Sulfamethoxazole
Product: Pilocarpine (Hydrochloride)
Identifier : DBSNPE003457
Drug : DB01015 (Sulfamethoxazole)
Interacting Gene/Enzyme : Glucose-6-phosphate 1-dehydrogenase
Gene Name : G6PD
UniProt ID : P11413
Allele Name : Torun
Genotype(s) : Not Available
Type(s) : ADR Inferred
Groups : G6PD deficiency
Description : Increased risk of dose-related hemolysis.
References :
- Bacdivim™[package insert]. Philadelphia, Pennysylvania: Mutual Pharmaceutical Company; 2013. [Link]
PMID: 26491845
Sulfamethoxazole
Product: Doxepin (Hydrochloride)
Identifier : DBSNPE003458
Drug : DB01015 (Sulfamethoxazole)
Interacting Gene/Enzyme : Glucose-6-phosphate 1-dehydrogenase
Gene Name : G6PD
UniProt ID : P11413
Allele Name : Sunderland
Genotype(s) : Not Available
Type(s) : ADR Inferred
Groups : G6PD deficiency
Description : Increased risk of dose-related hemolysis.
References :
- Bacdivim™[package insert]. Philadelphia, Pennysylvania: Mutual Pharmaceutical Company; 2013. [Link]
PMID: 11790767
Sulfamethoxazole
Product: Ingenol Mebutate
Identifier : DBSNPE003459
Drug : DB01015 (Sulfamethoxazole)
Interacting Gene/Enzyme : Glucose-6-phosphate 1-dehydrogenase
Gene Name : G6PD
UniProt ID : P11413
Allele Name : Iwatsuki
Genotype(s) : Not Available
Type(s) : ADR Inferred
Groups : G6PD deficiency
Description : Increased risk of dose-related hemolysis.
References :
- Bacdivim™[package insert]. Philadelphia, Pennysylvania: Mutual Pharmaceutical Company; 2013. [Link]
PMID: 25625039
Sulfamethoxazole
Product: Sertaconazole (nitrate)
Identifier : DBSNPE003460
Drug : DB01015 (Sulfamethoxazole)
Interacting Gene/Enzyme : Glucose-6-phosphate 1-dehydrogenase
Gene Name : G6PD
UniProt ID : P11413
Allele Name : Serres
Genotype(s) : Not Available
Type(s) : ADR Inferred
Groups : G6PD deficiency
Description : Increased risk of dose-related hemolysis.
References :
- Bacdivim™[package insert]. Philadelphia, Pennysylvania: Mutual Pharmaceutical Company; 2013. [Link]
PMID: 19261605
Sulfamethoxazole
Product: Methylene Blue
Identifier : DBSNPE003461
Drug : DB01015 (Sulfamethoxazole)
Interacting Gene/Enzyme : Glucose-6-phosphate 1-dehydrogenase
Gene Name : G6PD
UniProt ID : P11413
Defining Change(s) :
- 1084_1101delCTGAACGAGCGCAAGGCC
Allele Name : Tondela
Genotype(s) : Not Available
Type(s) : ADR Inferred
Groups : G6PD deficiency
Description : Increased risk of dose-related hemolysis.
References :
- Bacdivim™[package insert]. Philadelphia, Pennysylvania: Mutual Pharmaceutical Company; 2013. [Link]
PMID: 19271755
Sulfamethoxazole
Product: Carteolol (hydrochloride)
Identifier : DBSNPE003462
Drug : DB01015 (Sulfamethoxazole)
Interacting Gene/Enzyme : Glucose-6-phosphate 1-dehydrogenase
Gene Name : G6PD
UniProt ID : P11413
Allele Name : Loma Linda
Genotype(s) : Not Available
Type(s) : ADR Inferred
Groups : G6PD deficiency
Description : Increased risk of dose-related hemolysis.
References :
- Bacdivim™[package insert]. Philadelphia, Pennysylvania: Mutual Pharmaceutical Company; 2013. [Link]
PMID: 24487964
Sulfamethoxazole
Product: Pentoxifylline
Identifier : DBSNPE003463
Drug : DB01015 (Sulfamethoxazole)
Interacting Gene/Enzyme : Glucose-6-phosphate 1-dehydrogenase
Gene Name : G6PD
UniProt ID : P11413
Allele Name : Aachen
Genotype(s) : Not Available
Type(s) : ADR Inferred
Groups : G6PD deficiency
Description : Increased risk of dose-related hemolysis.
References :
- Bacdivim™[package insert]. Philadelphia, Pennysylvania: Mutual Pharmaceutical Company; 2013. [Link]
PMID: 17785464
Sulfamethoxazole
Product: Amlexanox
Identifier : DBSNPE003464
Drug : DB01015 (Sulfamethoxazole)
Interacting Gene/Enzyme : Glucose-6-phosphate 1-dehydrogenase
Gene Name : G6PD
UniProt ID : P11413
Allele Name : Tenri
Genotype(s) : Not Available
Type(s) : ADR Inferred
Groups : G6PD deficiency
Description : Increased risk of dose-related hemolysis.
References :
- Bacdivim™[package insert]. Philadelphia, Pennysylvania: Mutual Pharmaceutical Company; 2013. [Link]
PMID: 16759099
Sulfamethoxazole
Product: Ceftriaxone
Identifier : DBSNPE003465
Drug : DB01015 (Sulfamethoxazole)
Interacting Gene/Enzyme : Glucose-6-phosphate 1-dehydrogenase
Gene Name : G6PD
UniProt ID : P11413
Allele Name : Montpellier
Genotype(s) : Not Available
Type(s) : ADR Inferred
Groups : G6PD deficiency
Description : Increased risk of dose-related hemolysis.
References :
- Bacdivim™[package insert]. Philadelphia, Pennysylvania: Mutual Pharmaceutical Company; 2013. [Link]
PMID: 25086309
Sulfamethoxazole
Product: Betaine
Identifier : DBSNPE003466
Drug : DB01015 (Sulfamethoxazole)
Interacting Gene/Enzyme : Glucose-6-phosphate 1-dehydrogenase
Gene Name : G6PD
UniProt ID : P11413
Allele Name : Calvo Mackenna
Genotype(s) : Not Available
Type(s) : ADR Inferred
Groups : G6PD deficiency
Description : Increased risk of dose-related hemolysis.
References :
- Bacdivim™[package insert]. Philadelphia, Pennysylvania: Mutual Pharmaceutical Company; 2013. [Link]
PMID: 22727639
Sulfamethoxazole
Product: β-Estradiol 17-acetate
Identifier : DBSNPE003467
Drug : DB01015 (Sulfamethoxazole)
Interacting Gene/Enzyme : Glucose-6-phosphate 1-dehydrogenase
Gene Name : G6PD
UniProt ID : P11413
Allele Name : Riley
Genotype(s) : Not Available
Type(s) : ADR Inferred
Groups : G6PD deficiency
Description : Increased risk of dose-related hemolysis.
References :
- Bacdivim™[package insert]. Philadelphia, Pennysylvania: Mutual Pharmaceutical Company; 2013. [Link]
PMID: 19279215
Sulfamethoxazole
Product: Sertindole
Identifier : DBSNPE003469
Drug : DB01015 (Sulfamethoxazole)
Interacting Gene/Enzyme : Glucose-6-phosphate 1-dehydrogenase
Gene Name : G6PD
UniProt ID : P11413
Allele Name : Tomah
Genotype(s) : Not Available
Type(s) : ADR Inferred
Groups : G6PD deficiency
Description : Increased risk of dose-related hemolysis.
References :
- Bacdivim™[package insert]. Philadelphia, Pennysylvania: Mutual Pharmaceutical Company; 2013. [Link]
PMID: 24097188
Sulfamethoxazole
Product: Atenolol
Identifier : DBSNPE003470
Drug : DB01015 (Sulfamethoxazole)
Interacting Gene/Enzyme : Glucose-6-phosphate 1-dehydrogenase
Gene Name : G6PD
UniProt ID : P11413
Allele Name : Lynwood
Genotype(s) : Not Available
Type(s) : ADR Inferred
Groups : G6PD deficiency
Description : Increased risk of dose-related hemolysis.
References :
- Bacdivim™[package insert]. Philadelphia, Pennysylvania: Mutual Pharmaceutical Company; 2013. [Link]
PMID: 27853135
Sulfamethoxazole
Product: Atractyloside A
Identifier : DBSNPE003471
Drug : DB01015 (Sulfamethoxazole)
Interacting Gene/Enzyme : Glucose-6-phosphate 1-dehydrogenase
Gene Name : G6PD
UniProt ID : P11413
Allele Name : Madrid
Genotype(s) : Not Available
Type(s) : ADR Inferred
Groups : G6PD deficiency
Description : Increased risk of dose-related hemolysis.
References :
- Bacdivim™[package insert]. Philadelphia, Pennysylvania: Mutual Pharmaceutical Company; 2013. [Link]
PMID: 16432512
Sulfamethoxazole
Product: Sivelestat (sodium)
Identifier : DBSNPE003472
Drug : DB01015 (Sulfamethoxazole)
Interacting Gene/Enzyme : Glucose-6-phosphate 1-dehydrogenase
Gene Name : G6PD
UniProt ID : P11413
Allele Name : Iowa, Walter Reed, Springfield
Genotype(s) : Not Available
Type(s) : ADR Inferred
Groups : G6PD deficiency
Description : Increased risk of dose-related hemolysis.
References :
- Bacdivim™[package insert]. Philadelphia, Pennysylvania: Mutual Pharmaceutical Company; 2013. [Link]
PMID: 15608074
Sulfamethoxazole
Product: Sivelestat
Identifier : DBSNPE003473
Drug : DB01015 (Sulfamethoxazole)
Interacting Gene/Enzyme : Glucose-6-phosphate 1-dehydrogenase
Gene Name : G6PD
UniProt ID : P11413
Allele Name : Beverly Hills, Genova, Iwate, Niigata, Yamaguchi
Genotype(s) : Not Available
Type(s) : ADR Inferred
Groups : G6PD deficiency
Description : Increased risk of dose-related hemolysis.
References :
- Bacdivim™[package insert]. Philadelphia, Pennysylvania: Mutual Pharmaceutical Company; 2013. [Link]
PMID: 25017033
Sulfamethoxazole
Product: Temoporfin
Identifier : DBSNPE003474
Drug : DB01015 (Sulfamethoxazole)
Interacting Gene/Enzyme : Glucose-6-phosphate 1-dehydrogenase
Gene Name : G6PD
UniProt ID : P11413
Allele Name : Hartford
Genotype(s) : Not Available
Type(s) : ADR Inferred
Groups : G6PD deficiency
Description : Increased risk of dose-related hemolysis.
References :
- Bacdivim™[package insert]. Philadelphia, Pennysylvania: Mutual Pharmaceutical Company; 2013. [Link]
PMID: 24479195
Sulfamethoxazole
Product: Candesartan (Cilexetil)
Identifier : DBSNPE003475
Drug : DB01015 (Sulfamethoxazole)
Interacting Gene/Enzyme : Glucose-6-phosphate 1-dehydrogenase
Gene Name : G6PD
UniProt ID : P11413
Allele Name : Praha
Genotype(s) : Not Available
Type(s) : ADR Inferred
Groups : G6PD deficiency
Description : Increased risk of dose-related hemolysis.
References :
- Bacdivim™[package insert]. Philadelphia, Pennysylvania: Mutual Pharmaceutical Company; 2013. [Link]
PMID: 23460565
Sulfamethoxazole
Product: (R)-1,2,3,4-Tetrahydro-3-isoquinolinecarboxylic acid
Identifier : DBSNPE003476
Drug : DB01015 (Sulfamethoxazole)
Interacting Gene/Enzyme : Glucose-6-phosphate 1-dehydrogenase
Gene Name : G6PD
UniProt ID : P11413
Allele Name : Krakow
Genotype(s) : Not Available
Type(s) : ADR Inferred
Groups : G6PD deficiency
Description : Increased risk of dose-related hemolysis.
References :
- Bacdivim™[package insert]. Philadelphia, Pennysylvania: Mutual Pharmaceutical Company; 2013. [Link]
PMID: 21916012
Sulfamethoxazole
Product: SM-164
Identifier : DBSNPE003477
Drug : DB01015 (Sulfamethoxazole)
Interacting Gene/Enzyme : Glucose-6-phosphate 1-dehydrogenase
Gene Name : G6PD
UniProt ID : P11413
Allele Name : Wisconsin
Genotype(s) : Not Available
Type(s) : ADR Inferred
Groups : G6PD deficiency
Description : Increased risk of dose-related hemolysis.
