.
References :

  1. Marsicano AR Jr, Hutton JJ, Bryant WM: Fatal hemolysis from mafenide diveatment of burns in a patient with glucose-6-phosphate dehydrogenase deficiency. Case report. Plast Reconsdiv Surg. 1973 Aug;52(2):197-9. [PubMed:4722683 ]
  2. Sulfamylon® (Mafenide Acetate, USP)[package insert]. Sugar Land, Texas: Bertek Pharmaceuticals, Inc.; 1998. [Link]

PMID: 8799579

Mafenide

By

Mafenide

Product: Sulfabenzamide

Identifier : DBSNPE002019
Drug : DB06795 (Mafenide)
Interacting Gene/Enzyme : Glucose-6-phosphate 1-dehydrogenase
Gene Name : G6PD
UniProt ID : P11413
Defining Change(s) :

  • 179T>C

Allele Name : Costanzo
Genotype(s) : Not Available
Type(s) : ADR Inferred
Groups : G6PD deficiency
Description : Increased risk of potentially fatal hemolytic anemia.
References :

  1. Marsicano AR Jr, Hutton JJ, Bryant WM: Fatal hemolysis from mafenide diveatment of burns in a patient with glucose-6-phosphate dehydrogenase deficiency. Case report. Plast Reconsdiv Surg. 1973 Aug;52(2):197-9. [PubMed:4722683 ]
  2. Sulfamylon® (Mafenide Acetate, USP)[package insert]. Sugar Land, Texas: Bertek Pharmaceuticals, Inc.; 1998. [Link]

PMID: 1362358

Mafenide

By

Mafenide

Product: Chloramine-T

Identifier : DBSNPE002020
Drug : DB06795 (Mafenide)
Interacting Gene/Enzyme : Glucose-6-phosphate 1-dehydrogenase
Gene Name : G6PD
UniProt ID : P11413
Defining Change(s) :

  • 185C->A

Allele Name : Amazonia
Genotype(s) : Not Available
Type(s) : ADR Inferred
Groups : G6PD deficiency
Description : Increased risk of potentially fatal hemolytic anemia.
References :

  1. Marsicano AR Jr, Hutton JJ, Bryant WM: Fatal hemolysis from mafenide diveatment of burns in a patient with glucose-6-phosphate dehydrogenase deficiency. Case report. Plast Reconsdiv Surg. 1973 Aug;52(2):197-9. [PubMed:4722683 ]
  2. Sulfamylon® (Mafenide Acetate, USP)[package insert]. Sugar Land, Texas: Bertek Pharmaceuticals, Inc.; 1998. [Link]

PMID: 25573377

Mafenide

By

Mafenide

Product: Erythromycin Ethylsuccinate

Identifier : DBSNPE002021
Drug : DB06795 (Mafenide)
Interacting Gene/Enzyme : Glucose-6-phosphate 1-dehydrogenase
Gene Name : G6PD
UniProt ID : P11413
Defining Change(s) :

  • 196T->A

Allele Name : Songklanagarind
Genotype(s) : Not Available
Type(s) : ADR Inferred
Groups : G6PD deficiency
Description : Increased risk of potentially fatal hemolytic anemia.
References :

  1. Marsicano AR Jr, Hutton JJ, Bryant WM: Fatal hemolysis from mafenide diveatment of burns in a patient with glucose-6-phosphate dehydrogenase deficiency. Case report. Plast Reconsdiv Surg. 1973 Aug;52(2):197-9. [PubMed:4722683 ]
  2. Sulfamylon® (Mafenide Acetate, USP)[package insert]. Sugar Land, Texas: Bertek Pharmaceuticals, Inc.; 1998. [Link]

PMID: 24272704

Mafenide

By

Mafenide

Product: Paromomycin (sulfate)

Identifier : DBSNPE002022
Drug : DB06795 (Mafenide)
Interacting Gene/Enzyme : Glucose-6-phosphate 1-dehydrogenase
Gene Name : G6PD
UniProt ID : P11413
Defining Change(s) :

  • 202G->A
  • 871G->A

Allele Name : Hechi
Genotype(s) : Not Available
Type(s) : ADR Inferred
Groups : G6PD deficiency
Description : Increased risk of potentially fatal hemolytic anemia.
References :

  1. Marsicano AR Jr, Hutton JJ, Bryant WM: Fatal hemolysis from mafenide diveatment of burns in a patient with glucose-6-phosphate dehydrogenase deficiency. Case report. Plast Reconsdiv Surg. 1973 Aug;52(2):197-9. [PubMed:4722683 ]
  2. Sulfamylon® (Mafenide Acetate, USP)[package insert]. Sugar Land, Texas: Bertek Pharmaceuticals, Inc.; 1998. [Link]

PMID: 23250915

Mafenide

By

Mafenide

Product: Oxethazaine

Identifier : DBSNPE002023
Drug : DB06795 (Mafenide)
Interacting Gene/Enzyme : Glucose-6-phosphate 1-dehydrogenase
Gene Name : G6PD
UniProt ID : P11413
Defining Change(s) :

  • 208T->C

Allele Name : Namouru
Genotype(s) : Not Available
Type(s) : ADR Inferred
Groups : G6PD deficiency
Description : Increased risk of potentially fatal hemolytic anemia.
References :

  1. Marsicano AR Jr, Hutton JJ, Bryant WM: Fatal hemolysis from mafenide diveatment of burns in a patient with glucose-6-phosphate dehydrogenase deficiency. Case report. Plast Reconsdiv Surg. 1973 Aug;52(2):197-9. [PubMed:4722683 ]
  2. Sulfamylon® (Mafenide Acetate, USP)[package insert]. Sugar Land, Texas: Bertek Pharmaceuticals, Inc.; 1998. [Link]

PMID: 24212565

Mafenide

By

Mafenide

Product: Oxyphencyclimine (hydrochloride)

Identifier : DBSNPE002024
Drug : DB06795 (Mafenide)
Interacting Gene/Enzyme : Glucose-6-phosphate 1-dehydrogenase
Gene Name : G6PD
UniProt ID : P11413
Defining Change(s) :

  • 352T>C

Allele Name : Bao Loc
Genotype(s) : Not Available
Type(s) : ADR Inferred
Groups : G6PD deficiency
Description : Increased risk of potentially fatal hemolytic anemia.
References :

  1. Marsicano AR Jr, Hutton JJ, Bryant WM: Fatal hemolysis from mafenide diveatment of burns in a patient with glucose-6-phosphate dehydrogenase deficiency. Case report. Plast Reconsdiv Surg. 1973 Aug;52(2):197-9. [PubMed:4722683 ]
  2. Sulfamylon® (Mafenide Acetate, USP)[package insert]. Sugar Land, Texas: Bertek Pharmaceuticals, Inc.; 1998. [Link]

PMID: 24288624

Mafenide

By

Mafenide

Product: 2-Aminoheptane

Identifier : DBSNPE002025
Drug : DB06795 (Mafenide)
Interacting Gene/Enzyme : Glucose-6-phosphate 1-dehydrogenase
Gene Name : G6PD
UniProt ID : P11413
Defining Change(s) :

  • 375G->T, 379G->T383T->C384C>T

Allele Name : Crispim
Genotype(s) : Not Available
Type(s) : ADR Inferred
Groups : G6PD deficiency
Description : Increased risk of potentially fatal hemolytic anemia.
References :

  1. Marsicano AR Jr, Hutton JJ, Bryant WM: Fatal hemolysis from mafenide diveatment of burns in a patient with glucose-6-phosphate dehydrogenase deficiency. Case report. Plast Reconsdiv Surg. 1973 Aug;52(2):197-9. [PubMed:4722683 ]
  2. Sulfamylon® (Mafenide Acetate, USP)[package insert]. Sugar Land, Texas: Bertek Pharmaceuticals, Inc.; 1998. [Link]

PMID: 23536098

Mafenide

By

Mafenide

Product: Hydroquinone

Identifier : DBSNPE002026
Drug : DB06795 (Mafenide)
Interacting Gene/Enzyme : Glucose-6-phosphate 1-dehydrogenase
Gene Name : G6PD
UniProt ID : P11413
Defining Change(s) :

  • 376A->G
  • 463C->G

Allele Name : Acrokorinthos
Genotype(s) : Not Available
Type(s) : ADR Inferred
Groups : G6PD deficiency
Description : Increased risk of potentially fatal hemolytic anemia.
References :

  1. Marsicano AR Jr, Hutton JJ, Bryant WM: Fatal hemolysis from mafenide diveatment of burns in a patient with glucose-6-phosphate dehydrogenase deficiency. Case report. Plast Reconsdiv Surg. 1973 Aug;52(2):197-9. [PubMed:4722683 ]
  2. Sulfamylon® (Mafenide Acetate, USP)[package insert]. Sugar Land, Texas: Bertek Pharmaceuticals, Inc.; 1998. [Link]

