Sulfamethoxazole

Sulfamethoxazole

Product: Pilocarpine (Hydrochloride)

Identifier : DBSNPE003457
Drug : DB01015 (Sulfamethoxazole)
Interacting Gene/Enzyme : Glucose-6-phosphate 1-dehydrogenase
Gene Name : G6PD
UniProt ID : P11413
Defining Change(s) :

  • 1006A->G

Allele Name : Torun
Genotype(s) : Not Available
Type(s) : ADR Inferred
Groups : G6PD deficiency
Description : Increased risk of dose-related hemolysis.
References :

  1. Bacdivim™[package insert]. Philadelphia, Pennysylvania: Mutual Pharmaceutical Company; 2013. [Link]

PMID: 26491845

Sulfamethoxazole

Sulfamethoxazole

Product: Doxepin (Hydrochloride)

Identifier : DBSNPE003458
Drug : DB01015 (Sulfamethoxazole)
Interacting Gene/Enzyme : Glucose-6-phosphate 1-dehydrogenase
Gene Name : G6PD
UniProt ID : P11413
Defining Change(s) :

  • 105_107delCAT

Allele Name : Sunderland
Genotype(s) : Not Available
Type(s) : ADR Inferred
Groups : G6PD deficiency
Description : Increased risk of dose-related hemolysis.
References :

  1. Bacdivim™[package insert]. Philadelphia, Pennysylvania: Mutual Pharmaceutical Company; 2013. [Link]

PMID: 11790767

Sulfamethoxazole

Sulfamethoxazole

Product: Ingenol Mebutate

Identifier : DBSNPE003459
Drug : DB01015 (Sulfamethoxazole)
Interacting Gene/Enzyme : Glucose-6-phosphate 1-dehydrogenase
Gene Name : G6PD
UniProt ID : P11413
Defining Change(s) :

  • 1081G->A

Allele Name : Iwatsuki
Genotype(s) : Not Available
Type(s) : ADR Inferred
Groups : G6PD deficiency
Description : Increased risk of dose-related hemolysis.
References :

  1. Bacdivim™[package insert]. Philadelphia, Pennysylvania: Mutual Pharmaceutical Company; 2013. [Link]

PMID: 25625039

Sulfamethoxazole

Sulfamethoxazole

Product: Sertaconazole (nitrate)

Identifier : DBSNPE003460
Drug : DB01015 (Sulfamethoxazole)
Interacting Gene/Enzyme : Glucose-6-phosphate 1-dehydrogenase
Gene Name : G6PD
UniProt ID : P11413
Defining Change(s) :

  • 1082C->T

Allele Name : Serres
Genotype(s) : Not Available
Type(s) : ADR Inferred
Groups : G6PD deficiency
Description : Increased risk of dose-related hemolysis.
References :

  1. Bacdivim™[package insert]. Philadelphia, Pennysylvania: Mutual Pharmaceutical Company; 2013. [Link]

PMID: 19261605

Sulfamethoxazole

Sulfamethoxazole

Product: Methylene Blue

Identifier : DBSNPE003461
Drug : DB01015 (Sulfamethoxazole)
Interacting Gene/Enzyme : Glucose-6-phosphate 1-dehydrogenase
Gene Name : G6PD
UniProt ID : P11413
Defining Change(s) :

  • 1084_1101delCTGAACGAGCGCAAGGCC

Allele Name : Tondela
Genotype(s) : Not Available
Type(s) : ADR Inferred
Groups : G6PD deficiency
Description : Increased risk of dose-related hemolysis.
References :

  1. Bacdivim™[package insert]. Philadelphia, Pennysylvania: Mutual Pharmaceutical Company; 2013. [Link]

PMID: 19271755

Sulfamethoxazole

Sulfamethoxazole

Product: Carteolol (hydrochloride)

Identifier : DBSNPE003462
Drug : DB01015 (Sulfamethoxazole)
Interacting Gene/Enzyme : Glucose-6-phosphate 1-dehydrogenase
Gene Name : G6PD
UniProt ID : P11413
Defining Change(s) :

  • 1089C->A

Allele Name : Loma Linda
Genotype(s) : Not Available
Type(s) : ADR Inferred
Groups : G6PD deficiency
Description : Increased risk of dose-related hemolysis.
References :