References :
- Bacdivim™[package insert]. Philadelphia, Pennysylvania: Mutual Pharmaceutical Company; 2013. [Link]
PMID: 25263033
Sulfamethoxazole
Product: Baclofen
Identifier : DBSNPE003479
Drug : DB01015 (Sulfamethoxazole)
Interacting Gene/Enzyme : Glucose-6-phosphate 1-dehydrogenase
Gene Name : G6PD
UniProt ID : P11413
Allele Name : Alhambra
Genotype(s) : Not Available
Type(s) : ADR Inferred
Groups : G6PD deficiency
Description : Increased risk of dose-related hemolysis.
References :
- Bacdivim™[package insert]. Philadelphia, Pennysylvania: Mutual Pharmaceutical Company; 2013. [Link]
PMID: 20405001
Sulfamethoxazole
Product: Pirarubicin
Identifier : DBSNPE003480
Drug : DB01015 (Sulfamethoxazole)
Interacting Gene/Enzyme : Glucose-6-phosphate 1-dehydrogenase
Gene Name : G6PD
UniProt ID : P11413
Allele Name : Bari
Genotype(s) : Not Available
Type(s) : ADR Inferred
Groups : G6PD deficiency
Description : Increased risk of dose-related hemolysis.
References :
- Bacdivim™[package insert]. Philadelphia, Pennysylvania: Mutual Pharmaceutical Company; 2013. [Link]
PMID: 1846921
Sulfamethoxazole
Product: Eflornithine (hydrochloride)
Identifier : DBSNPE003481
Drug : DB01015 (Sulfamethoxazole)
Interacting Gene/Enzyme : Glucose-6-phosphate 1-dehydrogenase
Gene Name : G6PD
UniProt ID : P11413
Allele Name : Puerto Limon
Genotype(s) : Not Available
Type(s) : ADR Inferred
Groups : G6PD deficiency
Description : Increased risk of dose-related hemolysis.
References :
- Bacdivim™[package insert]. Philadelphia, Pennysylvania: Mutual Pharmaceutical Company; 2013. [Link]
PMID: 18440066
Sulfamethoxazole
Product: Eflornithine
Identifier : DBSNPE003482
Drug : DB01015 (Sulfamethoxazole)
Interacting Gene/Enzyme : Glucose-6-phosphate 1-dehydrogenase
Gene Name : G6PD
UniProt ID : P11413
Allele Name : Covao do Lobo
Genotype(s) : Not Available
Type(s) : ADR Inferred
Groups : G6PD deficiency
Description : Increased risk of dose-related hemolysis.
References :
- Bacdivim™[package insert]. Philadelphia, Pennysylvania: Mutual Pharmaceutical Company; 2013. [Link]
PMID: 8981566
Sulfamethoxazole
Product: Dithranol
Identifier : DBSNPE003483
Drug : DB01015 (Sulfamethoxazole)
Interacting Gene/Enzyme : Glucose-6-phosphate 1-dehydrogenase
Gene Name : G6PD
UniProt ID : P11413
Allele Name : Clinic
Genotype(s) : Not Available
Type(s) : ADR Inferred
Groups : G6PD deficiency
Description : Increased risk of dose-related hemolysis.
References :
- Bacdivim™[package insert]. Philadelphia, Pennysylvania: Mutual Pharmaceutical Company; 2013. [Link]
PMID: 10224306
Sulfamethoxazole
Product: Fenoldopam
Identifier : DBSNPE003484
Drug : DB01015 (Sulfamethoxazole)
Interacting Gene/Enzyme : Glucose-6-phosphate 1-dehydrogenase
Gene Name : G6PD
UniProt ID : P11413
Allele Name : Udivecht
Genotype(s) : Not Available
Type(s) : ADR Inferred
Groups : G6PD deficiency
Description : Increased risk of dose-related hemolysis.
References :
- Bacdivim™[package insert]. Philadelphia, Pennysylvania: Mutual Pharmaceutical Company; 2013. [Link]
PMID: 11504802
Sulfamethoxazole
Product: Fotemustine
Identifier : DBSNPE003485
Drug : DB01015 (Sulfamethoxazole)
Interacting Gene/Enzyme : Glucose-6-phosphate 1-dehydrogenase
Gene Name : G6PD
UniProt ID : P11413
Allele Name : Suwalki
Genotype(s) : Not Available
Type(s) : ADR Inferred
Groups : G6PD deficiency
Description : Increased risk of dose-related hemolysis.
References :
- Bacdivim™[package insert]. Philadelphia, Pennysylvania: Mutual Pharmaceutical Company; 2013. [Link]
PMID: 8393489
Sulfamethoxazole
Product: NVP-TNKS656
Identifier : DBSNPE003486
Drug : DB01015 (Sulfamethoxazole)
Interacting Gene/Enzyme : Glucose-6-phosphate 1-dehydrogenase
Gene Name : G6PD
UniProt ID : P11413
Allele Name : Riverside
Genotype(s) : Not Available
Type(s) : ADR Inferred
Groups : G6PD deficiency
Description : Increased risk of dose-related hemolysis.
References :
- Bacdivim™[package insert]. Philadelphia, Pennysylvania: Mutual Pharmaceutical Company; 2013. [Link]
PMID: 1657267
Sulfamethoxazole
Product: Seratrodast
Identifier : DBSNPE003487
Drug : DB01015 (Sulfamethoxazole)
Interacting Gene/Enzyme : Glucose-6-phosphate 1-dehydrogenase
Gene Name : G6PD
UniProt ID : P11413
Allele Name : Japan, Shinagawa
Genotype(s) : Not Available
Type(s) : ADR Inferred
Groups : G6PD deficiency
Description : Increased risk of dose-related hemolysis.
References :
- Bacdivim™[package insert]. Philadelphia, Pennysylvania: Mutual Pharmaceutical Company; 2013. [Link]
PMID: 1659636
Sulfamethoxazole
Product: Cefozopran
Identifier : DBSNPE003488
Drug : DB01015 (Sulfamethoxazole)
Interacting Gene/Enzyme : Glucose-6-phosphate 1-dehydrogenase
Gene Name : G6PD
UniProt ID : P11413
Allele Name : Kawasaki
Genotype(s) : Not Available
Type(s) : ADR Inferred
Groups : G6PD deficiency
Description : Increased risk of dose-related hemolysis.
References :
- Bacdivim™[package insert]. Philadelphia, Pennysylvania: Mutual Pharmaceutical Company; 2013. [Link]
PMID: 1846918
Sulfamethoxazole
Product: Bicyclol
Identifier : DBSNPE003489
Drug : DB01015 (Sulfamethoxazole)
Interacting Gene/Enzyme : Glucose-6-phosphate 1-dehydrogenase
Gene Name : G6PD
UniProt ID : P11413
Allele Name : Munich
Genotype(s) : Not Available
Type(s) : ADR Inferred
Groups : G6PD deficiency
Description : Increased risk of dose-related hemolysis.
References :
- Bacdivim™[package insert]. Philadelphia, Pennysylvania: Mutual Pharmaceutical Company; 2013. [Link]
PMID: 7493620
Sulfamethoxazole
Product: Bucladesine (sodium salt)
Identifier : DBSNPE003490
Drug : DB01015 (Sulfamethoxazole)
Interacting Gene/Enzyme : Glucose-6-phosphate 1-dehydrogenase
Gene Name : G6PD
UniProt ID : P11413
Allele Name : Georgia
Genotype(s) : Not Available
Type(s) : ADR Inferred
Groups : G6PD deficiency
Description : Increased risk of dose-related hemolysis.
References :
- Bacdivim™[package insert]. Philadelphia, Pennysylvania: Mutual Pharmaceutical Company; 2013. [Link]
PMID: 2568146
Sulfamethoxazole
Product: Ibudilast
Identifier : DBSNPE003491
Drug : DB01015 (Sulfamethoxazole)
Interacting Gene/Enzyme : Glucose-6-phosphate 1-dehydrogenase
Gene Name : G6PD
UniProt ID : P11413
Allele Name : Sumare
Genotype(s) : Not Available
Type(s) : ADR Inferred
Groups : G6PD deficiency
Description : Increased risk of dose-related hemolysis.
References :
- Bacdivim™[package insert]. Philadelphia, Pennysylvania: Mutual Pharmaceutical Company; 2013. [Link]
PMID: 8071934
Sulfamethoxazole
Product: Fenofibric acid
Identifier : DBSNPE003492
Drug : DB01015 (Sulfamethoxazole)
Interacting Gene/Enzyme : Glucose-6-phosphate 1-dehydrogenase
Gene Name : G6PD
UniProt ID : P11413
Allele Name : Telti/Kobe
Genotype(s) : Not Available
Type(s) : ADR Inferred
Groups : G6PD deficiency
Description : Increased risk of dose-related hemolysis.
References :
- Bacdivim™[package insert]. Philadelphia, Pennysylvania: Mutual Pharmaceutical Company; 2013. [Link]
PMID: 25559075
Sulfamethoxazole
Product: Hematoporphyrin
Identifier : DBSNPE003493
Drug : DB01015 (Sulfamethoxazole)
Interacting Gene/Enzyme : Glucose-6-phosphate 1-dehydrogenase
Gene Name : G6PD
UniProt ID : P11413
Allele Name : Santiago de Cuba, Morioka
Genotype(s) : Not Available
Type(s) : ADR Inferred
Groups : G6PD deficiency
Description : Increased risk of dose-related hemolysis.
References :
- Bacdivim™[package insert]. Philadelphia, Pennysylvania: Mutual Pharmaceutical Company; 2013. [Link]
PMID: 17060492
Sulfamethoxazole
Product: Gliclazide
Identifier : DBSNPE003494
Drug : DB01015 (Sulfamethoxazole)
Interacting Gene/Enzyme : Glucose-6-phosphate 1-dehydrogenase
Gene Name : G6PD
UniProt ID : P11413
Allele Name : Harima
Genotype(s) : Not Available
Type(s) : ADR Inferred
Groups : G6PD deficiency
Description : Increased risk of dose-related hemolysis.
References :
- Bacdivim™[package insert]. Philadelphia, Pennysylvania: Mutual Pharmaceutical Company; 2013. [Link]
PMID: 22537770
Sulfamethoxazole
Product: Azithromycin (hydrate)
Identifier : DBSNPE003495
Drug : DB01015 (Sulfamethoxazole)
Interacting Gene/Enzyme : Glucose-6-phosphate 1-dehydrogenase
Gene Name : G6PD
UniProt ID : P11413
Allele Name : Figuera da Foz
Genotype(s) : Not Available
Type(s) : ADR Inferred
Groups : G6PD deficiency
Description : Increased risk of dose-related hemolysis.
References :
- Bacdivim™[package insert]. Philadelphia, Pennysylvania: Mutual Pharmaceutical Company; 2013. [Link]
PMID: 9535991
Sulfamethoxazole
Product: Fumagillin
Identifier : DBSNPE003496
Drug : DB01015 (Sulfamethoxazole)
Interacting Gene/Enzyme : Glucose-6-phosphate 1-dehydrogenase
Gene Name : G6PD
UniProt ID : P11413
Allele Name : Amiens
Genotype(s) : Not Available
Type(s) : ADR Inferred
Groups : G6PD deficiency
Description : Increased risk of dose-related hemolysis.
References :
- Bacdivim™[package insert]. Philadelphia, Pennysylvania: Mutual Pharmaceutical Company; 2013. [Link]
PMID: 8388301
Sulfamethoxazole
Product: Talaporfin (sodium)
Identifier : DBSNPE003497
Drug : DB01015 (Sulfamethoxazole)
Interacting Gene/Enzyme : Glucose-6-phosphate 1-dehydrogenase
Gene Name : G6PD
UniProt ID : P11413
Allele Name : Bangkok Noi
Genotype(s) : Not Available
Type(s) : ADR Inferred
Groups : G6PD deficiency
Description : Increased risk of dose-related hemolysis.
References :
- Bacdivim™[package insert]. Philadelphia, Pennysylvania: Mutual Pharmaceutical Company; 2013. [Link]
PMID: 8390939
Sulfamethoxazole
Product: Luminol (sodium salt)
Identifier : DBSNPE003498
Drug : DB01015 (Sulfamethoxazole)
Interacting Gene/Enzyme : Glucose-6-phosphate 1-dehydrogenase
Gene Name : G6PD
UniProt ID : P11413
Allele Name : Fukaya
Genotype(s) : Not Available
Type(s) : ADR Inferred
Groups : G6PD deficiency
Description : Increased risk of dose-related hemolysis.