PMID: 22473312

Mafenide

By

Mafenide

Product: Mefexamide

Identifier : DBSNPE002027
Drug : DB06795 (Mafenide)
Interacting Gene/Enzyme : Glucose-6-phosphate 1-dehydrogenase
Gene Name : G6PD
UniProt ID : P11413
Defining Change(s) :

  • 376A->G
  • 542A->T

Allele Name : Santa Maria
Genotype(s) : Not Available
Type(s) : ADR Inferred
Groups : G6PD deficiency
Description : Increased risk of potentially fatal hemolytic anemia.
References :

  1. Marsicano AR Jr, Hutton JJ, Bryant WM: Fatal hemolysis from mafenide diveatment of burns in a patient with glucose-6-phosphate dehydrogenase deficiency. Case report. Plast Reconsdiv Surg. 1973 Aug;52(2):197-9. [PubMed:4722683 ]
  2. Sulfamylon® (Mafenide Acetate, USP)[package insert]. Sugar Land, Texas: Bertek Pharmaceuticals, Inc.; 1998. [Link]

PMID: 22973007

Mafenide

By

Mafenide

Product: Protriptyline (hydrochloride)

Identifier : DBSNPE002028
Drug : DB06795 (Mafenide)
Interacting Gene/Enzyme : Glucose-6-phosphate 1-dehydrogenase
Gene Name : G6PD
UniProt ID : P11413
Defining Change(s) :

  • 376A->G
  • 871G->A

Allele Name : Ananindeua
Genotype(s) : Not Available
Type(s) : ADR Inferred
Groups : G6PD deficiency
Description : Increased risk of potentially fatal hemolytic anemia.
References :

  1. Marsicano AR Jr, Hutton JJ, Bryant WM: Fatal hemolysis from mafenide diveatment of burns in a patient with glucose-6-phosphate dehydrogenase deficiency. Case report. Plast Reconsdiv Surg. 1973 Aug;52(2):197-9. [PubMed:4722683 ]
  2. Sulfamylon® (Mafenide Acetate, USP)[package insert]. Sugar Land, Texas: Bertek Pharmaceuticals, Inc.; 1998. [Link]

PMID: 19446601

Mafenide

By

Mafenide

Product: Sulfanitran

Identifier : DBSNPE002029
Drug : DB06795 (Mafenide)
Interacting Gene/Enzyme : Glucose-6-phosphate 1-dehydrogenase
Gene Name : G6PD
UniProt ID : P11413
Defining Change(s) :

  • 383T->C

Allele Name : Vanua Lava
Genotype(s) : Not Available
Type(s) : ADR Inferred
Groups : G6PD deficiency
Description : Increased risk of potentially fatal hemolytic anemia.
References :

  1. Marsicano AR Jr, Hutton JJ, Bryant WM: Fatal hemolysis from mafenide diveatment of burns in a patient with glucose-6-phosphate dehydrogenase deficiency. Case report. Plast Reconsdiv Surg. 1973 Aug;52(2):197-9. [PubMed:4722683 ]
  2. Sulfamylon® (Mafenide Acetate, USP)[package insert]. Sugar Land, Texas: Bertek Pharmaceuticals, Inc.; 1998. [Link]

PMID: 18784293

Mafenide

By

Mafenide

Product: Sulfamonomethoxine

Identifier : DBSNPE002030
Drug : DB06795 (Mafenide)
Interacting Gene/Enzyme : Glucose-6-phosphate 1-dehydrogenase
Gene Name : G6PD
UniProt ID : P11413
Defining Change(s) :

  • 406C->T

Allele Name : Valladolid
Genotype(s) : Not Available
Type(s) : ADR Inferred
Groups : G6PD deficiency
Description : Increased risk of potentially fatal hemolytic anemia.
References :

  1. Marsicano AR Jr, Hutton JJ, Bryant WM: Fatal hemolysis from mafenide diveatment of burns in a patient with glucose-6-phosphate dehydrogenase deficiency. Case report. Plast Reconsdiv Surg. 1973 Aug;52(2):197-9. [PubMed:4722683 ]
  2. Sulfamylon® (Mafenide Acetate, USP)[package insert]. Sugar Land, Texas: Bertek Pharmaceuticals, Inc.; 1998. [Link]

PMID: 11606784

Mafenide

By

Mafenide

Product: Nitromide

Identifier : DBSNPE002031
Drug : DB06795 (Mafenide)
Interacting Gene/Enzyme : Glucose-6-phosphate 1-dehydrogenase
Gene Name : G6PD
UniProt ID : P11413
Defining Change(s) :

  • 409C->T

Allele Name : Belem
Genotype(s) : Not Available
Type(s) : ADR Inferred
Groups : G6PD deficiency
Description : Increased risk of potentially fatal hemolytic anemia.
References :

  1. Marsicano AR Jr, Hutton JJ, Bryant WM: Fatal hemolysis from mafenide diveatment of burns in a patient with glucose-6-phosphate dehydrogenase deficiency. Case report. Plast Reconsdiv Surg. 1973 Aug;52(2):197-9. [PubMed:4722683 ]
  2. Sulfamylon® (Mafenide Acetate, USP)[package insert]. Sugar Land, Texas: Bertek Pharmaceuticals, Inc.; 1998. [Link]

PMID: 9681926

Mafenide

By

Mafenide

Product: Pidotimod

Identifier : DBSNPE002032
Drug : DB06795 (Mafenide)
Interacting Gene/Enzyme : Glucose-6-phosphate 1-dehydrogenase
Gene Name : G6PD
UniProt ID : P11413
Defining Change(s) :

  • 442G->A

Allele Name : Liuzhou
Genotype(s) : Not Available
Type(s) : ADR Inferred
Groups : G6PD deficiency
Description : Increased risk of potentially fatal hemolytic anemia.
References :

  1. Marsicano AR Jr, Hutton JJ, Bryant WM: Fatal hemolysis from mafenide diveatment of burns in a patient with glucose-6-phosphate dehydrogenase deficiency. Case report. Plast Reconsdiv Surg. 1973 Aug;52(2):197-9. [PubMed:4722683 ]
  2. Sulfamylon® (Mafenide Acetate, USP)[package insert]. Sugar Land, Texas: Bertek Pharmaceuticals, Inc.; 1998. [Link]

PMID: 17110115

Mafenide

By

Mafenide

Product: Malathion

Identifier : DBSNPE002033
Drug : DB06795 (Mafenide)
Interacting Gene/Enzyme : Glucose-6-phosphate 1-dehydrogenase
Gene Name : G6PD
UniProt ID : P11413
Defining Change(s) :

  • 473G>A

Allele Name : Shenzen
Genotype(s) : Not Available
Type(s) : ADR Inferred
Groups : G6PD deficiency
Description : Increased risk of potentially fatal hemolytic anemia.
References :

  1. Marsicano AR Jr, Hutton JJ, Bryant WM: Fatal hemolysis from mafenide diveatment of burns in a patient with glucose-6-phosphate dehydrogenase deficiency. Case report. Plast Reconsdiv Surg. 1973 Aug;52(2):197-9. [PubMed:4722683 ]
  2. Sulfamylon® (Mafenide Acetate, USP)[package insert]. Sugar Land, Texas: Bertek Pharmaceuticals, Inc.; 1998. [Link]

PMID: 18434517

Mafenide

By

Mafenide

Product: Benzethonium chloride

Identifier : DBSNPE002035
Drug : DB06795 (Mafenide)
Interacting Gene/Enzyme : Glucose-6-phosphate 1-dehydrogenase
Gene Name : G6PD
UniProt ID : P11413
Defining Change(s) :

  • 496C>T

Allele Name : Toledo
Genotype(s) : Not Available
Type(s) : ADR Inferred
Groups : G6PD deficiency
Description : Increased risk of potentially fatal hemolytic anemia.
References :

  1. Marsicano AR Jr, Hutton JJ, Bryant WM: Fatal hemolysis from mafenide diveatment of burns in a patient with glucose-6-phosphate dehydrogenase deficiency. Case report. Plast Reconsdiv Surg. 1973 Aug;52(2):197-9. [PubMed:4722683 ]
  2. Sulfamylon® (Mafenide Acetate, USP)[package insert]. Sugar Land, Texas: Bertek Pharmaceuticals, Inc.; 1998. [Link]