  1. Bacdivim™[package insert]. Philadelphia, Pennysylvania: Mutual Pharmaceutical Company; 2013. [Link]

PMID: 24487964

Sulfamethoxazole

Sulfamethoxazole

Product: Pentoxifylline

Identifier : DBSNPE003463
Drug : DB01015 (Sulfamethoxazole)
Interacting Gene/Enzyme : Glucose-6-phosphate 1-dehydrogenase
Gene Name : G6PD
UniProt ID : P11413
Defining Change(s) :

  • 1089C->G

Allele Name : Aachen
Genotype(s) : Not Available
Type(s) : ADR Inferred
Groups : G6PD deficiency
Description : Increased risk of dose-related hemolysis.
References :

  1. Bacdivim™[package insert]. Philadelphia, Pennysylvania: Mutual Pharmaceutical Company; 2013. [Link]

PMID: 17785464

Sulfamethoxazole

Sulfamethoxazole

Product: Amlexanox

Identifier : DBSNPE003464
Drug : DB01015 (Sulfamethoxazole)
Interacting Gene/Enzyme : Glucose-6-phosphate 1-dehydrogenase
Gene Name : G6PD
UniProt ID : P11413
Defining Change(s) :

  • 1096A->G

Allele Name : Tenri
Genotype(s) : Not Available
Type(s) : ADR Inferred
Groups : G6PD deficiency
Description : Increased risk of dose-related hemolysis.
References :

  1. Bacdivim™[package insert]. Philadelphia, Pennysylvania: Mutual Pharmaceutical Company; 2013. [Link]

PMID: 16759099

Sulfamethoxazole

Sulfamethoxazole

Product: Ceftriaxone

Identifier : DBSNPE003465
Drug : DB01015 (Sulfamethoxazole)
Interacting Gene/Enzyme : Glucose-6-phosphate 1-dehydrogenase
Gene Name : G6PD
UniProt ID : P11413
Defining Change(s) :

  • 1132G>A

Allele Name : Montpellier
Genotype(s) : Not Available
Type(s) : ADR Inferred
Groups : G6PD deficiency
Description : Increased risk of dose-related hemolysis.
References :

  1. Bacdivim™[package insert]. Philadelphia, Pennysylvania: Mutual Pharmaceutical Company; 2013. [Link]

PMID: 25086309

Sulfamethoxazole

Sulfamethoxazole

Product: Betaine

Identifier : DBSNPE003466
Drug : DB01015 (Sulfamethoxazole)
Interacting Gene/Enzyme : Glucose-6-phosphate 1-dehydrogenase
Gene Name : G6PD
UniProt ID : P11413
Defining Change(s) :

  • 1138A->G

Allele Name : Calvo Mackenna
Genotype(s) : Not Available
Type(s) : ADR Inferred
Groups : G6PD deficiency
Description : Increased risk of dose-related hemolysis.
References :

  1. Bacdivim™[package insert]. Philadelphia, Pennysylvania: Mutual Pharmaceutical Company; 2013. [Link]

PMID: 22727639

Sulfamethoxazole

Sulfamethoxazole

Product: β-Estradiol 17-acetate

Identifier : DBSNPE003467
Drug : DB01015 (Sulfamethoxazole)
Interacting Gene/Enzyme : Glucose-6-phosphate 1-dehydrogenase
Gene Name : G6PD
UniProt ID : P11413
Defining Change(s) :

  • 1139T->C

Allele Name : Riley
Genotype(s) : Not Available
Type(s) : ADR Inferred
Groups : G6PD deficiency
Description : Increased risk of dose-related hemolysis.
References :

  1. Bacdivim™[package insert]. Philadelphia, Pennysylvania: Mutual Pharmaceutical Company; 2013. [Link]

PMID: 19279215

Sulfamethoxazole

Sulfamethoxazole

Product: Sertindole

Identifier : DBSNPE003469
Drug : DB01015 (Sulfamethoxazole)
Interacting Gene/Enzyme : Glucose-6-phosphate 1-dehydrogenase
Gene Name : G6PD
UniProt ID : P11413
Defining Change(s) :

  • 1153T->C

Allele Name : Tomah
Genotype(s) : Not Available
Type(s) : ADR Inferred
Groups : G6PD deficiency
Description : Increased risk of dose-related hemolysis.
References :