References :
- Bacdivim™[package insert]. Philadelphia, Pennysylvania: Mutual Pharmaceutical Company; 2013. [Link]
PMID: 2822490
Sulfamethoxazole
Product: Ramatroban
Identifier : DBSNPE003499
Drug : DB01015 (Sulfamethoxazole)
Interacting Gene/Enzyme : Glucose-6-phosphate 1-dehydrogenase
Gene Name : G6PD
UniProt ID : P11413
Allele Name : Campinas
Genotype(s) : Not Available
Type(s) : ADR Inferred
Groups : G6PD deficiency
Description : Increased risk of dose-related hemolysis.
References :
- Bacdivim™[package insert]. Philadelphia, Pennysylvania: Mutual Pharmaceutical Company; 2013. [Link]
PMID: 9517380
Sulfamethoxazole
Product: Hoechst 33342 (trihydrochloride)
Identifier : DBSNPE003500
Drug : DB01015 (Sulfamethoxazole)
Interacting Gene/Enzyme : Glucose-6-phosphate 1-dehydrogenase
Gene Name : G6PD
UniProt ID : P11413
Allele Name : Buenos Aires
Genotype(s) : Not Available
Type(s) : ADR Inferred
Groups : G6PD deficiency
Description : Increased risk of dose-related hemolysis.
References :
- Bacdivim™[package insert]. Philadelphia, Pennysylvania: Mutual Pharmaceutical Company; 2013. [Link]
PMID: 8045272
Sulfamethoxazole
Product: Exatecan (Mesylate)
Identifier : DBSNPE003501
Drug : DB01015 (Sulfamethoxazole)
Interacting Gene/Enzyme : Glucose-6-phosphate 1-dehydrogenase
Gene Name : G6PD
UniProt ID : P11413
Allele Name : Arakawa
Genotype(s) : Not Available
Type(s) : ADR Inferred
Groups : G6PD deficiency
Description : Increased risk of dose-related hemolysis.
References :
- Bacdivim™[package insert]. Philadelphia, Pennysylvania: Mutual Pharmaceutical Company; 2013. [Link]
PMID: 7679733
Sulfamethoxazole
Product: Exatecan
Identifier : DBSNPE003502
Drug : DB01015 (Sulfamethoxazole)
Interacting Gene/Enzyme : Glucose-6-phosphate 1-dehydrogenase
Gene Name : G6PD
UniProt ID : P11413
Allele Name : Brighton
Genotype(s) : Not Available
Type(s) : ADR Inferred
Groups : G6PD deficiency
Description : Increased risk of dose-related hemolysis.
References :
- Bacdivim™[package insert]. Philadelphia, Pennysylvania: Mutual Pharmaceutical Company; 2013. [Link]
PMID: 1320979
Sulfamethoxazole
Product: Prulifloxacin
Identifier : DBSNPE003503
Drug : DB01015 (Sulfamethoxazole)
Interacting Gene/Enzyme : Glucose-6-phosphate 1-dehydrogenase
Gene Name : G6PD
UniProt ID : P11413
Allele Name : Kozukata
Genotype(s) : Not Available
Type(s) : ADR Inferred
Groups : G6PD deficiency
Description : Increased risk of dose-related hemolysis.
References :
- Bacdivim™[package insert]. Philadelphia, Pennysylvania: Mutual Pharmaceutical Company; 2013. [Link]
PMID: 24187130
Sulfamethoxazole
Product: Udenafil
Identifier : DBSNPE003504
Drug : DB01015 (Sulfamethoxazole)
Interacting Gene/Enzyme : Glucose-6-phosphate 1-dehydrogenase
Gene Name : G6PD
UniProt ID : P11413
Allele Name : Amsterdam
Genotype(s) : Not Available
Type(s) : ADR Inferred
Groups : G6PD deficiency
Description : Increased risk of dose-related hemolysis.
References :
- Bacdivim™[package insert]. Philadelphia, Pennysylvania: Mutual Pharmaceutical Company; 2013. [Link]
PMID: 1348110
Sulfamethoxazole
Product: Nicergoline
Identifier : DBSNPE003505
Drug : DB01015 (Sulfamethoxazole)
Interacting Gene/Enzyme : Glucose-6-phosphate 1-dehydrogenase
Gene Name : G6PD
UniProt ID : P11413
Defining Change(s) :
- 202G->A, 376A->G, 1264C>G
Allele Name : No name
Genotype(s) : Not Available
Type(s) : ADR Inferred
Groups : G6PD deficiency
Description : Increased risk of dose-related hemolysis.
References :
- Bacdivim™[package insert]. Philadelphia, Pennysylvania: Mutual Pharmaceutical Company; 2013. [Link]
PMID: 1656303
Sulfamethoxazole
Product: Ceftibuten
Identifier : DBSNPE003506
Drug : DB01015 (Sulfamethoxazole)
Interacting Gene/Enzyme : Glucose-6-phosphate 1-dehydrogenase
Gene Name : G6PD
UniProt ID : P11413
Allele Name : Swansea
Genotype(s) : Not Available
Type(s) : ADR Inferred
Groups : G6PD deficiency
Description : Increased risk of dose-related hemolysis.
References :
- Bacdivim™[package insert]. Philadelphia, Pennysylvania: Mutual Pharmaceutical Company; 2013. [Link]
PMID: 2824750
Sulfamethoxazole
Product: Formestane
Identifier : DBSNPE003507
Drug : DB01015 (Sulfamethoxazole)
Interacting Gene/Enzyme : Glucose-6-phosphate 1-dehydrogenase
Gene Name : G6PD
UniProt ID : P11413
Allele Name : Urayasu
Genotype(s) : Not Available
Type(s) : ADR Inferred
Groups : G6PD deficiency
Description : Increased risk of dose-related hemolysis.
References :
- Bacdivim™[package insert]. Philadelphia, Pennysylvania: Mutual Pharmaceutical Company; 2013. [Link]
PMID: 9109509
Sulfamethoxazole
Product: Tiagabine (hydrochloride)
Identifier : DBSNPE003508
Drug : DB01015 (Sulfamethoxazole)
Interacting Gene/Enzyme : Glucose-6-phosphate 1-dehydrogenase
Gene Name : G6PD
UniProt ID : P11413
Allele Name : Vancouver
Genotype(s) : Not Available
Type(s) : ADR Inferred
Groups : G6PD deficiency
Description : Increased risk of dose-related hemolysis.
References :
- Bacdivim™[package insert]. Philadelphia, Pennysylvania: Mutual Pharmaceutical Company; 2013. [Link]
PMID: 9353416
Sulfamethoxazole
Product: Miltefosine
Identifier : DBSNPE003510
Drug : DB01015 (Sulfamethoxazole)
Interacting Gene/Enzyme : Glucose-6-phosphate 1-dehydrogenase
Gene Name : G6PD
UniProt ID : P11413
Allele Name : Plymouth
Genotype(s) : Not Available
Type(s) : ADR Inferred
Groups : G6PD deficiency
Description : Increased risk of dose-related hemolysis.
References :
- Bacdivim™[package insert]. Philadelphia, Pennysylvania: Mutual Pharmaceutical Company; 2013. [Link]
PMID: 8182708
Sulfamethoxazole
Product: Indinavir (sulfate)
Identifier : DBSNPE003511
Drug : DB01015 (Sulfamethoxazole)
Interacting Gene/Enzyme : Glucose-6-phosphate 1-dehydrogenase
Gene Name : G6PD
UniProt ID : P11413
Allele Name : Volendam
Genotype(s) : Not Available
Type(s) : ADR Inferred
Groups : G6PD deficiency
Description : Increased risk of dose-related hemolysis.
References :
- Bacdivim™[package insert]. Philadelphia, Pennysylvania: Mutual Pharmaceutical Company; 2013. [Link]
PMID: 25663984
Sulfamethoxazole
Product: Indinavir
Identifier : DBSNPE003512
Drug : DB01015 (Sulfamethoxazole)
Interacting Gene/Enzyme : Glucose-6-phosphate 1-dehydrogenase
Gene Name : G6PD
UniProt ID : P11413
Allele Name : Shinshu
Genotype(s) : Not Available
Type(s) : ADR Inferred
Groups : G6PD deficiency
Description : Increased risk of dose-related hemolysis.
References :
- Bacdivim™[package insert]. Philadelphia, Pennysylvania: Mutual Pharmaceutical Company; 2013. [Link]
PMID: 25490143
Sulfamethoxazole
Product: Valrubicin
Identifier : DBSNPE003513
Drug : DB01015 (Sulfamethoxazole)
Interacting Gene/Enzyme : Glucose-6-phosphate 1-dehydrogenase
Gene Name : G6PD
UniProt ID : P11413
Allele Name : Chikugo
Genotype(s) : Not Available
Type(s) : ADR Inferred
Groups : G6PD deficiency
Description : Increased risk of dose-related hemolysis.
References :
- Bacdivim™[package insert]. Philadelphia, Pennysylvania: Mutual Pharmaceutical Company; 2013. [Link]
PMID: 24603327
Sulfamethoxazole
Product: Dapsone
Identifier : DBSNPE003514
Drug : DB01015 (Sulfamethoxazole)
Interacting Gene/Enzyme : Glucose-6-phosphate 1-dehydrogenase
Gene Name : G6PD
UniProt ID : P11413
Allele Name : Tsukui
Genotype(s) : Not Available
Type(s) : ADR Inferred
Groups : G6PD deficiency
Description : Increased risk of dose-related hemolysis.
References :
- Bacdivim™[package insert]. Philadelphia, Pennysylvania: Mutual Pharmaceutical Company; 2013. [Link]
PMID: 24105441
Sulfamethoxazole
Product: Warfarin
Identifier : DBSNPE003515
Drug : DB01015 (Sulfamethoxazole)
Interacting Gene/Enzyme : Glucose-6-phosphate 1-dehydrogenase
Gene Name : G6PD
UniProt ID : P11413
Allele Name : Pedoplis-Ckaro
Genotype(s) : Not Available
Type(s) : ADR Inferred
Groups : G6PD deficiency
Description : Increased risk of dose-related hemolysis.
References :
- Bacdivim™[package insert]. Philadelphia, Pennysylvania: Mutual Pharmaceutical Company; 2013. [Link]
PMID: 23775075
Sulfamethoxazole
Product: Rimantadine (hydrochloride)
Identifier : DBSNPE003516
Drug : DB01015 (Sulfamethoxazole)
Interacting Gene/Enzyme : Glucose-6-phosphate 1-dehydrogenase
Gene Name : G6PD
UniProt ID : P11413
Allele Name : Santiago
Genotype(s) : Not Available
Type(s) : ADR Inferred
Groups : G6PD deficiency
Description : Increased risk of dose-related hemolysis.
References :
- Bacdivim™[package insert]. Philadelphia, Pennysylvania: Mutual Pharmaceutical Company; 2013. [Link]
PMID: 23542927
Sulfamethoxazole
Product: Enalapril
Identifier : DBSNPE003517
Drug : DB01015 (Sulfamethoxazole)
Interacting Gene/Enzyme : Glucose-6-phosphate 1-dehydrogenase
Gene Name : G6PD
UniProt ID : P11413
Allele Name : Minnesota, Marion, Gastonia, LeJeune
Genotype(s) : Not Available
Type(s) : ADR Inferred
Groups : G6PD deficiency
Description : Increased risk of dose-related hemolysis.
References :
- Bacdivim™[package insert]. Philadelphia, Pennysylvania: Mutual Pharmaceutical Company; 2013. [Link]
PMID: 22343623
Sulfamethoxazole
Product: Sitagliptin (phosphate)
Identifier : DBSNPE003518
Drug : DB01015 (Sulfamethoxazole)
Interacting Gene/Enzyme : Glucose-6-phosphate 1-dehydrogenase
Gene Name : G6PD
UniProt ID : P11413
Allele Name : Cincinnati
Genotype(s) : Not Available
Type(s) : ADR Inferred
Groups : G6PD deficiency
Description : Increased risk of dose-related hemolysis.
References :
- Bacdivim™[package insert]. Philadelphia, Pennysylvania: Mutual Pharmaceutical Company; 2013. [Link]
PMID: 23166745
Sulfamethoxazole
Product: Sitagliptin
Identifier : DBSNPE003519
Drug : DB01015 (Sulfamethoxazole)
Interacting Gene/Enzyme : Glucose-6-phosphate 1-dehydrogenase
Gene Name : G6PD
UniProt ID : P11413
Allele Name : Harilaou
Genotype(s) : Not Available
Type(s) : ADR Inferred
Groups : G6PD deficiency
Description : Increased risk of dose-related hemolysis.
References :
- Bacdivim™[package insert]. Philadelphia, Pennysylvania: Mutual Pharmaceutical Company; 2013. [Link]
PMID: 21666232
Sulfamethoxazole
Product: Pixantrone
Identifier : DBSNPE003520
Drug : DB01015 (Sulfamethoxazole)
Interacting Gene/Enzyme : Glucose-6-phosphate 1-dehydrogenase
Gene Name : G6PD
UniProt ID : P11413
Allele Name : North Dallas
Genotype(s) : Not Available
Type(s) : ADR Inferred
Groups : G6PD deficiency
Description : Increased risk of dose-related hemolysis.