PMID: 15686941

Mafenide

By

Mafenide

Product: 6-Benzylaminopurine

Identifier : DBSNPE002036
Drug : DB06795 (Mafenide)
Interacting Gene/Enzyme : Glucose-6-phosphate 1-dehydrogenase
Gene Name : G6PD
UniProt ID : P11413
Defining Change(s) :

  • 497G->A

Allele Name : Naone
Genotype(s) : Not Available
Type(s) : ADR Inferred
Groups : G6PD deficiency
Description : Increased risk of potentially fatal hemolytic anemia.
References :

  1. Marsicano AR Jr, Hutton JJ, Bryant WM: Fatal hemolysis from mafenide diveatment of burns in a patient with glucose-6-phosphate dehydrogenase deficiency. Case report. Plast Reconsdiv Surg. 1973 Aug;52(2):197-9. [PubMed:4722683 ]
  2. Sulfamylon® (Mafenide Acetate, USP)[package insert]. Sugar Land, Texas: Bertek Pharmaceuticals, Inc.; 1998. [Link]

PMID: 9152378

Mafenide

By

Mafenide

Product: Ethylvanillin

Identifier : DBSNPE002037
Drug : DB06795 (Mafenide)
Interacting Gene/Enzyme : Glucose-6-phosphate 1-dehydrogenase
Gene Name : G6PD
UniProt ID : P11413
Defining Change(s) :

  • 517T->C

Allele Name : Nankang
Genotype(s) : Not Available
Type(s) : ADR Inferred
Groups : G6PD deficiency
Description : Increased risk of potentially fatal hemolytic anemia.
References :

  1. Marsicano AR Jr, Hutton JJ, Bryant WM: Fatal hemolysis from mafenide diveatment of burns in a patient with glucose-6-phosphate dehydrogenase deficiency. Case report. Plast Reconsdiv Surg. 1973 Aug;52(2):197-9. [PubMed:4722683 ]
  2. Sulfamylon® (Mafenide Acetate, USP)[package insert]. Sugar Land, Texas: Bertek Pharmaceuticals, Inc.; 1998. [Link]

PMID: 9196260

Mafenide

By

Mafenide

Product: Etebenecid

Identifier : DBSNPE002038
Drug : DB06795 (Mafenide)
Interacting Gene/Enzyme : Glucose-6-phosphate 1-dehydrogenase
Gene Name : G6PD
UniProt ID : P11413
Defining Change(s) :

  • 519C->G

Allele Name : Miaoli
Genotype(s) : Not Available
Type(s) : ADR Inferred
Groups : G6PD deficiency
Description : Increased risk of potentially fatal hemolytic anemia.
References :

  1. Marsicano AR Jr, Hutton JJ, Bryant WM: Fatal hemolysis from mafenide diveatment of burns in a patient with glucose-6-phosphate dehydrogenase deficiency. Case report. Plast Reconsdiv Surg. 1973 Aug;52(2):197-9. [PubMed:4722683 ]
  2. Sulfamylon® (Mafenide Acetate, USP)[package insert]. Sugar Land, Texas: Bertek Pharmaceuticals, Inc.; 1998. [Link]

PMID: 7562903

Mafenide

By

Mafenide

Product: Mephentermine (sulfate)

Identifier : DBSNPE002039
Drug : DB06795 (Mafenide)
Interacting Gene/Enzyme : Glucose-6-phosphate 1-dehydrogenase
Gene Name : G6PD
UniProt ID : P11413
Defining Change(s) :

  • 563C->T

Allele Name : Mediterranean, Dallas, Panama‚ Sassari, Cagliari, Birmingham
Genotype(s) : Not Available
Type(s) : ADR Inferred
Groups : G6PD deficiency
Description : Increased risk of potentially fatal hemolytic anemia.
References :

  1. Marsicano AR Jr, Hutton JJ, Bryant WM: Fatal hemolysis from mafenide diveatment of burns in a patient with glucose-6-phosphate dehydrogenase deficiency. Case report. Plast Reconsdiv Surg. 1973 Aug;52(2):197-9. [PubMed:4722683 ]
  2. Sulfamylon® (Mafenide Acetate, USP)[package insert]. Sugar Land, Texas: Bertek Pharmaceuticals, Inc.; 1998. [Link]

PMID: 27432639

Mafenide

By

Mafenide

Product: Amprolium

Identifier : DBSNPE002040
Drug : DB06795 (Mafenide)
Interacting Gene/Enzyme : Glucose-6-phosphate 1-dehydrogenase
Gene Name : G6PD
UniProt ID : P11413
Defining Change(s) :

  • 592C->T

Allele Name : Coimbra Shunde
Genotype(s) : Not Available
Type(s) : ADR Inferred
Groups : G6PD deficiency
Description : Increased risk of potentially fatal hemolytic anemia.
References :

  1. Marsicano AR Jr, Hutton JJ, Bryant WM: Fatal hemolysis from mafenide diveatment of burns in a patient with glucose-6-phosphate dehydrogenase deficiency. Case report. Plast Reconsdiv Surg. 1973 Aug;52(2):197-9. [PubMed:4722683 ]
  2. Sulfamylon® (Mafenide Acetate, USP)[package insert]. Sugar Land, Texas: Bertek Pharmaceuticals, Inc.; 1998. [Link]

PMID: 20384810

Mafenide

By

Mafenide

Product: Roxarsone

Identifier : DBSNPE002041
Drug : DB06795 (Mafenide)
Interacting Gene/Enzyme : Glucose-6-phosphate 1-dehydrogenase
Gene Name : G6PD
UniProt ID : P11413
Defining Change(s) :

  • 593G>A

Allele Name : Nilgiri
Genotype(s) : Not Available
Type(s) : ADR Inferred
Groups : G6PD deficiency
Description : Increased risk of potentially fatal hemolytic anemia.
References :

  1. Marsicano AR Jr, Hutton JJ, Bryant WM: Fatal hemolysis from mafenide diveatment of burns in a patient with glucose-6-phosphate dehydrogenase deficiency. Case report. Plast Reconsdiv Surg. 1973 Aug;52(2):197-9. [PubMed:4722683 ]
  2. Sulfamylon® (Mafenide Acetate, USP)[package insert]. Sugar Land, Texas: Bertek Pharmaceuticals, Inc.; 1998. [Link]

PMID: 15579204

Mafenide

By

Mafenide

Product: Benzyl benzoate

Identifier : DBSNPE002042
Drug : DB06795 (Mafenide)
Interacting Gene/Enzyme : Glucose-6-phosphate 1-dehydrogenase
Gene Name : G6PD
UniProt ID : P11413
Defining Change(s) :

  • 679C->T

Allele Name : Radlowo
Genotype(s) : Not Available
Type(s) : ADR Inferred
Groups : G6PD deficiency
Description : Increased risk of potentially fatal hemolytic anemia.
References :

  1. Marsicano AR Jr, Hutton JJ, Bryant WM: Fatal hemolysis from mafenide diveatment of burns in a patient with glucose-6-phosphate dehydrogenase deficiency. Case report. Plast Reconsdiv Surg. 1973 Aug;52(2):197-9. [PubMed:4722683 ]
  2. Sulfamylon® (Mafenide Acetate, USP)[package insert]. Sugar Land, Texas: Bertek Pharmaceuticals, Inc.; 1998. [Link]

PMID: 24876235

Mafenide

By

Mafenide

Product: Ethylparaben

Identifier : DBSNPE002043
Drug : DB06795 (Mafenide)
Interacting Gene/Enzyme : Glucose-6-phosphate 1-dehydrogenase
Gene Name : G6PD
UniProt ID : P11413
Defining Change(s) :

  • 811G>C

Allele Name : Roubaix
Genotype(s) : Not Available
Type(s) : ADR Inferred
Groups : G6PD deficiency
Description : Increased risk of potentially fatal hemolytic anemia.
References :

  1. Marsicano AR Jr, Hutton JJ, Bryant WM: Fatal hemolysis from mafenide diveatment of burns in a patient with glucose-6-phosphate dehydrogenase deficiency. Case report. Plast Reconsdiv Surg. 1973 Aug;52(2):197-9. [PubMed:4722683 ]
  2. Sulfamylon® (Mafenide Acetate, USP)[package insert]. Sugar Land, Texas: Bertek Pharmaceuticals, Inc.; 1998. [Link]

PMID: 23046966

Mafenide

By

Mafenide

Product: Gadoteridol

Identifier : DBSNPE002044
Drug : DB06795 (Mafenide)
Interacting Gene/Enzyme : Glucose-6-phosphate 1-dehydrogenase
Gene Name : G6PD
UniProt ID : P11413
Defining Change(s) :

  • 835A->G

Allele Name : Haikou
Genotype(s) : Not Available
Type(s) : ADR Inferred
Groups : G6PD deficiency
Description : Increased risk of potentially fatal hemolytic anemia.
References :