  1. Bacdivim™[package insert]. Philadelphia, Pennysylvania: Mutual Pharmaceutical Company; 2013. [Link]

PMID: 24097188

Sulfamethoxazole

Sulfamethoxazole

Product: Atenolol

Identifier : DBSNPE003470
Drug : DB01015 (Sulfamethoxazole)
Interacting Gene/Enzyme : Glucose-6-phosphate 1-dehydrogenase
Gene Name : G6PD
UniProt ID : P11413
Defining Change(s) :

  • 1154G->T

Allele Name : Lynwood
Genotype(s) : Not Available
Type(s) : ADR Inferred
Groups : G6PD deficiency
Description : Increased risk of dose-related hemolysis.
References :

  1. Bacdivim™[package insert]. Philadelphia, Pennysylvania: Mutual Pharmaceutical Company; 2013. [Link]

PMID: 27853135

Sulfamethoxazole

Sulfamethoxazole

Product: Atractyloside A

Identifier : DBSNPE003471
Drug : DB01015 (Sulfamethoxazole)
Interacting Gene/Enzyme : Glucose-6-phosphate 1-dehydrogenase
Gene Name : G6PD
UniProt ID : P11413
Defining Change(s) :

  • 1155C->G

Allele Name : Madrid
Genotype(s) : Not Available
Type(s) : ADR Inferred
Groups : G6PD deficiency
Description : Increased risk of dose-related hemolysis.
References :

  1. Bacdivim™[package insert]. Philadelphia, Pennysylvania: Mutual Pharmaceutical Company; 2013. [Link]

PMID: 16432512

Sulfamethoxazole

Sulfamethoxazole

Product: Sivelestat (sodium)

Identifier : DBSNPE003472
Drug : DB01015 (Sulfamethoxazole)
Interacting Gene/Enzyme : Glucose-6-phosphate 1-dehydrogenase
Gene Name : G6PD
UniProt ID : P11413
Defining Change(s) :

  • 1156A->G

Allele Name : Iowa, Walter Reed, Springfield
Genotype(s) : Not Available
Type(s) : ADR Inferred
Groups : G6PD deficiency
Description : Increased risk of dose-related hemolysis.
References :

  1. Bacdivim™[package insert]. Philadelphia, Pennysylvania: Mutual Pharmaceutical Company; 2013. [Link]

PMID: 15608074

Sulfamethoxazole

Sulfamethoxazole

Product: Sivelestat

Identifier : DBSNPE003473
Drug : DB01015 (Sulfamethoxazole)
Interacting Gene/Enzyme : Glucose-6-phosphate 1-dehydrogenase
Gene Name : G6PD
UniProt ID : P11413
Defining Change(s) :

  • 1160G->A

Allele Name : Beverly Hills, Genova, Iwate, Niigata, Yamaguchi
Genotype(s) : Not Available
Type(s) : ADR Inferred
Groups : G6PD deficiency
Description : Increased risk of dose-related hemolysis.
References :

  1. Bacdivim™[package insert]. Philadelphia, Pennysylvania: Mutual Pharmaceutical Company; 2013. [Link]

PMID: 25017033

Sulfamethoxazole

Sulfamethoxazole

Product: Temoporfin

Identifier : DBSNPE003474
Drug : DB01015 (Sulfamethoxazole)
Interacting Gene/Enzyme : Glucose-6-phosphate 1-dehydrogenase
Gene Name : G6PD
UniProt ID : P11413
Defining Change(s) :

  • 1162A->G

Allele Name : Hartford
Genotype(s) : Not Available
Type(s) : ADR Inferred
Groups : G6PD deficiency
Description : Increased risk of dose-related hemolysis.
References :

  1. Bacdivim™[package insert]. Philadelphia, Pennysylvania: Mutual Pharmaceutical Company; 2013. [Link]

PMID: 24479195

Sulfamethoxazole

Sulfamethoxazole

Product: Candesartan (Cilexetil)

Identifier : DBSNPE003475
Drug : DB01015 (Sulfamethoxazole)
Interacting Gene/Enzyme : Glucose-6-phosphate 1-dehydrogenase
Gene Name : G6PD
UniProt ID : P11413
Defining Change(s) :