References :
- Bacdivim™[package insert]. Philadelphia, Pennysylvania: Mutual Pharmaceutical Company; 2013. [Link]
PMID: 19924112
Sulfamethoxazole
Product: Metaxalone
Identifier : DBSNPE003521
Drug : DB01015 (Sulfamethoxazole)
Interacting Gene/Enzyme : Glucose-6-phosphate 1-dehydrogenase
Gene Name : G6PD
UniProt ID : P11413
Allele Name : Asahikawa
Genotype(s) : Not Available
Type(s) : ADR Inferred
Groups : G6PD deficiency
Description : Increased risk of dose-related hemolysis.
References :
- Bacdivim™[package insert]. Philadelphia, Pennysylvania: Mutual Pharmaceutical Company; 2013. [Link]
PMID: 20696141
Sulfamethoxazole
Product: Etizolam
Identifier : DBSNPE003522
Drug : DB01015 (Sulfamethoxazole)
Interacting Gene/Enzyme : Glucose-6-phosphate 1-dehydrogenase
Gene Name : G6PD
UniProt ID : P11413
Allele Name : Durham
Genotype(s) : Not Available
Type(s) : ADR Inferred
Groups : G6PD deficiency
Description : Increased risk of dose-related hemolysis.
References :
- Bacdivim™[package insert]. Philadelphia, Pennysylvania: Mutual Pharmaceutical Company; 2013. [Link]
PMID: 8201586
Sulfamethoxazole
Product: Ebastine
Identifier : DBSNPE003523
Drug : DB01015 (Sulfamethoxazole)
Interacting Gene/Enzyme : Glucose-6-phosphate 1-dehydrogenase
Gene Name : G6PD
UniProt ID : P11413
Allele Name : Stonybrook
Genotype(s) : Not Available
Type(s) : ADR Inferred
Groups : G6PD deficiency
Description : Increased risk of dose-related hemolysis.
References :
- Bacdivim™[package insert]. Philadelphia, Pennysylvania: Mutual Pharmaceutical Company; 2013. [Link]
PMID: 7799399
Sulfamethoxazole
Product: Pirfenidone
Identifier : DBSNPE003524
Drug : DB01015 (Sulfamethoxazole)
Interacting Gene/Enzyme : Glucose-6-phosphate 1-dehydrogenase
Gene Name : G6PD
UniProt ID : P11413
Allele Name : Wayne
Genotype(s) : Not Available
Type(s) : ADR Inferred
Groups : G6PD deficiency
Description : Increased risk of dose-related hemolysis.
References :
- Bacdivim™[package insert]. Philadelphia, Pennysylvania: Mutual Pharmaceutical Company; 2013. [Link]
PMID: 11478923
Sulfamethoxazole
Product: β-Estradiol 17-valerate
Identifier : DBSNPE003525
Drug : DB01015 (Sulfamethoxazole)
Interacting Gene/Enzyme : Glucose-6-phosphate 1-dehydrogenase
Gene Name : G6PD
UniProt ID : P11413
Allele Name : Aveiro
Genotype(s) : Not Available
Type(s) : ADR Inferred
Groups : G6PD deficiency
Description : Increased risk of dose-related hemolysis.
References :
- Bacdivim™[package insert]. Philadelphia, Pennysylvania: Mutual Pharmaceutical Company; 2013. [Link]
PMID: 10822054
Sulfamethoxazole
Product: Dihydroergotamine (mesylate)
Identifier : DBSNPE003526
Drug : DB01015 (Sulfamethoxazole)
Interacting Gene/Enzyme : Glucose-6-phosphate 1-dehydrogenase
Gene Name : G6PD
UniProt ID : P11413
Allele Name : Cleveland Corum
Genotype(s) : Not Available
Type(s) : ADR Inferred
Groups : G6PD deficiency
Description : Increased risk of dose-related hemolysis.
References :
- Bacdivim™[package insert]. Philadelphia, Pennysylvania: Mutual Pharmaceutical Company; 2013. [Link]
PMID: 9836606
Sulfamethoxazole
Product: Balsalazide
Identifier : DBSNPE003527
Drug : DB01015 (Sulfamethoxazole)
Interacting Gene/Enzyme : Glucose-6-phosphate 1-dehydrogenase
Gene Name : G6PD
UniProt ID : P11413
Allele Name : Lille
Genotype(s) : Not Available
Type(s) : ADR Inferred
Groups : G6PD deficiency
Description : Increased risk of dose-related hemolysis.
References :
- Bacdivim™[package insert]. Philadelphia, Pennysylvania: Mutual Pharmaceutical Company; 2013. [Link]
PMID: 22737280
Sulfamethoxazole
Product: Ciprofibrate
Identifier : DBSNPE003529
Drug : DB01015 (Sulfamethoxazole)
Interacting Gene/Enzyme : Glucose-6-phosphate 1-dehydrogenase
Gene Name : G6PD
UniProt ID : P11413
Allele Name : Sugao
Genotype(s) : Not Available
Type(s) : ADR Inferred
Groups : G6PD deficiency
Description : Increased risk of dose-related hemolysis.
References :
- Bacdivim™[package insert]. Philadelphia, Pennysylvania: Mutual Pharmaceutical Company; 2013. [Link]
PMID: 22091479
Sulfamethoxazole
Product: Tamsulosin (hydrochloride)
Identifier : DBSNPE003530
Drug : DB01015 (Sulfamethoxazole)
Interacting Gene/Enzyme : Glucose-6-phosphate 1-dehydrogenase
Gene Name : G6PD
UniProt ID : P11413
Allele Name : La Jolla
Genotype(s) : Not Available
Type(s) : ADR Inferred
Groups : G6PD deficiency
Description : Increased risk of dose-related hemolysis.
References :
- Bacdivim™[package insert]. Philadelphia, Pennysylvania: Mutual Pharmaceutical Company; 2013. [Link]
PMID: 25660025
Sulfamethoxazole
Product: Tamsulosin
Identifier : DBSNPE003531
Drug : DB01015 (Sulfamethoxazole)
Interacting Gene/Enzyme : Glucose-6-phosphate 1-dehydrogenase
Gene Name : G6PD
UniProt ID : P11413
Allele Name : Wexham
Genotype(s) : Not Available
Type(s) : ADR Inferred
Groups : G6PD deficiency
Description : Increased risk of dose-related hemolysis.
References :
- Bacdivim™[package insert]. Philadelphia, Pennysylvania: Mutual Pharmaceutical Company; 2013. [Link]
PMID: 25402598
Sulfamethoxazole
Product: Eicosapentaenoic Acid
Identifier : DBSNPE003532
Drug : DB01015 (Sulfamethoxazole)
Interacting Gene/Enzyme : Glucose-6-phosphate 1-dehydrogenase
Gene Name : G6PD
UniProt ID : P11413
Allele Name : Piodivkow
Genotype(s) : Not Available
Type(s) : ADR Inferred
Groups : G6PD deficiency
Description : Increased risk of dose-related hemolysis.
References :
- Bacdivim™[package insert]. Philadelphia, Pennysylvania: Mutual Pharmaceutical Company; 2013. [Link]
PMID: 19856362
Sulfamethoxazole
Product: UK 14,304
Identifier : DBSNPE003533
Drug : DB01015 (Sulfamethoxazole)
Interacting Gene/Enzyme : Glucose-6-phosphate 1-dehydrogenase
Gene Name : G6PD
UniProt ID : P11413
Allele Name : West Virginia
Genotype(s) : Not Available
Type(s) : ADR Inferred
Groups : G6PD deficiency
Description : Increased risk of dose-related hemolysis.
References :
- Bacdivim™[package insert]. Philadelphia, Pennysylvania: Mutual Pharmaceutical Company; 2013. [Link]
PMID: 21986572
Sulfamethoxazole
Product: Rabeprazole (sodium)
Identifier : DBSNPE003534
Drug : DB01015 (Sulfamethoxazole)
Interacting Gene/Enzyme : Glucose-6-phosphate 1-dehydrogenase
Gene Name : G6PD
UniProt ID : P11413
Allele Name : Omiya
Genotype(s) : Not Available
Type(s) : ADR Inferred
Groups : G6PD deficiency
Description : Increased risk of dose-related hemolysis.
References :
- Bacdivim™[package insert]. Philadelphia, Pennysylvania: Mutual Pharmaceutical Company; 2013. [Link]
PMID: 20597485
Sulfamethoxazole
Product: Rabeprazole
Identifier : DBSNPE003535
Drug : DB01015 (Sulfamethoxazole)
Interacting Gene/Enzyme : Glucose-6-phosphate 1-dehydrogenase
Gene Name : G6PD
UniProt ID : P11413
Defining Change(s) :
- 953_976delCCACCAAAGGGTACCTGGAC GACC
Allele Name : Nara
Genotype(s) : Not Available
Type(s) : ADR Inferred
Groups : G6PD deficiency
Description : Increased risk of dose-related hemolysis.
References :
- Bacdivim™[package insert]. Philadelphia, Pennysylvania: Mutual Pharmaceutical Company; 2013. [Link]
PMID: 16627469
Sulfamethoxazole
Product: Zofenopril (calcium)
Identifier : DBSNPE003536
Drug : DB01015 (Sulfamethoxazole)
Interacting Gene/Enzyme : Glucose-6-phosphate 1-dehydrogenase
Gene Name : G6PD
UniProt ID : P11413
Allele Name : Manhattan
Genotype(s) : Not Available
Type(s) : ADR Inferred
Groups : G6PD deficiency
Description : Increased risk of dose-related hemolysis.
References :
- Bacdivim™[package insert]. Philadelphia, Pennysylvania: Mutual Pharmaceutical Company; 2013. [Link]
PMID: 20068098
Sulfamethoxazole
Product: Duloxetine
Identifier : DBSNPE003537
Drug : DB01015 (Sulfamethoxazole)
Interacting Gene/Enzyme : Glucose-6-phosphate 1-dehydrogenase
Gene Name : G6PD
UniProt ID : P11413
Allele Name : Rehevot
Genotype(s) : Not Available
Type(s) : ADR Inferred
Groups : G6PD deficiency
Description : Increased risk of dose-related hemolysis.
References :
- Bacdivim™[package insert]. Philadelphia, Pennysylvania: Mutual Pharmaceutical Company; 2013. [Link]
PMID: 18290633
Sulfamethoxazole
Product: Etonogestrel
Identifier : DBSNPE003538
Drug : DB01015 (Sulfamethoxazole)
Interacting Gene/Enzyme : Glucose-6-phosphate 1-dehydrogenase
Gene Name : G6PD
UniProt ID : P11413
Allele Name : Honiara
Genotype(s) : Not Available
Type(s) : ADR Inferred
Groups : G6PD deficiency
Description : Increased risk of dose-related hemolysis.
References :
- Bacdivim™[package insert]. Philadelphia, Pennysylvania: Mutual Pharmaceutical Company; 2013. [Link]
PMID: 16433906
Sulfamethoxazole
Product: Medroxyprogesterone
Identifier : DBSNPE003539
Drug : DB01015 (Sulfamethoxazole)
Interacting Gene/Enzyme : Glucose-6-phosphate 1-dehydrogenase
Gene Name : G6PD
UniProt ID : P11413
Allele Name : Tokyo, Fukushima
Genotype(s) : Not Available
Type(s) : ADR Inferred
Groups : G6PD deficiency
Description : Increased risk of dose-related hemolysis.
References :
- Bacdivim™[package insert]. Philadelphia, Pennysylvania: Mutual Pharmaceutical Company; 2013. [Link]
PMID: 19351824
Sulfamethoxazole
Product: Prednisolone (disodium phosphate)
Identifier : DBSNPE003540
Drug : DB01015 (Sulfamethoxazole)
Interacting Gene/Enzyme : Glucose-6-phosphate 1-dehydrogenase
Gene Name : G6PD
UniProt ID : P11413
Allele Name : Chatham
Genotype(s) : Not Available
Type(s) : ADR Inferred
Groups : G6PD deficiency
Description : Increased risk of dose-related hemolysis.
References :
- Bacdivim™[package insert]. Philadelphia, Pennysylvania: Mutual Pharmaceutical Company; 2013. [Link]
PMID: 10973989
Sulfamethoxazole
Product: Dirithromycin
Identifier : DBSNPE003541
Drug : DB01015 (Sulfamethoxazole)
Interacting Gene/Enzyme : Glucose-6-phosphate 1-dehydrogenase
Gene Name : G6PD
UniProt ID : P11413
Allele Name : Fushan
Genotype(s) : Not Available
Type(s) : ADR Inferred
Groups : G6PD deficiency
Description : Increased risk of dose-related hemolysis.