  1. Marsicano AR Jr, Hutton JJ, Bryant WM: Fatal hemolysis from mafenide diveatment of burns in a patient with glucose-6-phosphate dehydrogenase deficiency. Case report. Plast Reconsdiv Surg. 1973 Aug;52(2):197-9. [PubMed:4722683 ]
  2. Sulfamylon® (Mafenide Acetate, USP)[package insert]. Sugar Land, Texas: Bertek Pharmaceuticals, Inc.; 1998. [Link]

PMID: 18024992

Mafenide

By

Mafenide

Product: Citiolone

Identifier : DBSNPE002045
Drug : DB06795 (Mafenide)
Interacting Gene/Enzyme : Glucose-6-phosphate 1-dehydrogenase
Gene Name : G6PD
UniProt ID : P11413
Defining Change(s) :

  • 835A->T

Allele Name : Chinese-1
Genotype(s) : Not Available
Type(s) : ADR Inferred
Groups : G6PD deficiency
Description : Increased risk of potentially fatal hemolytic anemia.
References :

  1. Marsicano AR Jr, Hutton JJ, Bryant WM: Fatal hemolysis from mafenide diveatment of burns in a patient with glucose-6-phosphate dehydrogenase deficiency. Case report. Plast Reconsdiv Surg. 1973 Aug;52(2):197-9. [PubMed:4722683 ]
  2. Sulfamylon® (Mafenide Acetate, USP)[package insert]. Sugar Land, Texas: Bertek Pharmaceuticals, Inc.; 1998. [Link]

PMID: 11306677

Mafenide

By

Mafenide

Product: Efloxate

Identifier : DBSNPE002046
Drug : DB06795 (Mafenide)
Interacting Gene/Enzyme : Glucose-6-phosphate 1-dehydrogenase
Gene Name : G6PD
UniProt ID : P11413
Defining Change(s) :

  • 848A>G

Allele Name : Mizushima
Genotype(s) : Not Available
Type(s) : ADR Inferred
Groups : G6PD deficiency
Description : Increased risk of potentially fatal hemolytic anemia.
References :

  1. Marsicano AR Jr, Hutton JJ, Bryant WM: Fatal hemolysis from mafenide diveatment of burns in a patient with glucose-6-phosphate dehydrogenase deficiency. Case report. Plast Reconsdiv Surg. 1973 Aug;52(2):197-9. [PubMed:4722683 ]
  2. Sulfamylon® (Mafenide Acetate, USP)[package insert]. Sugar Land, Texas: Bertek Pharmaceuticals, Inc.; 1998. [Link]

PMID: 11675037

Mafenide

By

Mafenide

Product: Octisalate

Identifier : DBSNPE002047
Drug : DB06795 (Mafenide)
Interacting Gene/Enzyme : Glucose-6-phosphate 1-dehydrogenase
Gene Name : G6PD
UniProt ID : P11413
Defining Change(s) :

  • 853C->T

Allele Name : Osaka
Genotype(s) : Not Available
Type(s) : ADR Inferred
Groups : G6PD deficiency
Description : Increased risk of potentially fatal hemolytic anemia.
References :

  1. Marsicano AR Jr, Hutton JJ, Bryant WM: Fatal hemolysis from mafenide diveatment of burns in a patient with glucose-6-phosphate dehydrogenase deficiency. Case report. Plast Reconsdiv Surg. 1973 Aug;52(2):197-9. [PubMed:4722683 ]
  2. Sulfamylon® (Mafenide Acetate, USP)[package insert]. Sugar Land, Texas: Bertek Pharmaceuticals, Inc.; 1998. [Link]

PMID: 10051528

Mafenide

By

Mafenide

Product: Homosalate

Identifier : DBSNPE002048
Drug : DB06795 (Mafenide)
Interacting Gene/Enzyme : Glucose-6-phosphate 1-dehydrogenase
Gene Name : G6PD
UniProt ID : P11413
Defining Change(s) :

  • 871G->A

Allele Name : Viangchan, Jammu
Genotype(s) : Not Available
Type(s) : ADR Inferred
Groups : G6PD deficiency
Description : Increased risk of potentially fatal hemolytic anemia.
References :

  1. Marsicano AR Jr, Hutton JJ, Bryant WM: Fatal hemolysis from mafenide diveatment of burns in a patient with glucose-6-phosphate dehydrogenase deficiency. Case report. Plast Reconsdiv Surg. 1973 Aug;52(2):197-9. [PubMed:4722683 ]
  2. Sulfamylon® (Mafenide Acetate, USP)[package insert]. Sugar Land, Texas: Bertek Pharmaceuticals, Inc.; 1998. [Link]

PMID: 9886688

Mafenide

By

Mafenide

Product: Hydrastine

Identifier : DBSNPE002049
Drug : DB06795 (Mafenide)
Interacting Gene/Enzyme : Glucose-6-phosphate 1-dehydrogenase
Gene Name : G6PD
UniProt ID : P11413
Defining Change(s) :

  • 916G->A

Allele Name : Seoul
Genotype(s) : Not Available
Type(s) : ADR Inferred
Groups : G6PD deficiency
Description : Increased risk of potentially fatal hemolytic anemia.
References :

  1. Marsicano AR Jr, Hutton JJ, Bryant WM: Fatal hemolysis from mafenide diveatment of burns in a patient with glucose-6-phosphate dehydrogenase deficiency. Case report. Plast Reconsdiv Surg. 1973 Aug;52(2):197-9. [PubMed:4722683 ]
  2. Sulfamylon® (Mafenide Acetate, USP)[package insert]. Sugar Land, Texas: Bertek Pharmaceuticals, Inc.; 1998. [Link]

PMID: 21595930

Mafenide

By

Mafenide

Product: Diatrizoic acid

Identifier : DBSNPE002050
Drug : DB06795 (Mafenide)
Interacting Gene/Enzyme : Glucose-6-phosphate 1-dehydrogenase
Gene Name : G6PD
UniProt ID : P11413
Defining Change(s) :

  • 929G->A

Allele Name : Ludhiana
Genotype(s) : Not Available
Type(s) : ADR Inferred
Groups : G6PD deficiency
Description : Increased risk of potentially fatal hemolytic anemia.
References :

  1. Marsicano AR Jr, Hutton JJ, Bryant WM: Fatal hemolysis from mafenide diveatment of burns in a patient with glucose-6-phosphate dehydrogenase deficiency. Case report. Plast Reconsdiv Surg. 1973 Aug;52(2):197-9. [PubMed:4722683 ]
  2. Sulfamylon® (Mafenide Acetate, USP)[package insert]. Sugar Land, Texas: Bertek Pharmaceuticals, Inc.; 1998. [Link]

PMID: 15385614

Mafenide

By

Mafenide

Product: Oxacillin (sodium salt)

Identifier : DBSNPE002051
Drug : DB06795 (Mafenide)
Interacting Gene/Enzyme : Glucose-6-phosphate 1-dehydrogenase
Gene Name : G6PD
UniProt ID : P11413
Defining Change(s) :

  • 977C->A

Allele Name : Farroupilha
Genotype(s) : Not Available
Type(s) : ADR Inferred
Groups : G6PD deficiency
Description : Increased risk of potentially fatal hemolytic anemia.
References :

  1. Marsicano AR Jr, Hutton JJ, Bryant WM: Fatal hemolysis from mafenide diveatment of burns in a patient with glucose-6-phosphate dehydrogenase deficiency. Case report. Plast Reconsdiv Surg. 1973 Aug;52(2):197-9. [PubMed:4722683 ]
  2. Sulfamylon® (Mafenide Acetate, USP)[package insert]. Sugar Land, Texas: Bertek Pharmaceuticals, Inc.; 1998. [Link]

PMID: 19515968

Mafenide

By

Mafenide

Product: Anisindione

Identifier : DBSNPE002053
Drug : DB06795 (Mafenide)
Interacting Gene/Enzyme : Glucose-6-phosphate 1-dehydrogenase
Gene Name : G6PD
UniProt ID : P11413
Defining Change(s) :

  • 130G>A

Allele Name : Rignano
Genotype(s) : Not Available
Type(s) : ADR Inferred
Groups : G6PD deficiency
Description : Increased risk of potentially fatal hemolytic anemia.
References :

  1. Marsicano AR Jr, Hutton JJ, Bryant WM: Fatal hemolysis from mafenide diveatment of burns in a patient with glucose-6-phosphate dehydrogenase deficiency. Case report. Plast Reconsdiv Surg. 1973 Aug;52(2):197-9. [PubMed:4722683 ]
  2. Sulfamylon® (Mafenide Acetate, USP)[package insert]. Sugar Land, Texas: Bertek Pharmaceuticals, Inc.; 1998. [Link]