  • 1166A->G

Allele Name : Praha
Genotype(s) : Not Available
Type(s) : ADR Inferred
Groups : G6PD deficiency
Description : Increased risk of dose-related hemolysis.
References :

  1. Bacdivim™[package insert]. Philadelphia, Pennysylvania: Mutual Pharmaceutical Company; 2013. [Link]

PMID: 23460565

Sulfamethoxazole

Sulfamethoxazole

Product: (R)-1,2,3,4-Tetrahydro-3-isoquinolinecarboxylic acid

Identifier : DBSNPE003476
Drug : DB01015 (Sulfamethoxazole)
Interacting Gene/Enzyme : Glucose-6-phosphate 1-dehydrogenase
Gene Name : G6PD
UniProt ID : P11413
Defining Change(s) :

  • 1175T>C

Allele Name : Krakow
Genotype(s) : Not Available
Type(s) : ADR Inferred
Groups : G6PD deficiency
Description : Increased risk of dose-related hemolysis.
References :

  1. Bacdivim™[package insert]. Philadelphia, Pennysylvania: Mutual Pharmaceutical Company; 2013. [Link]

PMID: 21916012

Sulfamethoxazole

Sulfamethoxazole

Product: SM-164

Identifier : DBSNPE003477
Drug : DB01015 (Sulfamethoxazole)
Interacting Gene/Enzyme : Glucose-6-phosphate 1-dehydrogenase
Gene Name : G6PD
UniProt ID : P11413
Defining Change(s) :

  • 1177C->G

Allele Name : Wisconsin
Genotype(s) : Not Available
Type(s) : ADR Inferred
Groups : G6PD deficiency
Description : Increased risk of dose-related hemolysis.
References :

  1. Bacdivim™[package insert]. Philadelphia, Pennysylvania: Mutual Pharmaceutical Company; 2013. [Link]

PMID: 25263033

Sulfamethoxazole

Sulfamethoxazole

Product: Baclofen

Identifier : DBSNPE003479
Drug : DB01015 (Sulfamethoxazole)
Interacting Gene/Enzyme : Glucose-6-phosphate 1-dehydrogenase
Gene Name : G6PD
UniProt ID : P11413
Defining Change(s) :

  • 1180G->C

Allele Name : Alhambra
Genotype(s) : Not Available
Type(s) : ADR Inferred
Groups : G6PD deficiency
Description : Increased risk of dose-related hemolysis.
References :

  1. Bacdivim™[package insert]. Philadelphia, Pennysylvania: Mutual Pharmaceutical Company; 2013. [Link]

PMID: 20405001

Sulfamethoxazole

Sulfamethoxazole

Product: Pirarubicin

Identifier : DBSNPE003480
Drug : DB01015 (Sulfamethoxazole)
Interacting Gene/Enzyme : Glucose-6-phosphate 1-dehydrogenase
Gene Name : G6PD
UniProt ID : P11413
Defining Change(s) :

  • 1187C->T

Allele Name : Bari
Genotype(s) : Not Available
Type(s) : ADR Inferred
Groups : G6PD deficiency
Description : Increased risk of dose-related hemolysis.
References :

  1. Bacdivim™[package insert]. Philadelphia, Pennysylvania: Mutual Pharmaceutical Company; 2013. [Link]

PMID: 1846921

Sulfamethoxazole

Sulfamethoxazole

Product: Eflornithine (hydrochloride)

Identifier : DBSNPE003481
Drug : DB01015 (Sulfamethoxazole)
Interacting Gene/Enzyme : Glucose-6-phosphate 1-dehydrogenase
Gene Name : G6PD
UniProt ID : P11413
Defining Change(s) :

  • 1192G->A

Allele Name : Puerto Limon
Genotype(s) : Not Available
Type(s) : ADR Inferred
Groups : G6PD deficiency
Description : Increased risk of dose-related hemolysis.
References :

  1. Bacdivim™[package insert]. Philadelphia, Pennysylvania: Mutual Pharmaceutical Company; 2013. [Link]

PMID: 18440066

Sulfamethoxazole

Sulfamethoxazole

Product: Eflornithine

Identifier : DBSNPE003482
Drug : DB01015 (Sulfamethoxazole)
Interacting Gene/Enzyme : Glucose-6-phosphate 1-dehydrogenase
Gene Name : G6PD
UniProt ID : P11413
Defining Change(s) :