References :
- Bacdivim™[package insert]. Philadelphia, Pennysylvania: Mutual Pharmaceutical Company; 2013. [Link]
PMID: 10542155
Sulfamethoxazole
Product: Epinastine
Identifier : DBSNPE003542
Drug : DB01015 (Sulfamethoxazole)
Interacting Gene/Enzyme : Glucose-6-phosphate 1-dehydrogenase
Gene Name : G6PD
UniProt ID : P11413
Allele Name : Partenope
Genotype(s) : Not Available
Type(s) : ADR Inferred
Groups : G6PD deficiency
Description : Increased risk of dose-related hemolysis.
References :
- Bacdivim™[package insert]. Philadelphia, Pennysylvania: Mutual Pharmaceutical Company; 2013. [Link]
PMID: 25902731
Sulfamethoxazole
Product: Amifostine
Identifier : DBSNPE003543
Drug : DB01015 (Sulfamethoxazole)
Interacting Gene/Enzyme : Glucose-6-phosphate 1-dehydrogenase
Gene Name : G6PD
UniProt ID : P11413
Allele Name : Ierapediva
Genotype(s) : Not Available
Type(s) : ADR Inferred
Groups : G6PD deficiency
Description : Increased risk of dose-related hemolysis.
References :
- Bacdivim™[package insert]. Philadelphia, Pennysylvania: Mutual Pharmaceutical Company; 2013. [Link]
PMID: 24013174
Sulfamethoxazole
Product: Bezafibrate
Identifier : DBSNPE003544
Drug : DB01015 (Sulfamethoxazole)
Interacting Gene/Enzyme : Glucose-6-phosphate 1-dehydrogenase
Gene Name : G6PD
UniProt ID : P11413
Allele Name : Anadia
Genotype(s) : Not Available
Type(s) : ADR Inferred
Groups : G6PD deficiency
Description : Increased risk of dose-related hemolysis.
References :
- Bacdivim™[package insert]. Philadelphia, Pennysylvania: Mutual Pharmaceutical Company; 2013. [Link]
PMID: 23105120
Sulfamethoxazole
Product: Triamcinolone (acetonide)
Identifier : DBSNPE003545
Drug : DB01015 (Sulfamethoxazole)
Interacting Gene/Enzyme : Glucose-6-phosphate 1-dehydrogenase
Gene Name : G6PD
UniProt ID : P11413
Allele Name : Abeno
Genotype(s) : Not Available
Type(s) : ADR Inferred
Groups : G6PD deficiency
Description : Increased risk of dose-related hemolysis.
References :
- Bacdivim™[package insert]. Philadelphia, Pennysylvania: Mutual Pharmaceutical Company; 2013. [Link]
PMID: 12529430
Sulfamethoxazole
Product: Aceclofenac
Identifier : DBSNPE003547
Drug : DB01015 (Sulfamethoxazole)
Interacting Gene/Enzyme : Glucose-6-phosphate 1-dehydrogenase
Gene Name : G6PD
UniProt ID : P11413
Allele Name : Pawnee
Genotype(s) : Not Available
Type(s) : ADR Inferred
Groups : G6PD deficiency
Description : Increased risk of dose-related hemolysis.
References :
- Bacdivim™[package insert]. Philadelphia, Pennysylvania: Mutual Pharmaceutical Company; 2013. [Link]
PMID: 20857469
Sulfamethoxazole
Product: Vinflunine
Identifier : DBSNPE003548
Drug : DB01015 (Sulfamethoxazole)
Interacting Gene/Enzyme : Glucose-6-phosphate 1-dehydrogenase
Gene Name : G6PD
UniProt ID : P11413
Allele Name : S. Antioco
Genotype(s) : Not Available
Type(s) : ADR Inferred
Groups : G6PD deficiency
Description : Increased risk of dose-related hemolysis.
References :
- Bacdivim™[package insert]. Philadelphia, Pennysylvania: Mutual Pharmaceutical Company; 2013. [Link]
PMID: 23394180
Sulfamethoxazole
Product: Ciclesonide
Identifier : DBSNPE003549
Drug : DB01015 (Sulfamethoxazole)
Interacting Gene/Enzyme : Glucose-6-phosphate 1-dehydrogenase
Gene Name : G6PD
UniProt ID : P11413
Allele Name : Cassano
Genotype(s) : Not Available
Type(s) : ADR Inferred
Groups : G6PD deficiency
Description : Increased risk of dose-related hemolysis.
References :
- Bacdivim™[package insert]. Philadelphia, Pennysylvania: Mutual Pharmaceutical Company; 2013. [Link]
PMID: 23875972
Sulfamethoxazole
Product: Ropinirole (hydrochloride)
Identifier : DBSNPE003550
Drug : DB01015 (Sulfamethoxazole)
Interacting Gene/Enzyme : Glucose-6-phosphate 1-dehydrogenase
Gene Name : G6PD
UniProt ID : P11413
Allele Name : Hermoupolis
Genotype(s) : Not Available
Type(s) : ADR Inferred
Groups : G6PD deficiency
Description : Increased risk of dose-related hemolysis.
References :
- Bacdivim™[package insert]. Philadelphia, Pennysylvania: Mutual Pharmaceutical Company; 2013. [Link]
PMID: 15476401
Sulfamethoxazole
Product: Triclabendazole
Identifier : DBSNPE003551
Drug : DB01015 (Sulfamethoxazole)
Interacting Gene/Enzyme : Glucose-6-phosphate 1-dehydrogenase
Gene Name : G6PD
UniProt ID : P11413
Allele Name : Union,Maewo, Chinese-2, Kalo
Genotype(s) : Not Available
Type(s) : ADR Inferred
Groups : G6PD deficiency
Description : Increased risk of dose-related hemolysis.
References :
- Bacdivim™[package insert]. Philadelphia, Pennysylvania: Mutual Pharmaceutical Company; 2013. [Link]
PMID: 15367702
Sulfamethoxazole
Product: Dextromethorphan (hydrobromide)
Identifier : DBSNPE003552
Drug : DB01015 (Sulfamethoxazole)
Interacting Gene/Enzyme : Glucose-6-phosphate 1-dehydrogenase
Gene Name : G6PD
UniProt ID : P11413
Allele Name : Andalus
Genotype(s) : Not Available
Type(s) : ADR Inferred
Groups : G6PD deficiency
Description : Increased risk of dose-related hemolysis.
References :
- Bacdivim™[package insert]. Philadelphia, Pennysylvania: Mutual Pharmaceutical Company; 2013. [Link]
PMID: 28561035
Sulfamethoxazole
Product: Moricizine
Identifier : DBSNPE003553
Drug : DB01015 (Sulfamethoxazole)
Interacting Gene/Enzyme : Glucose-6-phosphate 1-dehydrogenase
Gene Name : G6PD
UniProt ID : P11413
Allele Name : Cosenza
Genotype(s) : Not Available
Type(s) : ADR Inferred
Groups : G6PD deficiency
Description : Increased risk of dose-related hemolysis.
References :
- Bacdivim™[package insert]. Philadelphia, Pennysylvania: Mutual Pharmaceutical Company; 2013. [Link]
PMID: 23303071
Sulfamethoxazole
Product: Mafenide (Acetate)
Identifier : DBSNPE003554
Drug : DB01015 (Sulfamethoxazole)
Interacting Gene/Enzyme : Glucose-6-phosphate 1-dehydrogenase
Gene Name : G6PD
UniProt ID : P11413
Allele Name : Canton, Taiwan- Hakka, Gifu-like, Agrigento-like
Genotype(s) : Not Available
Type(s) : ADR Inferred
Groups : G6PD deficiency
Description : Increased risk of dose-related hemolysis.
References :
- Bacdivim™[package insert]. Philadelphia, Pennysylvania: Mutual Pharmaceutical Company; 2013. [Link]
PMID: 24121008
Sulfamethoxazole
Product: Mafenide
Identifier : DBSNPE003555
Drug : DB01015 (Sulfamethoxazole)
Interacting Gene/Enzyme : Glucose-6-phosphate 1-dehydrogenase
Gene Name : G6PD
UniProt ID : P11413
Allele Name : Flores
Genotype(s) : Not Available
Type(s) : ADR Inferred
Groups : G6PD deficiency
Description : Increased risk of dose-related hemolysis.
References :
- Bacdivim™[package insert]. Philadelphia, Pennysylvania: Mutual Pharmaceutical Company; 2013. [Link]
PMID: 7991613
Sulfamethoxazole
Product: Lercanidipine (hydrochloride)
Identifier : DBSNPE003557
Drug : DB01015 (Sulfamethoxazole)
Interacting Gene/Enzyme : Glucose-6-phosphate 1-dehydrogenase
Gene Name : G6PD
UniProt ID : P11413
Allele Name : Kamogawa
Genotype(s) : Not Available
Type(s) : ADR Inferred
Groups : G6PD deficiency
Description : Increased risk of dose-related hemolysis.
References :
- Bacdivim™[package insert]. Philadelphia, Pennysylvania: Mutual Pharmaceutical Company; 2013. [Link]
PMID: 20708942
Sulfamethoxazole
Product: Lercanidipine
Identifier : DBSNPE003558
Drug : DB01015 (Sulfamethoxazole)
Interacting Gene/Enzyme : Glucose-6-phosphate 1-dehydrogenase
Gene Name : G6PD
UniProt ID : P11413
Allele Name : Costanzo
Genotype(s) : Not Available
Type(s) : ADR Inferred
Groups : G6PD deficiency
Description : Increased risk of dose-related hemolysis.
References :
- Bacdivim™[package insert]. Philadelphia, Pennysylvania: Mutual Pharmaceutical Company; 2013. [Link]
PMID: 11279259
Sulfamethoxazole
Product: Misoprostol
Identifier : DBSNPE003559
Drug : DB01015 (Sulfamethoxazole)
Interacting Gene/Enzyme : Glucose-6-phosphate 1-dehydrogenase
Gene Name : G6PD
UniProt ID : P11413
Allele Name : Amazonia
Genotype(s) : Not Available
Type(s) : ADR Inferred
Groups : G6PD deficiency
Description : Increased risk of dose-related hemolysis.
References :
- Bacdivim™[package insert]. Philadelphia, Pennysylvania: Mutual Pharmaceutical Company; 2013. [Link]
PMID: 1637285
Sulfamethoxazole
Product: Mifamurtide
Identifier : DBSNPE003560
Drug : DB01015 (Sulfamethoxazole)
Interacting Gene/Enzyme : Glucose-6-phosphate 1-dehydrogenase
Gene Name : G6PD
UniProt ID : P11413
Allele Name : Songklanagarind
Genotype(s) : Not Available
Type(s) : ADR Inferred
Groups : G6PD deficiency
Description : Increased risk of dose-related hemolysis.
References :
- Bacdivim™[package insert]. Philadelphia, Pennysylvania: Mutual Pharmaceutical Company; 2013. [Link]
PMID: 23237800
Sulfamethoxazole
Product: Eslicarbazepine (acetate)
Identifier : DBSNPE003561
Drug : DB01015 (Sulfamethoxazole)
Interacting Gene/Enzyme : Glucose-6-phosphate 1-dehydrogenase
Gene Name : G6PD
UniProt ID : P11413
Allele Name : Hechi
Genotype(s) : Not Available
Type(s) : ADR Inferred
Groups : G6PD deficiency
Description : Increased risk of dose-related hemolysis.
References :
- Bacdivim™[package insert]. Philadelphia, Pennysylvania: Mutual Pharmaceutical Company; 2013. [Link]
PMID: 22954722
Sulfamethoxazole
Product: Tiagabine
Identifier : DBSNPE003562
Drug : DB01015 (Sulfamethoxazole)
Interacting Gene/Enzyme : Glucose-6-phosphate 1-dehydrogenase
Gene Name : G6PD
UniProt ID : P11413
Allele Name : Namouru
Genotype(s) : Not Available
Type(s) : ADR Inferred
Groups : G6PD deficiency
Description : Increased risk of dose-related hemolysis.
References :
- Bacdivim™[package insert]. Philadelphia, Pennysylvania: Mutual Pharmaceutical Company; 2013. [Link]
PMID: 22052811
Sulfamethoxazole
Product: Carmustine
Identifier : DBSNPE003563
Drug : DB01015 (Sulfamethoxazole)
Interacting Gene/Enzyme : Glucose-6-phosphate 1-dehydrogenase
Gene Name : G6PD
UniProt ID : P11413
Allele Name : Bao Loc
Genotype(s) : Not Available
Type(s) : ADR Inferred
Groups : G6PD deficiency
Description : Increased risk of dose-related hemolysis.