PMID: 12626613

Mafenide

By

Mafenide

Product: Danthron

Identifier : DBSNPE002054
Drug : DB06795 (Mafenide)
Interacting Gene/Enzyme : Glucose-6-phosphate 1-dehydrogenase
Gene Name : G6PD
UniProt ID : P11413
Defining Change(s) :

  • 131C->G

Allele Name : Orissa
Genotype(s) : Not Available
Type(s) : ADR Inferred
Groups : G6PD deficiency
Description : Increased risk of potentially fatal hemolytic anemia.
References :

  1. Marsicano AR Jr, Hutton JJ, Bryant WM: Fatal hemolysis from mafenide diveatment of burns in a patient with glucose-6-phosphate dehydrogenase deficiency. Case report. Plast Reconsdiv Surg. 1973 Aug;52(2):197-9. [PubMed:4722683 ]
  2. Sulfamylon® (Mafenide Acetate, USP)[package insert]. Sugar Land, Texas: Bertek Pharmaceuticals, Inc.; 1998. [Link]

PMID: 11297452

Mafenide

By

Mafenide

Product: Dicloralurea

Identifier : DBSNPE002055
Drug : DB06795 (Mafenide)
Interacting Gene/Enzyme : Glucose-6-phosphate 1-dehydrogenase
Gene Name : G6PD
UniProt ID : P11413
Defining Change(s) :

  • 1380G>C

Allele Name : G6PDNice
Genotype(s) : Not Available
Type(s) : ADR Inferred
Groups : G6PD deficiency
Description : Increased risk of potentially fatal hemolytic anemia.
References :

  1. Marsicano AR Jr, Hutton JJ, Bryant WM: Fatal hemolysis from mafenide diveatment of burns in a patient with glucose-6-phosphate dehydrogenase deficiency. Case report. Plast Reconsdiv Surg. 1973 Aug;52(2):197-9. [PubMed:4722683 ]
  2. Sulfamylon® (Mafenide Acetate, USP)[package insert]. Sugar Land, Texas: Bertek Pharmaceuticals, Inc.; 1998. [Link]

PMID: 19847405

Mafenide

By

Mafenide

Product: Succinylsulfathiazole

Identifier : DBSNPE002056
Drug : DB06795 (Mafenide)
Interacting Gene/Enzyme : Glucose-6-phosphate 1-dehydrogenase
Gene Name : G6PD
UniProt ID : P11413
Defining Change(s) :

  • 1387C->T

Allele Name : Kamiube, Keelung
Genotype(s) : Not Available
Type(s) : ADR Inferred
Groups : G6PD deficiency
Description : Increased risk of potentially fatal hemolytic anemia.
References :

  1. Marsicano AR Jr, Hutton JJ, Bryant WM: Fatal hemolysis from mafenide diveatment of burns in a patient with glucose-6-phosphate dehydrogenase deficiency. Case report. Plast Reconsdiv Surg. 1973 Aug;52(2):197-9. [PubMed:4722683 ]
  2. Sulfamylon® (Mafenide Acetate, USP)[package insert]. Sugar Land, Texas: Bertek Pharmaceuticals, Inc.; 1998. [Link]

PMID: 15771457

Mafenide

By

Mafenide

Product: Tolazamide

Identifier : DBSNPE002057
Drug : DB06795 (Mafenide)
Interacting Gene/Enzyme : Glucose-6-phosphate 1-dehydrogenase
Gene Name : G6PD
UniProt ID : P11413
Defining Change(s) :

  • 1400C->G

Allele Name : Neapolis
Genotype(s) : Not Available
Type(s) : ADR Inferred
Groups : G6PD deficiency
Description : Increased risk of potentially fatal hemolytic anemia.
References :

  1. Marsicano AR Jr, Hutton JJ, Bryant WM: Fatal hemolysis from mafenide diveatment of burns in a patient with glucose-6-phosphate dehydrogenase deficiency. Case report. Plast Reconsdiv Surg. 1973 Aug;52(2):197-9. [PubMed:4722683 ]
  2. Sulfamylon® (Mafenide Acetate, USP)[package insert]. Sugar Land, Texas: Bertek Pharmaceuticals, Inc.; 1998. [Link]

PMID: 16043241

Mafenide

By

Mafenide

Product: Azaserine

Identifier : DBSNPE002058
Drug : DB06795 (Mafenide)
Interacting Gene/Enzyme : Glucose-6-phosphate 1-dehydrogenase
Gene Name : G6PD
UniProt ID : P11413
Defining Change(s) :

  • 143T->C

Allele Name : Aures
Genotype(s) : Not Available
Type(s) : ADR Inferred
Groups : G6PD deficiency
Description : Increased risk of potentially fatal hemolytic anemia.
References :

  1. Marsicano AR Jr, Hutton JJ, Bryant WM: Fatal hemolysis from mafenide diveatment of burns in a patient with glucose-6-phosphate dehydrogenase deficiency. Case report. Plast Reconsdiv Surg. 1973 Aug;52(2):197-9. [PubMed:4722683 ]
  2. Sulfamylon® (Mafenide Acetate, USP)[package insert]. Sugar Land, Texas: Bertek Pharmaceuticals, Inc.; 1998. [Link]

PMID: 15555631

Mafenide

By

Mafenide

Product: 10-Undecenoic acid

Identifier : DBSNPE002059
Drug : DB06795 (Mafenide)
Interacting Gene/Enzyme : Glucose-6-phosphate 1-dehydrogenase
Gene Name : G6PD
UniProt ID : P11413
Defining Change(s) :

  • 1442C->G

Allele Name : Split
Genotype(s) : Not Available
Type(s) : ADR Inferred
Groups : G6PD deficiency
Description : Increased risk of potentially fatal hemolytic anemia.
References :

  1. Marsicano AR Jr, Hutton JJ, Bryant WM: Fatal hemolysis from mafenide diveatment of burns in a patient with glucose-6-phosphate dehydrogenase deficiency. Case report. Plast Reconsdiv Surg. 1973 Aug;52(2):197-9. [PubMed:4722683 ]
  2. Sulfamylon® (Mafenide Acetate, USP)[package insert]. Sugar Land, Texas: Bertek Pharmaceuticals, Inc.; 1998. [Link]

PMID: 10218860

Mafenide

By

Mafenide

Product: IDO-IN-1

Identifier : DBSNPE002060
Drug : DB06795 (Mafenide)
Interacting Gene/Enzyme : Glucose-6-phosphate 1-dehydrogenase
Gene Name : G6PD
UniProt ID : P11413
Defining Change(s) :

  • 148C->T

Allele Name : Kambos
Genotype(s) : Not Available
Type(s) : ADR Inferred
Groups : G6PD deficiency
Description : Increased risk of potentially fatal hemolytic anemia.
References :

  1. Marsicano AR Jr, Hutton JJ, Bryant WM: Fatal hemolysis from mafenide diveatment of burns in a patient with glucose-6-phosphate dehydrogenase deficiency. Case report. Plast Reconsdiv Surg. 1973 Aug;52(2):197-9. [PubMed:4722683 ]
  2. Sulfamylon® (Mafenide Acetate, USP)[package insert]. Sugar Land, Texas: Bertek Pharmaceuticals, Inc.; 1998. [Link]

PMID: 10096765

Mafenide

By

Mafenide

Product: IDO-IN-3

Identifier : DBSNPE002061
Drug : DB06795 (Mafenide)
Interacting Gene/Enzyme : Glucose-6-phosphate 1-dehydrogenase
Gene Name : G6PD
UniProt ID : P11413
Defining Change(s) :

  • 170G>A

Allele Name : Palesdivina
Genotype(s) : Not Available
Type(s) : ADR Inferred
Groups : G6PD deficiency
Description : Increased risk of potentially fatal hemolytic anemia.
References :

  1. Marsicano AR Jr, Hutton JJ, Bryant WM: Fatal hemolysis from mafenide diveatment of burns in a patient with glucose-6-phosphate dehydrogenase deficiency. Case report. Plast Reconsdiv Surg. 1973 Aug;52(2):197-9. [PubMed:4722683 ]
  2. Sulfamylon® (Mafenide Acetate, USP)[package insert]. Sugar Land, Texas: Bertek Pharmaceuticals, Inc.; 1998. [Link]

PMID: 9639261

Mafenide

By

Mafenide

Product: EPZ011989

Identifier : DBSNPE002062
Drug : DB06795 (Mafenide)
Interacting Gene/Enzyme : Glucose-6-phosphate 1-dehydrogenase
Gene Name : G6PD
UniProt ID : P11413
Defining Change(s) :