  • 1205C>A

Allele Name : Covao do Lobo
Genotype(s) : Not Available
Type(s) : ADR Inferred
Groups : G6PD deficiency
Description : Increased risk of dose-related hemolysis.
References :

  1. Bacdivim™[package insert]. Philadelphia, Pennysylvania: Mutual Pharmaceutical Company; 2013. [Link]

PMID: 8981566

Sulfamethoxazole

Sulfamethoxazole

Product: Dithranol

Identifier : DBSNPE003483
Drug : DB01015 (Sulfamethoxazole)
Interacting Gene/Enzyme : Glucose-6-phosphate 1-dehydrogenase
Gene Name : G6PD
UniProt ID : P11413
Defining Change(s) :

  • 1215G->A

Allele Name : Clinic
Genotype(s) : Not Available
Type(s) : ADR Inferred
Groups : G6PD deficiency
Description : Increased risk of dose-related hemolysis.
References :

  1. Bacdivim™[package insert]. Philadelphia, Pennysylvania: Mutual Pharmaceutical Company; 2013. [Link]

PMID: 10224306

Sulfamethoxazole

Sulfamethoxazole

Product: Fenoldopam

Identifier : DBSNPE003484
Drug : DB01015 (Sulfamethoxazole)
Interacting Gene/Enzyme : Glucose-6-phosphate 1-dehydrogenase
Gene Name : G6PD
UniProt ID : P11413
Defining Change(s) :

  • 1225C->T

Allele Name : Udivecht
Genotype(s) : Not Available
Type(s) : ADR Inferred
Groups : G6PD deficiency
Description : Increased risk of dose-related hemolysis.
References :

  1. Bacdivim™[package insert]. Philadelphia, Pennysylvania: Mutual Pharmaceutical Company; 2013. [Link]

PMID: 11504802

Sulfamethoxazole

Sulfamethoxazole

Product: Fotemustine

Identifier : DBSNPE003485
Drug : DB01015 (Sulfamethoxazole)
Interacting Gene/Enzyme : Glucose-6-phosphate 1-dehydrogenase
Gene Name : G6PD
UniProt ID : P11413
Defining Change(s) :

  • 1226C->G

Allele Name : Suwalki
Genotype(s) : Not Available
Type(s) : ADR Inferred
Groups : G6PD deficiency
Description : Increased risk of dose-related hemolysis.
References :

  1. Bacdivim™[package insert]. Philadelphia, Pennysylvania: Mutual Pharmaceutical Company; 2013. [Link]

PMID: 8393489

Sulfamethoxazole

Sulfamethoxazole

Product: NVP-TNKS656

Identifier : DBSNPE003486
Drug : DB01015 (Sulfamethoxazole)
Interacting Gene/Enzyme : Glucose-6-phosphate 1-dehydrogenase
Gene Name : G6PD
UniProt ID : P11413
Defining Change(s) :

  • 1228G->T

Allele Name : Riverside
Genotype(s) : Not Available
Type(s) : ADR Inferred
Groups : G6PD deficiency
Description : Increased risk of dose-related hemolysis.
References :

  1. Bacdivim™[package insert]. Philadelphia, Pennysylvania: Mutual Pharmaceutical Company; 2013. [Link]

PMID: 1657267

Sulfamethoxazole

Sulfamethoxazole

Product: Seratrodast

Identifier : DBSNPE003487
Drug : DB01015 (Sulfamethoxazole)
Interacting Gene/Enzyme : Glucose-6-phosphate 1-dehydrogenase
Gene Name : G6PD
UniProt ID : P11413
Defining Change(s) :

  • 1229G->A

Allele Name : Japan, Shinagawa
Genotype(s) : Not Available
Type(s) : ADR Inferred
Groups : G6PD deficiency
Description : Increased risk of dose-related hemolysis.
References :

  1. Bacdivim™[package insert]. Philadelphia, Pennysylvania: Mutual Pharmaceutical Company; 2013. [Link]

PMID: 1659636

Sulfamethoxazole

Sulfamethoxazole

Product: Cefozopran

Identifier : DBSNPE003488
Drug : DB01015 (Sulfamethoxazole)
Interacting Gene/Enzyme : Glucose-6-phosphate 1-dehydrogenase
Gene Name : G6PD
UniProt ID : P11413
Defining Change(s) :