References :
- Bacdivim™[package insert]. Philadelphia, Pennysylvania: Mutual Pharmaceutical Company; 2013. [Link]
PMID: 24726384
Sulfamethoxazole
Product: Eptifibatide
Identifier : DBSNPE003564
Drug : DB01015 (Sulfamethoxazole)
Interacting Gene/Enzyme : Glucose-6-phosphate 1-dehydrogenase
Gene Name : G6PD
UniProt ID : P11413
Defining Change(s) :
- 375G->T, 379G->T383T->C384C>T
Allele Name : Crispim
Genotype(s) : Not Available
Type(s) : ADR Inferred
Groups : G6PD deficiency
Description : Increased risk of dose-related hemolysis.
References :
- Bacdivim™[package insert]. Philadelphia, Pennysylvania: Mutual Pharmaceutical Company; 2013. [Link]
PMID: 24280423
Sulfamethoxazole
Product: Bedaquiline (fumarate)
Identifier : DBSNPE003565
Drug : DB01015 (Sulfamethoxazole)
Interacting Gene/Enzyme : Glucose-6-phosphate 1-dehydrogenase
Gene Name : G6PD
UniProt ID : P11413
Allele Name : Acrokorinthos
Genotype(s) : Not Available
Type(s) : ADR Inferred
Groups : G6PD deficiency
Description : Increased risk of dose-related hemolysis.
References :
- Bacdivim™[package insert]. Philadelphia, Pennysylvania: Mutual Pharmaceutical Company; 2013. [Link]
PMID: 28257841
Sulfamethoxazole
Product: Bedaquiline
Identifier : DBSNPE003566
Drug : DB01015 (Sulfamethoxazole)
Interacting Gene/Enzyme : Glucose-6-phosphate 1-dehydrogenase
Gene Name : G6PD
UniProt ID : P11413
Allele Name : Santa Maria
Genotype(s) : Not Available
Type(s) : ADR Inferred
Groups : G6PD deficiency
Description : Increased risk of dose-related hemolysis.
References :
- Bacdivim™[package insert]. Philadelphia, Pennysylvania: Mutual Pharmaceutical Company; 2013. [Link]
PMID: 24178759
Sulfamethoxazole
Product: Iopamidol
Identifier : DBSNPE003567
Drug : DB01015 (Sulfamethoxazole)
Interacting Gene/Enzyme : Glucose-6-phosphate 1-dehydrogenase
Gene Name : G6PD
UniProt ID : P11413
Allele Name : Ananindeua
Genotype(s) : Not Available
Type(s) : ADR Inferred
Groups : G6PD deficiency
Description : Increased risk of dose-related hemolysis.
References :
- Bacdivim™[package insert]. Philadelphia, Pennysylvania: Mutual Pharmaceutical Company; 2013. [Link]
PMID: 24174263
Sulfamethoxazole
Product: Sarpogrelate (hydrochloride)
Identifier : DBSNPE003568
Drug : DB01015 (Sulfamethoxazole)
Interacting Gene/Enzyme : Glucose-6-phosphate 1-dehydrogenase
Gene Name : G6PD
UniProt ID : P11413
Allele Name : Vanua Lava
Genotype(s) : Not Available
Type(s) : ADR Inferred
Groups : G6PD deficiency
Description : Increased risk of dose-related hemolysis.
References :
- Bacdivim™[package insert]. Philadelphia, Pennysylvania: Mutual Pharmaceutical Company; 2013. [Link]
PMID: 23986182
Sulfamethoxazole
Product: Limaprost
Identifier : DBSNPE003569
Drug : DB01015 (Sulfamethoxazole)
Interacting Gene/Enzyme : Glucose-6-phosphate 1-dehydrogenase
Gene Name : G6PD
UniProt ID : P11413
Allele Name : Valladolid
Genotype(s) : Not Available
Type(s) : ADR Inferred
Groups : G6PD deficiency
Description : Increased risk of dose-related hemolysis.
References :
- Bacdivim™[package insert]. Philadelphia, Pennysylvania: Mutual Pharmaceutical Company; 2013. [Link]
PMID: 10875251
Sulfamethoxazole
Product: Lubiprostone
Identifier : DBSNPE003570
Drug : DB01015 (Sulfamethoxazole)
Interacting Gene/Enzyme : Glucose-6-phosphate 1-dehydrogenase
Gene Name : G6PD
UniProt ID : P11413
Allele Name : Belem
Genotype(s) : Not Available
Type(s) : ADR Inferred
Groups : G6PD deficiency
Description : Increased risk of dose-related hemolysis.
References :
- Bacdivim™[package insert]. Philadelphia, Pennysylvania: Mutual Pharmaceutical Company; 2013. [Link]
PMID: 10535455
Sulfamethoxazole
Product: Rasagiline
Identifier : DBSNPE003571
Drug : DB01015 (Sulfamethoxazole)
Interacting Gene/Enzyme : Glucose-6-phosphate 1-dehydrogenase
Gene Name : G6PD
UniProt ID : P11413
Allele Name : Liuzhou
Genotype(s) : Not Available
Type(s) : ADR Inferred
Groups : G6PD deficiency
Description : Increased risk of dose-related hemolysis.
References :
- Bacdivim™[package insert]. Philadelphia, Pennysylvania: Mutual Pharmaceutical Company; 2013. [Link]
PMID: 9075696
Sulfamethoxazole
Product: Fingolimod
Identifier : DBSNPE003572
Drug : DB01015 (Sulfamethoxazole)
Interacting Gene/Enzyme : Glucose-6-phosphate 1-dehydrogenase
Gene Name : G6PD
UniProt ID : P11413
Allele Name : Shenzen
Genotype(s) : Not Available
Type(s) : ADR Inferred
Groups : G6PD deficiency
Description : Increased risk of dose-related hemolysis.
References :
- Bacdivim™[package insert]. Philadelphia, Pennysylvania: Mutual Pharmaceutical Company; 2013. [Link]
PMID: 10650151
Sulfamethoxazole
Product: Raltitrexed
Identifier : DBSNPE003573
Drug : DB01015 (Sulfamethoxazole)
Interacting Gene/Enzyme : Glucose-6-phosphate 1-dehydrogenase
Gene Name : G6PD
UniProt ID : P11413
Allele Name : Taipei “Chinese- 3”
Genotype(s) : Not Available
Type(s) : ADR Inferred
Groups : G6PD deficiency
Description : Increased risk of dose-related hemolysis.
References :
- Bacdivim™[package insert]. Philadelphia, Pennysylvania: Mutual Pharmaceutical Company; 2013. [Link]
PMID: 7547985
Sulfamethoxazole
Product: Cyproterone (acetate)
Identifier : DBSNPE003574
Drug : DB01015 (Sulfamethoxazole)
Interacting Gene/Enzyme : Glucose-6-phosphate 1-dehydrogenase
Gene Name : G6PD
UniProt ID : P11413
Allele Name : Toledo
Genotype(s) : Not Available
Type(s) : ADR Inferred
Groups : G6PD deficiency
Description : Increased risk of dose-related hemolysis.
References :
- Bacdivim™[package insert]. Philadelphia, Pennysylvania: Mutual Pharmaceutical Company; 2013. [Link]
PMID: 7693328
Sulfamethoxazole
Product: Doxycycline (hyclate)
Identifier : DBSNPE003575
Drug : DB01015 (Sulfamethoxazole)
Interacting Gene/Enzyme : Glucose-6-phosphate 1-dehydrogenase
Gene Name : G6PD
UniProt ID : P11413
Allele Name : Naone
Genotype(s) : Not Available
Type(s) : ADR Inferred
Groups : G6PD deficiency
Description : Increased risk of dose-related hemolysis.
References :
- Bacdivim™[package insert]. Philadelphia, Pennysylvania: Mutual Pharmaceutical Company; 2013. [Link]
PMID: 22496574
Sulfamethoxazole
Product: Topotecan
Identifier : DBSNPE003576
Drug : DB01015 (Sulfamethoxazole)
Interacting Gene/Enzyme : Glucose-6-phosphate 1-dehydrogenase
Gene Name : G6PD
UniProt ID : P11413
Allele Name : Nankang
Genotype(s) : Not Available
Type(s) : ADR Inferred
Groups : G6PD deficiency
Description : Increased risk of dose-related hemolysis.
References :
- Bacdivim™[package insert]. Philadelphia, Pennysylvania: Mutual Pharmaceutical Company; 2013. [Link]
PMID: 20876278
Sulfamethoxazole
Product: Azelastine
Identifier : DBSNPE003577
Drug : DB01015 (Sulfamethoxazole)
Interacting Gene/Enzyme : Glucose-6-phosphate 1-dehydrogenase
Gene Name : G6PD
UniProt ID : P11413
Allele Name : Miaoli
Genotype(s) : Not Available
Type(s) : ADR Inferred
Groups : G6PD deficiency
Description : Increased risk of dose-related hemolysis.
References :
- Bacdivim™[package insert]. Philadelphia, Pennysylvania: Mutual Pharmaceutical Company; 2013. [Link]
PMID: 19001433
Sulfamethoxazole
Product: Miconazole (nitrate)
Identifier : DBSNPE003578
Drug : DB01015 (Sulfamethoxazole)
Interacting Gene/Enzyme : Glucose-6-phosphate 1-dehydrogenase
Gene Name : G6PD
UniProt ID : P11413
Allele Name : Mediterranean, Dallas, Panama‚ Sassari, Cagliari, Birmingham
Genotype(s) : Not Available
Type(s) : ADR Inferred
Groups : G6PD deficiency
Description : Increased risk of dose-related hemolysis.
References :
- Bacdivim™[package insert]. Philadelphia, Pennysylvania: Mutual Pharmaceutical Company; 2013. [Link]
PMID: 25621531
Sulfamethoxazole
Product: Diacerein
Identifier : DBSNPE003579
Drug : DB01015 (Sulfamethoxazole)
Interacting Gene/Enzyme : Glucose-6-phosphate 1-dehydrogenase
Gene Name : G6PD
UniProt ID : P11413
Allele Name : Coimbra Shunde
Genotype(s) : Not Available
Type(s) : ADR Inferred
Groups : G6PD deficiency
Description : Increased risk of dose-related hemolysis.
References :
- Bacdivim™[package insert]. Philadelphia, Pennysylvania: Mutual Pharmaceutical Company; 2013. [Link]
PMID: 25593987
Sulfamethoxazole
Product: Lomefloxacin
Identifier : DBSNPE003580
Drug : DB01015 (Sulfamethoxazole)
Interacting Gene/Enzyme : Glucose-6-phosphate 1-dehydrogenase
Gene Name : G6PD
UniProt ID : P11413
Allele Name : Nilgiri
Genotype(s) : Not Available
Type(s) : ADR Inferred
Groups : G6PD deficiency
Description : Increased risk of dose-related hemolysis.
References :
- Bacdivim™[package insert]. Philadelphia, Pennysylvania: Mutual Pharmaceutical Company; 2013. [Link]
PMID: 22776759
Sulfamethoxazole
Product: Paroxetine (hydrochloride hemihydrate)
Identifier : DBSNPE003581
Drug : DB01015 (Sulfamethoxazole)
Interacting Gene/Enzyme : Glucose-6-phosphate 1-dehydrogenase
Gene Name : G6PD
UniProt ID : P11413
Allele Name : Radlowo
Genotype(s) : Not Available
Type(s) : ADR Inferred
Groups : G6PD deficiency
Description : Increased risk of dose-related hemolysis.
References :
- Bacdivim™[package insert]. Philadelphia, Pennysylvania: Mutual Pharmaceutical Company; 2013. [Link]
PMID: 22952994
Sulfamethoxazole
Product: Homoharringtonine
Identifier : DBSNPE003582
Drug : DB01015 (Sulfamethoxazole)
Interacting Gene/Enzyme : Glucose-6-phosphate 1-dehydrogenase
Gene Name : G6PD
UniProt ID : P11413
Allele Name : Roubaix
Genotype(s) : Not Available
Type(s) : ADR Inferred
Groups : G6PD deficiency
Description : Increased risk of dose-related hemolysis.
References :
- Bacdivim™[package insert]. Philadelphia, Pennysylvania: Mutual Pharmaceutical Company; 2013. [Link]
PMID: 17554340
Sulfamethoxazole
Product: Tamoxifen
Identifier : DBSNPE003584
Drug : DB01015 (Sulfamethoxazole)
Interacting Gene/Enzyme : Glucose-6-phosphate 1-dehydrogenase
Gene Name : G6PD
UniProt ID : P11413
Allele Name : Chinese-1
Genotype(s) : Not Available
Type(s) : ADR Inferred
Groups : G6PD deficiency
Description : Increased risk of dose-related hemolysis.