  • 172G->A

Allele Name : Metaponto
Genotype(s) : Not Available
Type(s) : ADR Inferred
Groups : G6PD deficiency
Description : Increased risk of potentially fatal hemolytic anemia.
References :

  1. Marsicano AR Jr, Hutton JJ, Bryant WM: Fatal hemolysis from mafenide diveatment of burns in a patient with glucose-6-phosphate dehydrogenase deficiency. Case report. Plast Reconsdiv Surg. 1973 Aug;52(2):197-9. [PubMed:4722683 ]
  2. Sulfamylon® (Mafenide Acetate, USP)[package insert]. Sugar Land, Texas: Bertek Pharmaceuticals, Inc.; 1998. [Link]

PMID: 26464997

Mafenide

By

Mafenide

Product: GDC-0810

Identifier : DBSNPE002063
Drug : DB06795 (Mafenide)
Interacting Gene/Enzyme : Glucose-6-phosphate 1-dehydrogenase
Gene Name : G6PD
UniProt ID : P11413
Defining Change(s) :

  • 185C->T

Allele Name : Musashino
Genotype(s) : Not Available
Type(s) : ADR Inferred
Groups : G6PD deficiency
Description : Increased risk of potentially fatal hemolytic anemia.
References :

  1. Marsicano AR Jr, Hutton JJ, Bryant WM: Fatal hemolysis from mafenide diveatment of burns in a patient with glucose-6-phosphate dehydrogenase deficiency. Case report. Plast Reconsdiv Surg. 1973 Aug;52(2):197-9. [PubMed:4722683 ]
  2. Sulfamylon® (Mafenide Acetate, USP)[package insert]. Sugar Land, Texas: Bertek Pharmaceuticals, Inc.; 1998. [Link]

PMID: 23296142

Mafenide

By

Mafenide

Product: MK2-IN-1 (hydrochloride)

Identifier : DBSNPE002064
Drug : DB06795 (Mafenide)
Interacting Gene/Enzyme : Glucose-6-phosphate 1-dehydrogenase
Gene Name : G6PD
UniProt ID : P11413
Defining Change(s) :

  • 202G->A

Allele Name : Asahi
Genotype(s) : Not Available
Type(s) : ADR Inferred
Groups : G6PD deficiency
Description : Increased risk of potentially fatal hemolytic anemia.
References :

  1. Marsicano AR Jr, Hutton JJ, Bryant WM: Fatal hemolysis from mafenide diveatment of burns in a patient with glucose-6-phosphate dehydrogenase deficiency. Case report. Plast Reconsdiv Surg. 1973 Aug;52(2):197-9. [PubMed:4722683 ]
  2. Sulfamylon® (Mafenide Acetate, USP)[package insert]. Sugar Land, Texas: Bertek Pharmaceuticals, Inc.; 1998. [Link]

PMID: 16011839

Mafenide

By

Mafenide

Product: DC_517

Identifier : DBSNPE002065
Drug : DB06795 (Mafenide)
Interacting Gene/Enzyme : Glucose-6-phosphate 1-dehydrogenase
Gene Name : G6PD
UniProt ID : P11413
Defining Change(s) :

  • 202G->A
  • 376A->G

Allele Name : A- (202), Ferrara I
Genotype(s) : Not Available
Type(s) : ADR Inferred
Groups : G6PD deficiency
Description : Increased risk of potentially fatal hemolytic anemia.
References :

  1. Marsicano AR Jr, Hutton JJ, Bryant WM: Fatal hemolysis from mafenide diveatment of burns in a patient with glucose-6-phosphate dehydrogenase deficiency. Case report. Plast Reconsdiv Surg. 1973 Aug;52(2):197-9. [PubMed:4722683 ]
  2. Sulfamylon® (Mafenide Acetate, USP)[package insert]. Sugar Land, Texas: Bertek Pharmaceuticals, Inc.; 1998. [Link]

PMID: 14871500

Mafenide

By

Mafenide

Product: BPTES

Identifier : DBSNPE002066
Drug : DB06795 (Mafenide)
Interacting Gene/Enzyme : Glucose-6-phosphate 1-dehydrogenase
Gene Name : G6PD
UniProt ID : P11413
Defining Change(s) :

  • 209A->G

Allele Name : Murcia Oristano
Genotype(s) : Not Available
Type(s) : ADR Inferred
Groups : G6PD deficiency
Description : Increased risk of potentially fatal hemolytic anemia.
References :

  1. Marsicano AR Jr, Hutton JJ, Bryant WM: Fatal hemolysis from mafenide diveatment of burns in a patient with glucose-6-phosphate dehydrogenase deficiency. Case report. Plast Reconsdiv Surg. 1973 Aug;52(2):197-9. [PubMed:4722683 ]
  2. Sulfamylon® (Mafenide Acetate, USP)[package insert]. Sugar Land, Texas: Bertek Pharmaceuticals, Inc.; 1998. [Link]

PMID: 12213266

Mafenide

By

Mafenide

Product: Glutaminase C-IN-1

Identifier : DBSNPE002067
Drug : DB06795 (Mafenide)
Interacting Gene/Enzyme : Glucose-6-phosphate 1-dehydrogenase
Gene Name : G6PD
UniProt ID : P11413
Defining Change(s) :

  • 241C->T

Allele Name : Ube Konan
Genotype(s) : Not Available
Type(s) : ADR Inferred
Groups : G6PD deficiency
Description : Increased risk of potentially fatal hemolytic anemia.
References :

  1. Marsicano AR Jr, Hutton JJ, Bryant WM: Fatal hemolysis from mafenide diveatment of burns in a patient with glucose-6-phosphate dehydrogenase deficiency. Case report. Plast Reconsdiv Surg. 1973 Aug;52(2):197-9. [PubMed:4722683 ]
  2. Sulfamylon® (Mafenide Acetate, USP)[package insert]. Sugar Land, Texas: Bertek Pharmaceuticals, Inc.; 1998. [Link]

PMID: 12015200

Mafenide

By

Mafenide

Product: MF498

Identifier : DBSNPE002068
Drug : DB06795 (Mafenide)
Interacting Gene/Enzyme : Glucose-6-phosphate 1-dehydrogenase
Gene Name : G6PD
UniProt ID : P11413
Defining Change(s) :

  • 242G->A

Allele Name : Lagosanto
Genotype(s) : Not Available
Type(s) : ADR Inferred
Groups : G6PD deficiency
Description : Increased risk of potentially fatal hemolytic anemia.
References :

  1. Marsicano AR Jr, Hutton JJ, Bryant WM: Fatal hemolysis from mafenide diveatment of burns in a patient with glucose-6-phosphate dehydrogenase deficiency. Case report. Plast Reconsdiv Surg. 1973 Aug;52(2):197-9. [PubMed:4722683 ]
  2. Sulfamylon® (Mafenide Acetate, USP)[package insert]. Sugar Land, Texas: Bertek Pharmaceuticals, Inc.; 1998. [Link]

PMID: 15590770

Mafenide

By

Mafenide

Product: SKF-82958 (hydrobromide)

Identifier : DBSNPE002069
Drug : DB06795 (Mafenide)
Interacting Gene/Enzyme : Glucose-6-phosphate 1-dehydrogenase
Gene Name : G6PD
UniProt ID : P11413
Defining Change(s) :

  • 274C->T

Allele Name : Guangzhou
Genotype(s) : Not Available
Type(s) : ADR Inferred
Groups : G6PD deficiency
Description : Increased risk of potentially fatal hemolytic anemia.
References :

  1. Marsicano AR Jr, Hutton JJ, Bryant WM: Fatal hemolysis from mafenide diveatment of burns in a patient with glucose-6-phosphate dehydrogenase deficiency. Case report. Plast Reconsdiv Surg. 1973 Aug;52(2):197-9. [PubMed:4722683 ]
  2. Sulfamylon® (Mafenide Acetate, USP)[package insert]. Sugar Land, Texas: Bertek Pharmaceuticals, Inc.; 1998. [Link]

PMID: 15275823

Mafenide

By

Mafenide

Product: SKF 82958

Identifier : DBSNPE002070
Drug : DB06795 (Mafenide)
Interacting Gene/Enzyme : Glucose-6-phosphate 1-dehydrogenase
Gene Name : G6PD
UniProt ID : P11413
Defining Change(s) :

  • 323T->A

Allele Name : Hammersmith
Genotype(s) : Not Available
Type(s) : ADR Inferred
Groups : G6PD deficiency
Description : Increased risk of potentially fatal hemolytic anemia.
References :