  • 1229G->C

Allele Name : Kawasaki
Genotype(s) : Not Available
Type(s) : ADR Inferred
Groups : G6PD deficiency
Description : Increased risk of dose-related hemolysis.
References :

  1. Bacdivim™[package insert]. Philadelphia, Pennysylvania: Mutual Pharmaceutical Company; 2013. [Link]

PMID: 1846918

Sulfamethoxazole

Sulfamethoxazole

Product: Bicyclol

Identifier : DBSNPE003489
Drug : DB01015 (Sulfamethoxazole)
Interacting Gene/Enzyme : Glucose-6-phosphate 1-dehydrogenase
Gene Name : G6PD
UniProt ID : P11413
Defining Change(s) :

  • 1231A->G

Allele Name : Munich
Genotype(s) : Not Available
Type(s) : ADR Inferred
Groups : G6PD deficiency
Description : Increased risk of dose-related hemolysis.
References :

  1. Bacdivim™[package insert]. Philadelphia, Pennysylvania: Mutual Pharmaceutical Company; 2013. [Link]

PMID: 7493620

Sulfamethoxazole

Sulfamethoxazole

Product: Bucladesine (sodium salt)

Identifier : DBSNPE003490
Drug : DB01015 (Sulfamethoxazole)
Interacting Gene/Enzyme : Glucose-6-phosphate 1-dehydrogenase
Gene Name : G6PD
UniProt ID : P11413
Defining Change(s) :

  • 1284C->A

Allele Name : Georgia
Genotype(s) : Not Available
Type(s) : ADR Inferred
Groups : G6PD deficiency
Description : Increased risk of dose-related hemolysis.
References :

  1. Bacdivim™[package insert]. Philadelphia, Pennysylvania: Mutual Pharmaceutical Company; 2013. [Link]

PMID: 2568146

Sulfamethoxazole

Sulfamethoxazole

Product: Ibudilast

Identifier : DBSNPE003491
Drug : DB01015 (Sulfamethoxazole)
Interacting Gene/Enzyme : Glucose-6-phosphate 1-dehydrogenase
Gene Name : G6PD
UniProt ID : P11413
Defining Change(s) :

  • 1292T->G

Allele Name : Sumare
Genotype(s) : Not Available
Type(s) : ADR Inferred
Groups : G6PD deficiency
Description : Increased risk of dose-related hemolysis.
References :

  1. Bacdivim™[package insert]. Philadelphia, Pennysylvania: Mutual Pharmaceutical Company; 2013. [Link]

PMID: 8071934

Sulfamethoxazole

Sulfamethoxazole

Product: Fenofibric acid

Identifier : DBSNPE003492
Drug : DB01015 (Sulfamethoxazole)
Interacting Gene/Enzyme : Glucose-6-phosphate 1-dehydrogenase
Gene Name : G6PD
UniProt ID : P11413
Defining Change(s) :

  • 1318C->T

Allele Name : Telti/Kobe
Genotype(s) : Not Available
Type(s) : ADR Inferred
Groups : G6PD deficiency
Description : Increased risk of dose-related hemolysis.
References :

  1. Bacdivim™[package insert]. Philadelphia, Pennysylvania: Mutual Pharmaceutical Company; 2013. [Link]

PMID: 25559075

Sulfamethoxazole

Sulfamethoxazole

Product: Hematoporphyrin

Identifier : DBSNPE003493
Drug : DB01015 (Sulfamethoxazole)
Interacting Gene/Enzyme : Glucose-6-phosphate 1-dehydrogenase
Gene Name : G6PD
UniProt ID : P11413
Defining Change(s) :

  • 1339G->A

Allele Name : Santiago de Cuba, Morioka
Genotype(s) : Not Available
Type(s) : ADR Inferred
Groups : G6PD deficiency
Description : Increased risk of dose-related hemolysis.
References :

  1. Bacdivim™[package insert]. Philadelphia, Pennysylvania: Mutual Pharmaceutical Company; 2013. [Link]

PMID: 17060492

Sulfamethoxazole

Sulfamethoxazole

Product: Gliclazide

Identifier : DBSNPE003494
Drug : DB01015 (Sulfamethoxazole)
Interacting Gene/Enzyme : Glucose-6-phosphate 1-dehydrogenase
Gene Name : G6PD
UniProt ID : P11413
Defining Change(s) :