References :
- Bacdivim™[package insert]. Philadelphia, Pennysylvania: Mutual Pharmaceutical Company; 2013. [Link]
PMID: 17502136
Sulfamethoxazole
Product: Donepezil
Identifier : DBSNPE003585
Drug : DB01015 (Sulfamethoxazole)
Interacting Gene/Enzyme : Glucose-6-phosphate 1-dehydrogenase
Gene Name : G6PD
UniProt ID : P11413
Allele Name : Mizushima
Genotype(s) : Not Available
Type(s) : ADR Inferred
Groups : G6PD deficiency
Description : Increased risk of dose-related hemolysis.
References :
- Bacdivim™[package insert]. Philadelphia, Pennysylvania: Mutual Pharmaceutical Company; 2013. [Link]
PMID: 21481589
Sulfamethoxazole
Product: Voglibose
Identifier : DBSNPE003586
Drug : DB01015 (Sulfamethoxazole)
Interacting Gene/Enzyme : Glucose-6-phosphate 1-dehydrogenase
Gene Name : G6PD
UniProt ID : P11413
Allele Name : Osaka
Genotype(s) : Not Available
Type(s) : ADR Inferred
Groups : G6PD deficiency
Description : Increased risk of dose-related hemolysis.
References :
- Bacdivim™[package insert]. Philadelphia, Pennysylvania: Mutual Pharmaceutical Company; 2013. [Link]
PMID: 21538437
Sulfamethoxazole
Product: PPQ-102
Identifier : DBSNPE003587
Drug : DB01015 (Sulfamethoxazole)
Interacting Gene/Enzyme : Glucose-6-phosphate 1-dehydrogenase
Gene Name : G6PD
UniProt ID : P11413
Allele Name : Viangchan, Jammu
Genotype(s) : Not Available
Type(s) : ADR Inferred
Groups : G6PD deficiency
Description : Increased risk of dose-related hemolysis.
References :
- Bacdivim™[package insert]. Philadelphia, Pennysylvania: Mutual Pharmaceutical Company; 2013. [Link]
PMID: 18762160
Sulfamethoxazole
Product: Diclofenac
Identifier : DBSNPE003588
Drug : DB01015 (Sulfamethoxazole)
Interacting Gene/Enzyme : Glucose-6-phosphate 1-dehydrogenase
Gene Name : G6PD
UniProt ID : P11413
Allele Name : Seoul
Genotype(s) : Not Available
Type(s) : ADR Inferred
Groups : G6PD deficiency
Description : Increased risk of dose-related hemolysis.
References :
- Bacdivim™[package insert]. Philadelphia, Pennysylvania: Mutual Pharmaceutical Company; 2013. [Link]
PMID: 8222273
Sulfamethoxazole
Product: Fluoxetine
Identifier : DBSNPE003589
Drug : DB01015 (Sulfamethoxazole)
Interacting Gene/Enzyme : Glucose-6-phosphate 1-dehydrogenase
Gene Name : G6PD
UniProt ID : P11413
Allele Name : Ludhiana
Genotype(s) : Not Available
Type(s) : ADR Inferred
Groups : G6PD deficiency
Description : Increased risk of dose-related hemolysis.
References :
- Bacdivim™[package insert]. Philadelphia, Pennysylvania: Mutual Pharmaceutical Company; 2013. [Link]
PMID: 1431593
Sulfamethoxazole
Product: Talipexole
Identifier : DBSNPE003590
Drug : DB01015 (Sulfamethoxazole)
Interacting Gene/Enzyme : Glucose-6-phosphate 1-dehydrogenase
Gene Name : G6PD
UniProt ID : P11413
Allele Name : Farroupilha
Genotype(s) : Not Available
Type(s) : ADR Inferred
Groups : G6PD deficiency
Description : Increased risk of dose-related hemolysis.
References :
- Bacdivim™[package insert]. Philadelphia, Pennysylvania: Mutual Pharmaceutical Company; 2013. [Link]
PMID: 6441143
Sulfamethoxazole
Product: Sibutramine (hydrochloride monohydrate)
Identifier : DBSNPE003591
Drug : DB01015 (Sulfamethoxazole)
Interacting Gene/Enzyme : Glucose-6-phosphate 1-dehydrogenase
Gene Name : G6PD
UniProt ID : P11413
Allele Name : Chinese-5
Genotype(s) : Not Available
Type(s) : ADR Inferred
Groups : G6PD deficiency
Description : Increased risk of dose-related hemolysis.
References :
- Bacdivim™[package insert]. Philadelphia, Pennysylvania: Mutual Pharmaceutical Company; 2013. [Link]
PMID: 23524670
Sulfamethoxazole
Product: Sibutramine (hydrochloride)
Identifier : DBSNPE003592
Drug : DB01015 (Sulfamethoxazole)
Interacting Gene/Enzyme : Glucose-6-phosphate 1-dehydrogenase
Gene Name : G6PD
UniProt ID : P11413
Allele Name : Rignano
Genotype(s) : Not Available
Type(s) : ADR Inferred
Groups : G6PD deficiency
Description : Increased risk of dose-related hemolysis.
References :
- Bacdivim™[package insert]. Philadelphia, Pennysylvania: Mutual Pharmaceutical Company; 2013. [Link]
PMID: 12176665
Sulfamethoxazole
Product: Zaltoprofen
Identifier : DBSNPE003593
Drug : DB01015 (Sulfamethoxazole)
Interacting Gene/Enzyme : Glucose-6-phosphate 1-dehydrogenase
Gene Name : G6PD
UniProt ID : P11413
Allele Name : Orissa
Genotype(s) : Not Available
Type(s) : ADR Inferred
Groups : G6PD deficiency
Description : Increased risk of dose-related hemolysis.
References :
- Bacdivim™[package insert]. Philadelphia, Pennysylvania: Mutual Pharmaceutical Company; 2013. [Link]
PMID: 21614002
Sulfamethoxazole
Product: Nimorazole
Identifier : DBSNPE003594
Drug : DB01015 (Sulfamethoxazole)
Interacting Gene/Enzyme : Glucose-6-phosphate 1-dehydrogenase
Gene Name : G6PD
UniProt ID : P11413
Allele Name : G6PDNice
Genotype(s) : Not Available
Type(s) : ADR Inferred
Groups : G6PD deficiency
Description : Increased risk of dose-related hemolysis.
References :
- Bacdivim™[package insert]. Philadelphia, Pennysylvania: Mutual Pharmaceutical Company; 2013. [Link]
PMID: 7654694
Sulfamethoxazole
Product: Mirodenafil
Identifier : DBSNPE003595
Drug : DB01015 (Sulfamethoxazole)
Interacting Gene/Enzyme : Glucose-6-phosphate 1-dehydrogenase
Gene Name : G6PD
UniProt ID : P11413
Allele Name : Kamiube, Keelung
Genotype(s) : Not Available
Type(s) : ADR Inferred
Groups : G6PD deficiency
Description : Increased risk of dose-related hemolysis.
References :
- Bacdivim™[package insert]. Philadelphia, Pennysylvania: Mutual Pharmaceutical Company; 2013. [Link]
PMID: 1691947
Sulfamethoxazole
Product: Ademetionine
Identifier : DBSNPE003596
Drug : DB01015 (Sulfamethoxazole)
Interacting Gene/Enzyme : Glucose-6-phosphate 1-dehydrogenase
Gene Name : G6PD
UniProt ID : P11413
Allele Name : Neapolis
Genotype(s) : Not Available
Type(s) : ADR Inferred
Groups : G6PD deficiency
Description : Increased risk of dose-related hemolysis.
References :
- Bacdivim™[package insert]. Philadelphia, Pennysylvania: Mutual Pharmaceutical Company; 2013. [Link]
PMID: 1696151
Sulfamethoxazole
Product: DUBs-IN-1
Identifier : DBSNPE003597
Drug : DB01015 (Sulfamethoxazole)
Interacting Gene/Enzyme : Glucose-6-phosphate 1-dehydrogenase
Gene Name : G6PD
UniProt ID : P11413
Allele Name : Aures
Genotype(s) : Not Available
Type(s) : ADR Inferred
Groups : G6PD deficiency
Description : Increased risk of dose-related hemolysis.
References :
- Bacdivim™[package insert]. Philadelphia, Pennysylvania: Mutual Pharmaceutical Company; 2013. [Link]
PMID: 3479247
Sulfamethoxazole
Product: DUBs-IN-2
Identifier : DBSNPE003598
Drug : DB01015 (Sulfamethoxazole)
Interacting Gene/Enzyme : Glucose-6-phosphate 1-dehydrogenase
Gene Name : G6PD
UniProt ID : P11413
Allele Name : Split
Genotype(s) : Not Available
Type(s) : ADR Inferred
Groups : G6PD deficiency
Description : Increased risk of dose-related hemolysis.
References :
- Bacdivim™[package insert]. Philadelphia, Pennysylvania: Mutual Pharmaceutical Company; 2013. [Link]
PMID: 8480540
Sulfamethoxazole
Product: DUBs-IN-3
Identifier : DBSNPE003599
Drug : DB01015 (Sulfamethoxazole)
Interacting Gene/Enzyme : Glucose-6-phosphate 1-dehydrogenase
Gene Name : G6PD
UniProt ID : P11413
Allele Name : Kambos
Genotype(s) : Not Available
Type(s) : ADR Inferred
Groups : G6PD deficiency
Description : Increased risk of dose-related hemolysis.
References :
- Bacdivim™[package insert]. Philadelphia, Pennysylvania: Mutual Pharmaceutical Company; 2013. [Link]
PMID: 1793063
Sulfamethoxazole
Product: Maribavir
Identifier : DBSNPE003600
Drug : DB01015 (Sulfamethoxazole)
Interacting Gene/Enzyme : Glucose-6-phosphate 1-dehydrogenase
Gene Name : G6PD
UniProt ID : P11413
Allele Name : Palesdivina
Genotype(s) : Not Available
Type(s) : ADR Inferred
Groups : G6PD deficiency
Description : Increased risk of dose-related hemolysis.
References :
- Bacdivim™[package insert]. Philadelphia, Pennysylvania: Mutual Pharmaceutical Company; 2013. [Link]
PMID: 1847758
Sulfamethoxazole
Product: VER-49009
Identifier : DBSNPE003601
Drug : DB01015 (Sulfamethoxazole)
Interacting Gene/Enzyme : Glucose-6-phosphate 1-dehydrogenase
Gene Name : G6PD
UniProt ID : P11413
Allele Name : Metaponto
Genotype(s) : Not Available
Type(s) : ADR Inferred
Groups : G6PD deficiency
Description : Increased risk of dose-related hemolysis.
References :
- Bacdivim™[package insert]. Philadelphia, Pennysylvania: Mutual Pharmaceutical Company; 2013. [Link]
PMID: 15967159
Sulfamethoxazole
Product: VER-50589
Identifier : DBSNPE003602
Drug : DB01015 (Sulfamethoxazole)
Interacting Gene/Enzyme : Glucose-6-phosphate 1-dehydrogenase
Gene Name : G6PD
UniProt ID : P11413
Allele Name : Musashino
Genotype(s) : Not Available
Type(s) : ADR Inferred
Groups : G6PD deficiency
Description : Increased risk of dose-related hemolysis.
References :
- Bacdivim™[package insert]. Philadelphia, Pennysylvania: Mutual Pharmaceutical Company; 2013. [Link]
PMID: 9543090
Sulfamethoxazole
Product: Alcaftadine
Identifier : DBSNPE003603
Drug : DB01015 (Sulfamethoxazole)
Interacting Gene/Enzyme : Glucose-6-phosphate 1-dehydrogenase
Gene Name : G6PD
UniProt ID : P11413
Allele Name : Asahi
Genotype(s) : Not Available
Type(s) : ADR Inferred
Groups : G6PD deficiency
Description : Increased risk of dose-related hemolysis.
References :
- Bacdivim™[package insert]. Philadelphia, Pennysylvania: Mutual Pharmaceutical Company; 2013. [Link]
PMID: 9105693
Sulfamethoxazole
Product: Cefepime (Dihydrochloride Monohydrate)
Identifier : DBSNPE003604
Drug : DB01015 (Sulfamethoxazole)
Interacting Gene/Enzyme : Glucose-6-phosphate 1-dehydrogenase
Gene Name : G6PD
UniProt ID : P11413
Allele Name : A- (202), Ferrara I
Genotype(s) : Not Available
Type(s) : ADR Inferred
Groups : G6PD deficiency
Description : Increased risk of dose-related hemolysis.