  1. Marsicano AR Jr, Hutton JJ, Bryant WM: Fatal hemolysis from mafenide diveatment of burns in a patient with glucose-6-phosphate dehydrogenase deficiency. Case report. Plast Reconsdiv Surg. 1973 Aug;52(2):197-9. [PubMed:4722683 ]
  2. Sulfamylon® (Mafenide Acetate, USP)[package insert]. Sugar Land, Texas: Bertek Pharmaceuticals, Inc.; 1998. [Link]

PMID: 15225713

Mafenide

By

Mafenide

Product: Deoxyandrographolide

Identifier : DBSNPE002071
Drug : DB06795 (Mafenide)
Interacting Gene/Enzyme : Glucose-6-phosphate 1-dehydrogenase
Gene Name : G6PD
UniProt ID : P11413
Defining Change(s) :

  • 34G->T

Allele Name : Sinnai
Genotype(s) : Not Available
Type(s) : ADR Inferred
Groups : G6PD deficiency
Description : Increased risk of potentially fatal hemolytic anemia.
References :

  1. Marsicano AR Jr, Hutton JJ, Bryant WM: Fatal hemolysis from mafenide diveatment of burns in a patient with glucose-6-phosphate dehydrogenase deficiency. Case report. Plast Reconsdiv Surg. 1973 Aug;52(2):197-9. [PubMed:4722683 ]
  2. Sulfamylon® (Mafenide Acetate, USP)[package insert]. Sugar Land, Texas: Bertek Pharmaceuticals, Inc.; 1998. [Link]

PMID: 12519057

Mafenide

By

Mafenide

Product: Alisol C (23-acetate)

Identifier : DBSNPE002072
Drug : DB06795 (Mafenide)
Interacting Gene/Enzyme : Glucose-6-phosphate 1-dehydrogenase
Gene Name : G6PD
UniProt ID : P11413
Defining Change(s) :

  • 376A->G
  • 680G->T

Allele Name : A- (680)
Genotype(s) : Not Available
Type(s) : ADR Inferred
Groups : G6PD deficiency
Description : Increased risk of potentially fatal hemolytic anemia.
References :

  1. Marsicano AR Jr, Hutton JJ, Bryant WM: Fatal hemolysis from mafenide diveatment of burns in a patient with glucose-6-phosphate dehydrogenase deficiency. Case report. Plast Reconsdiv Surg. 1973 Aug;52(2):197-9. [PubMed:4722683 ]
  2. Sulfamylon® (Mafenide Acetate, USP)[package insert]. Sugar Land, Texas: Bertek Pharmaceuticals, Inc.; 1998. [Link]

PMID: 12473093

Mafenide

By

Mafenide

Product: Alisol G

Identifier : DBSNPE002073
Drug : DB06795 (Mafenide)
Interacting Gene/Enzyme : Glucose-6-phosphate 1-dehydrogenase
Gene Name : G6PD
UniProt ID : P11413
Defining Change(s) :

  • 376A->G
  • 968T->C

Allele Name : A- (968), Betica,Selma, Guantanamo
Genotype(s) : Not Available
Type(s) : ADR Inferred
Groups : G6PD deficiency
Description : Increased risk of potentially fatal hemolytic anemia.
References :

  1. Marsicano AR Jr, Hutton JJ, Bryant WM: Fatal hemolysis from mafenide diveatment of burns in a patient with glucose-6-phosphate dehydrogenase deficiency. Case report. Plast Reconsdiv Surg. 1973 Aug;52(2):197-9. [PubMed:4722683 ]
  2. Sulfamylon® (Mafenide Acetate, USP)[package insert]. Sugar Land, Texas: Bertek Pharmaceuticals, Inc.; 1998. [Link]

PMID: 26536027

Mafenide

By

Mafenide

Product: Alisol F

Identifier : DBSNPE002074
Drug : DB06795 (Mafenide)
Interacting Gene/Enzyme : Glucose-6-phosphate 1-dehydrogenase
Gene Name : G6PD
UniProt ID : P11413
Defining Change(s) :

  • 383T>G

Allele Name : Salerno Pyrgos
Genotype(s) : Not Available
Type(s) : ADR Inferred
Groups : G6PD deficiency
Description : Increased risk of potentially fatal hemolytic anemia.
References :

  1. Marsicano AR Jr, Hutton JJ, Bryant WM: Fatal hemolysis from mafenide diveatment of burns in a patient with glucose-6-phosphate dehydrogenase deficiency. Case report. Plast Reconsdiv Surg. 1973 Aug;52(2):197-9. [PubMed:4722683 ]
  2. Sulfamylon® (Mafenide Acetate, USP)[package insert]. Sugar Land, Texas: Bertek Pharmaceuticals, Inc.; 1998. [Link]

PMID: 24612076

Mafenide

By

Mafenide

Product: Alisol A (24-acetate)

Identifier : DBSNPE002075
Drug : DB06795 (Mafenide)
Interacting Gene/Enzyme : Glucose-6-phosphate 1-dehydrogenase
Gene Name : G6PD
UniProt ID : P11413
Defining Change(s) :

  • 392G->T

Allele Name : Quing Yan
Genotype(s) : Not Available
Type(s) : ADR Inferred
Groups : G6PD deficiency
Description : Increased risk of potentially fatal hemolytic anemia.
References :

  1. Marsicano AR Jr, Hutton JJ, Bryant WM: Fatal hemolysis from mafenide diveatment of burns in a patient with glucose-6-phosphate dehydrogenase deficiency. Case report. Plast Reconsdiv Surg. 1973 Aug;52(2):197-9. [PubMed:4722683 ]
  2. Sulfamylon® (Mafenide Acetate, USP)[package insert]. Sugar Land, Texas: Bertek Pharmaceuticals, Inc.; 1998. [Link]

PMID: 12695537

Mafenide

By

Mafenide

Product: Alisol A

Identifier : DBSNPE002076
Drug : DB06795 (Mafenide)
Interacting Gene/Enzyme : Glucose-6-phosphate 1-dehydrogenase
Gene Name : G6PD
UniProt ID : P11413
Defining Change(s) :

  • 40G->A

Allele Name : Lages
Genotype(s) : Not Available
Type(s) : ADR Inferred
Groups : G6PD deficiency
Description : Increased risk of potentially fatal hemolytic anemia.
References :

  1. Marsicano AR Jr, Hutton JJ, Bryant WM: Fatal hemolysis from mafenide diveatment of burns in a patient with glucose-6-phosphate dehydrogenase deficiency. Case report. Plast Reconsdiv Surg. 1973 Aug;52(2):197-9. [PubMed:4722683 ]
  2. Sulfamylon® (Mafenide Acetate, USP)[package insert]. Sugar Land, Texas: Bertek Pharmaceuticals, Inc.; 1998. [Link]

PMID: 14593202

Mafenide

By

Mafenide

Product: Benzoylpaeoniflorin

Identifier : DBSNPE002077
Drug : DB06795 (Mafenide)
Interacting Gene/Enzyme : Glucose-6-phosphate 1-dehydrogenase
Gene Name : G6PD
UniProt ID : P11413
Defining Change(s) :

  • 466G->A

Allele Name : Ilesha
Genotype(s) : Not Available
Type(s) : ADR Inferred
Groups : G6PD deficiency
Description : Increased risk of potentially fatal hemolytic anemia.
References :

  1. Marsicano AR Jr, Hutton JJ, Bryant WM: Fatal hemolysis from mafenide diveatment of burns in a patient with glucose-6-phosphate dehydrogenase deficiency. Case report. Plast Reconsdiv Surg. 1973 Aug;52(2):197-9. [PubMed:4722683 ]
  2. Sulfamylon® (Mafenide Acetate, USP)[package insert]. Sugar Land, Texas: Bertek Pharmaceuticals, Inc.; 1998. [Link]

PMID: 11071713

Mafenide

By

Mafenide

Product: Benzoylhypaconine

Identifier : DBSNPE002078
Drug : DB06795 (Mafenide)
Interacting Gene/Enzyme : Glucose-6-phosphate 1-dehydrogenase
Gene Name : G6PD
UniProt ID : P11413
Defining Change(s) :

  • 487G->A

Allele Name : Mahidol
Genotype(s) : Not Available
Type(s) : ADR Inferred
Groups : G6PD deficiency
Description : Increased risk of potentially fatal hemolytic anemia.
References :

  1. Marsicano AR Jr, Hutton JJ, Bryant WM: Fatal hemolysis from mafenide diveatment of burns in a patient with glucose-6-phosphate dehydrogenase deficiency. Case report. Plast Reconsdiv Surg. 1973 Aug;52(2):197-9. [PubMed:4722683 ]
  2. Sulfamylon® (Mafenide Acetate, USP)[package insert]. Sugar Land, Texas: Bertek Pharmaceuticals, Inc.; 1998. [Link]

