Clear evidence of strong interactions at 1:1 molar ratio between the complementary RNA sequence and conjugate C2 or C1 (Figure 3), both in the presence of monovalent ions (i.e. in Tris buffer) and in their absence (i.e. in water), was provided by a noticeable response from fluorescein tag located at the 5′-terminal phosphate of the 2′-O-methyl-RNA sequences, which was also supported by UV-visible spectroscopy (see Figure S7 in the Supplementary Material). In Tris buffer, this can be attributed to the formation of the C2:FAM-RNA1 or C1:FAM-RNA1 duplexes stabilized by Watson-Crick hydrogen bonding between the oligonucleotide moiety of the POC and the complementary region of the RNA1 sequence (see Figures 3A and 3E, respectively). The oligonucleotide recognition component seemed to play the dominant role in the interactions between the C2 or C1 conjugates and the complementary target in the presence of a high level of counter cations under buffered-electrolyte conditions, which was sufficient to minimize repulsion between the negatively charged oligonucleotide strands, as demonstrated by a pictorial diagram shown in Figure 4.
Remarkably, the base-specificity and the cleavage efficacy of this class of the peptidyl-oligonucleotide conjugates strongly depend on the nature, sequence and structural features of the RNA target. Earlier, C1 and C2 conjugates were evaluated against the linear (e.g. non-structured) complementary oligoribonucleotide 5′-[P³²]-GAUUGAAAAUCCCC, which corresponded to a sequence from the anticodon arm of E.Coli tRNAPhe, (Pyshnyi et al., 1997, Mironova et al., 2004c) and had some sequence similarity with RNA1 studied in this research. In contrast to the data presented here (see Figure 2A) showing clear Pyr-A preference in cleavage of 5′-[³²P]-RNA-HIV-1, both conjugates demonstrated exclusive G-X base-specificity for the site-directed cleavage of this short, linear complementary target, mainly at G1-A2 and G5-A6 positions. C1 showed 80% cleavage activity, whereas the activity of C2 against this target was not reported. Similarly, G-X basespecificity was detected again for these C1 and C2 conjugates, when they were studied against the linear (i.e. non-structured) non-complementary 20-mer sequence 5′-[P³²]UUACACACACUGGGAAGUUU (Mironova et al., 2004c), which had full homology with RNA2 studied here. The overall cleavage efficiency of C1 and C2 against this target was found to be 80% and 63%, respectively, with the main cleavage sites seen at G12-G13, G13-G14, G14-A15 and G17-U18 positions (Mironova et al., 2004c). Neither peptide alone nor the mixture of the unconjugated peptide and oligonucleotide possessed cleavage activity, thus suggesting that only the hybrid peptide-oligonucleotide could promote catalysis.
The behavior of peptidyl-oligonucleotide conjugates (POCs) in hybridization with RNA targets is profoundly influenced by the ionic environment, particularly the concentration of monovalent counter cations such as K⁺. This study reveals a fundamental dichotomy in conjugate-RNA interactions: one mode dominates under physiological conditions, while another emerges under non-physiological, low-ionic settings.
In Tris-buffered electrolyte (50 mM Tris-HCl, 200 mM KCl, pH 7.0), the oligonucleotide recognition element governs the interaction with complementary RNA. Fluorescence quenching of FAM-labeled RNA1 upon addition of C1 or C2 conjugates—up to 28% and 30%, respectively—was observed, indicating stable duplex formation via Watson-Crick base pairing. This is further corroborated by UV-visible spectroscopy, where hypochromic effects and slight blue shifts in absorption maxima confirm close molecular proximity and stacking interactions. These findings are consistent with the expected behavior of nucleic acid hybrids, where electrostatic repulsion between negatively charged backbones is effectively screened by physiological levels of K⁺, allowing complementary strands to associate freely. The dominance of the oligonucleotide component ensures high sequence specificity, minimizing off-target binding.
However, in de-ionized water—where counter cations are absent—the dynamics shift dramatically. Under these conditions, the same conjugates induce significantly stronger fluorescence quenching (30–38%) with both complementary (FAM-RNA1) and non-complementary (FAM-RNA2) targets. This indicates robust, non-specific binding driven primarily by the positively charged peptide moiety. Without charge screening, electrostatic repulsion between the oligonucleotide backbones cannot be overcome, leading to destabilization of the duplex. Instead, the arginine-rich peptide acts as an “electrostatic anchor,” forming transient but strong interactions with the RNA backbone through salt bridge formation with phosphate groups. This mechanism explains why both C1 and C2 bind equally well to non-complementary RNA in water—sequence independence becomes irrelevant when the driving force is purely electrostatic.
This switch in binding mode highlights a critical design principle: the functional outcome of POCs is not fixed but tunable. In physiological environments, the conjugate behaves as a precise molecular scalpel—targeting only complementary sequences. In non-physiological conditions, it transforms into a promiscuous binder, capable of interacting with any RNA regardless of sequence.IL-8 Antibody medchemexpress This phenomenon underscores the importance of maintaining proper ionic strength in experimental systems and has direct implications for therapeutic applications.Saccharocin Epigenetics For instance, in vivo delivery must preserve the cellular ionic milieu to ensure specificity and prevent off-target cleavage.PMID:35100396
Moreover, the dependence on target structure is evident from comparative studies using linear oligoribonucleotides. When tested against a non-structured, single-stranded target (5′-[³²P]-GAUUGAAAAUCCCC), C1 and C2 exhibited exclusive G-X specificity, cleaving primarily at G1-A2 and G5-A6. This contrasts sharply with their Pyr-A preference in structured HIV-1 RNA, demonstrating that the catalytic activity is not solely determined by the conjugate’s intrinsic chemistry but is modulated by the local RNA architecture. Flexible regions facilitate access to the catalytic site, while rigid helices hinder it.
These results collectively illustrate a dynamic interplay between electrostatic forces, conformational flexibility, and sequence complementarity. The oligonucleotide provides specificity and stability under physiological conditions, while the peptide enables catalytic turnover and transient binding. By leveraging this dual functionality, synthetic ribonucleases can achieve both precision and potency—key attributes for next-generation RNA-targeted therapeutics.MedChemExpress (MCE) offers a wide range of high-quality research chemicals and biochemicals (novel life-science reagents, reference compounds and natural compounds) for scientific use. We have professionally experienced and friendly staff to meet your needs. We are a competent and trustworthy partner for your research and scientific projects.Related websites: https://www.medchemexpress.com