References :
- Bacdivim™[package insert]. Philadelphia, Pennysylvania: Mutual Pharmaceutical Company; 2013. [Link]
PMID: 15289293
Sulfamethoxazole
Product: Amrubicin (hydrochloride)
Identifier : DBSNPE003606
Drug : DB01015 (Sulfamethoxazole)
Interacting Gene/Enzyme : Glucose-6-phosphate 1-dehydrogenase
Gene Name : G6PD
UniProt ID : P11413
Allele Name : Ube Konan
Genotype(s) : Not Available
Type(s) : ADR Inferred
Groups : G6PD deficiency
Description : Increased risk of dose-related hemolysis.
References :
- Bacdivim™[package insert]. Philadelphia, Pennysylvania: Mutual Pharmaceutical Company; 2013. [Link]
PMID: 12569099
Sulfamethoxazole
Product: Amrubicin
Identifier : DBSNPE003607
Drug : DB01015 (Sulfamethoxazole)
Interacting Gene/Enzyme : Glucose-6-phosphate 1-dehydrogenase
Gene Name : G6PD
UniProt ID : P11413
Allele Name : Lagosanto
Genotype(s) : Not Available
Type(s) : ADR Inferred
Groups : G6PD deficiency
Description : Increased risk of dose-related hemolysis.
References :
- Bacdivim™[package insert]. Philadelphia, Pennysylvania: Mutual Pharmaceutical Company; 2013. [Link]
PMID: 28591579
Sulfamethoxazole
Product: Clevudine
Identifier : DBSNPE003608
Drug : DB01015 (Sulfamethoxazole)
Interacting Gene/Enzyme : Glucose-6-phosphate 1-dehydrogenase
Gene Name : G6PD
UniProt ID : P11413
Allele Name : Guangzhou
Genotype(s) : Not Available
Type(s) : ADR Inferred
Groups : G6PD deficiency
Description : Increased risk of dose-related hemolysis.
References :
- Bacdivim™[package insert]. Philadelphia, Pennysylvania: Mutual Pharmaceutical Company; 2013. [Link]
PMID: 2016727
Sulfamethoxazole
Product: Amiodarone
Identifier : DBSNPE003609
Drug : DB01015 (Sulfamethoxazole)
Interacting Gene/Enzyme : Glucose-6-phosphate 1-dehydrogenase
Gene Name : G6PD
UniProt ID : P11413
Allele Name : Hammersmith
Genotype(s) : Not Available
Type(s) : ADR Inferred
Groups : G6PD deficiency
Description : Increased risk of dose-related hemolysis.
References :
- Bacdivim™[package insert]. Philadelphia, Pennysylvania: Mutual Pharmaceutical Company; 2013. [Link]
PMID: 14570767
Sulfamethoxazole
Product: Fasudil
Identifier : DBSNPE003610
Drug : DB01015 (Sulfamethoxazole)
Interacting Gene/Enzyme : Glucose-6-phosphate 1-dehydrogenase
Gene Name : G6PD
UniProt ID : P11413
Allele Name : Sinnai
Genotype(s) : Not Available
Type(s) : ADR Inferred
Groups : G6PD deficiency
Description : Increased risk of dose-related hemolysis.
References :
- Bacdivim™[package insert]. Philadelphia, Pennysylvania: Mutual Pharmaceutical Company; 2013. [Link]
PMID: 8081074
Sulfamethoxazole
Product: Bilastine
Identifier : DBSNPE003611
Drug : DB01015 (Sulfamethoxazole)
Interacting Gene/Enzyme : Glucose-6-phosphate 1-dehydrogenase
Gene Name : G6PD
UniProt ID : P11413
Allele Name : A- (680)
Genotype(s) : Not Available
Type(s) : ADR Inferred
Groups : G6PD deficiency
Description : Increased risk of dose-related hemolysis.
References :
- Bacdivim™[package insert]. Philadelphia, Pennysylvania: Mutual Pharmaceutical Company; 2013. [Link]
PMID: 1334748
Sulfamethoxazole
Product: Tirofiban
Identifier : DBSNPE003612
Drug : DB01015 (Sulfamethoxazole)
Interacting Gene/Enzyme : Glucose-6-phosphate 1-dehydrogenase
Gene Name : G6PD
UniProt ID : P11413
Allele Name : A- (968), Betica,Selma, Guantanamo
Genotype(s) : Not Available
Type(s) : ADR Inferred
Groups : G6PD deficiency
Description : Increased risk of dose-related hemolysis.
References :
- Bacdivim™[package insert]. Philadelphia, Pennysylvania: Mutual Pharmaceutical Company; 2013. [Link]
PMID: 24335295
Sulfamethoxazole
Product: Chlorhexidine (digluconate)
Identifier : DBSNPE003613
Drug : DB01015 (Sulfamethoxazole)
Interacting Gene/Enzyme : Glucose-6-phosphate 1-dehydrogenase
Gene Name : G6PD
UniProt ID : P11413
Allele Name : Salerno Pyrgos
Genotype(s) : Not Available
Type(s) : ADR Inferred
Groups : G6PD deficiency
Description : Increased risk of dose-related hemolysis.
References :
- Bacdivim™[package insert]. Philadelphia, Pennysylvania: Mutual Pharmaceutical Company; 2013. [Link]
PMID: 22688342
Sulfamethoxazole
Product: Nitisinone
Identifier : DBSNPE003614
Drug : DB01015 (Sulfamethoxazole)
Interacting Gene/Enzyme : Glucose-6-phosphate 1-dehydrogenase
Gene Name : G6PD
UniProt ID : P11413
Allele Name : Quing Yan
Genotype(s) : Not Available
Type(s) : ADR Inferred
Groups : G6PD deficiency
Description : Increased risk of dose-related hemolysis.
References :
- Bacdivim™[package insert]. Philadelphia, Pennysylvania: Mutual Pharmaceutical Company; 2013. [Link]
PMID: 21169551
Sulfamethoxazole
Product: Epirubicin
Identifier : DBSNPE003615
Drug : DB01015 (Sulfamethoxazole)
Interacting Gene/Enzyme : Glucose-6-phosphate 1-dehydrogenase
Gene Name : G6PD
UniProt ID : P11413
Allele Name : Lages
Genotype(s) : Not Available
Type(s) : ADR Inferred
Groups : G6PD deficiency
Description : Increased risk of dose-related hemolysis.
References :
- Bacdivim™[package insert]. Philadelphia, Pennysylvania: Mutual Pharmaceutical Company; 2013. [Link]
PMID: 16574785
Sulfamethoxazole
Product: 4-Aminopyridine
Identifier : DBSNPE003616
Drug : DB01015 (Sulfamethoxazole)
Interacting Gene/Enzyme : Glucose-6-phosphate 1-dehydrogenase
Gene Name : G6PD
UniProt ID : P11413
Allele Name : Ilesha
Genotype(s) : Not Available
Type(s) : ADR Inferred
Groups : G6PD deficiency
Description : Increased risk of dose-related hemolysis.
References :
- Bacdivim™[package insert]. Philadelphia, Pennysylvania: Mutual Pharmaceutical Company; 2013. [Link]
PMID: 16006512
Sulfamethoxazole
Product: Tafamidis
Identifier : DBSNPE003617
Drug : DB01015 (Sulfamethoxazole)
Interacting Gene/Enzyme : Glucose-6-phosphate 1-dehydrogenase
Gene Name : G6PD
UniProt ID : P11413
Allele Name : Mahidol
Genotype(s) : Not Available
Type(s) : ADR Inferred
Groups : G6PD deficiency
Description : Increased risk of dose-related hemolysis.
References :
- Bacdivim™[package insert]. Philadelphia, Pennysylvania: Mutual Pharmaceutical Company; 2013. [Link]
PMID: 9653548
Sulfamethoxazole
Product: (R)-Lansoprazole
Identifier : DBSNPE003618
Drug : DB01015 (Sulfamethoxazole)
Interacting Gene/Enzyme : Glucose-6-phosphate 1-dehydrogenase
Gene Name : G6PD
UniProt ID : P11413
Allele Name : Malaga
Genotype(s) : Not Available
Type(s) : ADR Inferred
Groups : G6PD deficiency
Description : Increased risk of dose-related hemolysis.
References :
- Bacdivim™[package insert]. Philadelphia, Pennysylvania: Mutual Pharmaceutical Company; 2013. [Link]
PMID: 18055761
Sulfamethoxazole
Product: Acetaminophen
Identifier : DBSNPE003619
Drug : DB01015 (Sulfamethoxazole)
Interacting Gene/Enzyme : Glucose-6-phosphate 1-dehydrogenase
Gene Name : G6PD
UniProt ID : P11413
Allele Name : Sibari
Genotype(s) : Not Available
Type(s) : ADR Inferred
Groups : G6PD deficiency
Description : Increased risk of dose-related hemolysis.
References :
- Bacdivim™[package insert]. Philadelphia, Pennysylvania: Mutual Pharmaceutical Company; 2013. [Link]
PMID: 23166964
Sulfamethoxazole
Product: Desvenlafaxine
Identifier : DBSNPE003621
Drug : DB01015 (Sulfamethoxazole)
Interacting Gene/Enzyme : Glucose-6-phosphate 1-dehydrogenase
Gene Name : G6PD
UniProt ID : P11413
Allele Name : Nanning
Genotype(s) : Not Available
Type(s) : ADR Inferred
Groups : G6PD deficiency
Description : Increased risk of dose-related hemolysis.
References :
- Bacdivim™[package insert]. Philadelphia, Pennysylvania: Mutual Pharmaceutical Company; 2013. [Link]
PMID: 18334597
Sulfamethoxazole
Product: Tafluprost
Identifier : DBSNPE003622
Drug : DB01015 (Sulfamethoxazole)
Interacting Gene/Enzyme : Glucose-6-phosphate 1-dehydrogenase
Gene Name : G6PD
UniProt ID : P11413
Allele Name : Seattle, Lodi, Modena, Ferrara II, Athens-like
Genotype(s) : Not Available
Type(s) : ADR Inferred
Groups : G6PD deficiency
Description : Increased risk of dose-related hemolysis.
References :
- Bacdivim™[package insert]. Philadelphia, Pennysylvania: Mutual Pharmaceutical Company; 2013. [Link]
PMID: 18374567
Sulfamethoxazole
Product: Camostat (mesylate)
Identifier : DBSNPE003623
Drug : DB01015 (Sulfamethoxazole)
Interacting Gene/Enzyme : Glucose-6-phosphate 1-dehydrogenase
Gene Name : G6PD
UniProt ID : P11413
Allele Name : Bajo Maumere
Genotype(s) : Not Available
Type(s) : ADR Inferred
Groups : G6PD deficiency
Description : Increased risk of dose-related hemolysis.
References :
- Bacdivim™[package insert]. Philadelphia, Pennysylvania: Mutual Pharmaceutical Company; 2013. [Link]
PMID: 15602004
Sulfamethoxazole
Product: Salmeterol
Identifier : DBSNPE003624
Drug : DB01015 (Sulfamethoxazole)
Interacting Gene/Enzyme : Glucose-6-phosphate 1-dehydrogenase
Gene Name : G6PD
UniProt ID : P11413
Allele Name : Montalbano
Genotype(s) : Not Available
Type(s) : ADR Inferred
Groups : G6PD deficiency
Description : Increased risk of dose-related hemolysis.
References :
- Bacdivim™[package insert]. Philadelphia, Pennysylvania: Mutual Pharmaceutical Company; 2013. [Link]
PMID: 16250653
Sulfamethoxazole
Product: Taltirelin
Identifier : DBSNPE003625
Drug : DB01015 (Sulfamethoxazole)
Interacting Gene/Enzyme : Glucose-6-phosphate 1-dehydrogenase
Gene Name : G6PD
UniProt ID : P11413
Allele Name : Kalyan-Kerala, Jamnaga, Rohini
Genotype(s) : Not Available
Type(s) : ADR Inferred
Groups : G6PD deficiency
Description : Increased risk of dose-related hemolysis.
References :
- Bacdivim™[package insert]. Philadelphia, Pennysylvania: Mutual Pharmaceutical Company; 2013. [Link]
PMID: 18202020
Sulfamethoxazole
Product: Ramosetron (Hydrochloride)
Identifier : DBSNPE003626
Drug : DB01015 (Sulfamethoxazole)
Interacting Gene/Enzyme : Glucose-6-phosphate 1-dehydrogenase
Gene Name : G6PD
UniProt ID : P11413
Allele Name : Gaohe
Genotype(s) : Not Available
Type(s) : ADR Inferred
Groups : G6PD deficiency
Description : Increased risk of dose-related hemolysis.
References :
- Bacdivim™[package insert]. Philadelphia, Pennysylvania: Mutual Pharmaceutical Company; 2013. [Link]
PMID: 17671214