PMID: 20610166

Mafenide

By

Mafenide

Product: Catalpol

Identifier : DBSNPE002079
Drug : DB06795 (Mafenide)
Interacting Gene/Enzyme : Glucose-6-phosphate 1-dehydrogenase
Gene Name : G6PD
UniProt ID : P11413
Defining Change(s) :

  • 542A->T

Allele Name : Malaga
Genotype(s) : Not Available
Type(s) : ADR Inferred
Groups : G6PD deficiency
Description : Increased risk of potentially fatal hemolytic anemia.
References :

  1. Marsicano AR Jr, Hutton JJ, Bryant WM: Fatal hemolysis from mafenide diveatment of burns in a patient with glucose-6-phosphate dehydrogenase deficiency. Case report. Plast Reconsdiv Surg. 1973 Aug;52(2):197-9. [PubMed:4722683 ]
  2. Sulfamylon® (Mafenide Acetate, USP)[package insert]. Sugar Land, Texas: Bertek Pharmaceuticals, Inc.; 1998. [Link]

PMID: 19112153

Mafenide

By

Mafenide

Product: Alisol B

Identifier : DBSNPE002080
Drug : DB06795 (Mafenide)
Interacting Gene/Enzyme : Glucose-6-phosphate 1-dehydrogenase
Gene Name : G6PD
UniProt ID : P11413
Defining Change(s) :

  • 634A->G

Allele Name : Sibari
Genotype(s) : Not Available
Type(s) : ADR Inferred
Groups : G6PD deficiency
Description : Increased risk of potentially fatal hemolytic anemia.
References :

  1. Marsicano AR Jr, Hutton JJ, Bryant WM: Fatal hemolysis from mafenide diveatment of burns in a patient with glucose-6-phosphate dehydrogenase deficiency. Case report. Plast Reconsdiv Surg. 1973 Aug;52(2):197-9. [PubMed:4722683 ]
  2. Sulfamylon® (Mafenide Acetate, USP)[package insert]. Sugar Land, Texas: Bertek Pharmaceuticals, Inc.; 1998. [Link]

PMID: 18164695

Mafenide

By

Mafenide

Product: Alisol B (23-acetate)

Identifier : DBSNPE002081
Drug : DB06795 (Mafenide)
Interacting Gene/Enzyme : Glucose-6-phosphate 1-dehydrogenase
Gene Name : G6PD
UniProt ID : P11413
Defining Change(s) :

  • 680G->A

Allele Name : Mexico City
Genotype(s) : Not Available
Type(s) : ADR Inferred
Groups : G6PD deficiency
Description : Increased risk of potentially fatal hemolytic anemia.
References :

  1. Marsicano AR Jr, Hutton JJ, Bryant WM: Fatal hemolysis from mafenide diveatment of burns in a patient with glucose-6-phosphate dehydrogenase deficiency. Case report. Plast Reconsdiv Surg. 1973 Aug;52(2):197-9. [PubMed:4722683 ]
  2. Sulfamylon® (Mafenide Acetate, USP)[package insert]. Sugar Land, Texas: Bertek Pharmaceuticals, Inc.; 1998. [Link]

PMID: 18487514

Mafenide

By

Mafenide

Product: Piperidolate

Identifier : DBSNPE002082
Drug : DB06795 (Mafenide)
Interacting Gene/Enzyme : Glucose-6-phosphate 1-dehydrogenase
Gene Name : G6PD
UniProt ID : P11413
Defining Change(s) :

  • 703C->T

Allele Name : Nanning
Genotype(s) : Not Available
Type(s) : ADR Inferred
Groups : G6PD deficiency
Description : Increased risk of potentially fatal hemolytic anemia.
References :

  1. Marsicano AR Jr, Hutton JJ, Bryant WM: Fatal hemolysis from mafenide diveatment of burns in a patient with glucose-6-phosphate dehydrogenase deficiency. Case report. Plast Reconsdiv Surg. 1973 Aug;52(2):197-9. [PubMed:4722683 ]
  2. Sulfamylon® (Mafenide Acetate, USP)[package insert]. Sugar Land, Texas: Bertek Pharmaceuticals, Inc.; 1998. [Link]

PMID: 17597604

Mafenide

By

Mafenide

Product: Piperidolate (hydrochloride)

Identifier : DBSNPE002083
Drug : DB06795 (Mafenide)
Interacting Gene/Enzyme : Glucose-6-phosphate 1-dehydrogenase
Gene Name : G6PD
UniProt ID : P11413
Defining Change(s) :

  • 844G->C

Allele Name : Seattle, Lodi, Modena, Ferrara II, Athens-like
Genotype(s) : Not Available
Type(s) : ADR Inferred
Groups : G6PD deficiency
Description : Increased risk of potentially fatal hemolytic anemia.
References :

  1. Marsicano AR Jr, Hutton JJ, Bryant WM: Fatal hemolysis from mafenide diveatment of burns in a patient with glucose-6-phosphate dehydrogenase deficiency. Case report. Plast Reconsdiv Surg. 1973 Aug;52(2):197-9. [PubMed:4722683 ]
  2. Sulfamylon® (Mafenide Acetate, USP)[package insert]. Sugar Land, Texas: Bertek Pharmaceuticals, Inc.; 1998. [Link]

PMID: 20566651

Mafenide

By

Mafenide

Product: Chlorindione

Identifier : DBSNPE002085
Drug : DB06795 (Mafenide)
Interacting Gene/Enzyme : Glucose-6-phosphate 1-dehydrogenase
Gene Name : G6PD
UniProt ID : P11413
Defining Change(s) :

  • 854G->A

Allele Name : Montalbano
Genotype(s) : Not Available
Type(s) : ADR Inferred
Groups : G6PD deficiency
Description : Increased risk of potentially fatal hemolytic anemia.
References :

  1. Marsicano AR Jr, Hutton JJ, Bryant WM: Fatal hemolysis from mafenide diveatment of burns in a patient with glucose-6-phosphate dehydrogenase deficiency. Case report. Plast Reconsdiv Surg. 1973 Aug;52(2):197-9. [PubMed:4722683 ]
  2. Sulfamylon® (Mafenide Acetate, USP)[package insert]. Sugar Land, Texas: Bertek Pharmaceuticals, Inc.; 1998. [Link]

PMID: 15976016

Mafenide

By

Mafenide

Product: Bromindione

Identifier : DBSNPE002086
Drug : DB06795 (Mafenide)
Interacting Gene/Enzyme : Glucose-6-phosphate 1-dehydrogenase
Gene Name : G6PD
UniProt ID : P11413
Defining Change(s) :

  • 949G->A

Allele Name : Kalyan-Kerala, Jamnaga, Rohini
Genotype(s) : Not Available
Type(s) : ADR Inferred
Groups : G6PD deficiency
Description : Increased risk of potentially fatal hemolytic anemia.
References :

  1. Marsicano AR Jr, Hutton JJ, Bryant WM: Fatal hemolysis from mafenide diveatment of burns in a patient with glucose-6-phosphate dehydrogenase deficiency. Case report. Plast Reconsdiv Surg. 1973 Aug;52(2):197-9. [PubMed:4722683 ]
  2. Sulfamylon® (Mafenide Acetate, USP)[package insert]. Sugar Land, Texas: Bertek Pharmaceuticals, Inc.; 1998. [Link]

PMID: 21757343

Mafenide

By

Mafenide

Product: Propoxur

Identifier : DBSNPE002087
Drug : DB06795 (Mafenide)
Interacting Gene/Enzyme : Glucose-6-phosphate 1-dehydrogenase
Gene Name : G6PD
UniProt ID : P11413
Defining Change(s) :

  • 95A->G

Allele Name : Gaohe
Genotype(s) : Not Available
Type(s) : ADR Inferred
Groups : G6PD deficiency
Description : Increased risk of potentially fatal hemolytic anemia.
References :

  1. Marsicano AR Jr, Hutton JJ, Bryant WM: Fatal hemolysis from mafenide diveatment of burns in a patient with glucose-6-phosphate dehydrogenase deficiency. Case report. Plast Reconsdiv Surg. 1973 Aug;52(2):197-9. [PubMed:4722683 ]
  2. Sulfamylon® (Mafenide Acetate, USP)[package insert]. Sugar Land, Texas: Bertek Pharmaceuticals, Inc.; 1998. [Link]

PMID: 20218930

By

Related Post

You Missed

Uncategorized

SULT1A1 Recombinant Rabbit Monoclonal Antibody (034)

Uncategorized

actin binding LIM protein 1

Uncategorized

STOML2 Monoclonal Antibody (OTI1G6), TrueMAB™

Uncategorized

fms related tyrosine kinase 4