  • 1358T->A

Allele Name : Harima
Genotype(s) : Not Available
Type(s) : ADR Inferred
Groups : G6PD deficiency
Description : Increased risk of dose-related hemolysis.
References :

  1. Bacdivim™[package insert]. Philadelphia, Pennysylvania: Mutual Pharmaceutical Company; 2013. [Link]

PMID: 22537770

Sulfamethoxazole

Sulfamethoxazole

Product: Azithromycin (hydrate)

Identifier : DBSNPE003495
Drug : DB01015 (Sulfamethoxazole)
Interacting Gene/Enzyme : Glucose-6-phosphate 1-dehydrogenase
Gene Name : G6PD
UniProt ID : P11413
Defining Change(s) :

  • 1366G->C

Allele Name : Figuera da Foz
Genotype(s) : Not Available
Type(s) : ADR Inferred
Groups : G6PD deficiency
Description : Increased risk of dose-related hemolysis.
References :

  1. Bacdivim™[package insert]. Philadelphia, Pennysylvania: Mutual Pharmaceutical Company; 2013. [Link]

PMID: 9535991

Sulfamethoxazole

Sulfamethoxazole

Product: Fumagillin

Identifier : DBSNPE003496
Drug : DB01015 (Sulfamethoxazole)
Interacting Gene/Enzyme : Glucose-6-phosphate 1-dehydrogenase
Gene Name : G6PD
UniProt ID : P11413
Defining Change(s) :

  • 1367A>T

Allele Name : Amiens
Genotype(s) : Not Available
Type(s) : ADR Inferred
Groups : G6PD deficiency
Description : Increased risk of dose-related hemolysis.
References :

  1. Bacdivim™[package insert]. Philadelphia, Pennysylvania: Mutual Pharmaceutical Company; 2013. [Link]

PMID: 8388301

Sulfamethoxazole

Sulfamethoxazole

Product: Talaporfin (sodium)

Identifier : DBSNPE003497
Drug : DB01015 (Sulfamethoxazole)
Interacting Gene/Enzyme : Glucose-6-phosphate 1-dehydrogenase
Gene Name : G6PD
UniProt ID : P11413
Defining Change(s) :

  • 1376G->T, 1502T->G

Allele Name : Bangkok Noi
Genotype(s) : Not Available
Type(s) : ADR Inferred
Groups : G6PD deficiency
Description : Increased risk of dose-related hemolysis.
References :

  1. Bacdivim™[package insert]. Philadelphia, Pennysylvania: Mutual Pharmaceutical Company; 2013. [Link]

PMID: 8390939

Sulfamethoxazole

Sulfamethoxazole

Product: Luminol (sodium salt)

Identifier : DBSNPE003498
Drug : DB01015 (Sulfamethoxazole)
Interacting Gene/Enzyme : Glucose-6-phosphate 1-dehydrogenase
Gene Name : G6PD
UniProt ID : P11413
Defining Change(s) :

  • 1462G->A

Allele Name : Fukaya
Genotype(s) : Not Available
Type(s) : ADR Inferred
Groups : G6PD deficiency
Description : Increased risk of dose-related hemolysis.
References :

  1. Bacdivim™[package insert]. Philadelphia, Pennysylvania: Mutual Pharmaceutical Company; 2013. [Link]

PMID: 2822490

Sulfamethoxazole

Sulfamethoxazole

Product: Ramatroban

Identifier : DBSNPE003499
Drug : DB01015 (Sulfamethoxazole)
Interacting Gene/Enzyme : Glucose-6-phosphate 1-dehydrogenase
Gene Name : G6PD
UniProt ID : P11413
Defining Change(s) :

  • 1463G->T

Allele Name : Campinas
Genotype(s) : Not Available
Type(s) : ADR Inferred
Groups : G6PD deficiency
Description : Increased risk of dose-related hemolysis.
References :

  1. Bacdivim™[package insert]. Philadelphia, Pennysylvania: Mutual Pharmaceutical Company; 2013. [Link]

PMID: 9517380

Sulfamethoxazole

Sulfamethoxazole

Product: Hoechst 33342 (trihydrochloride)

Identifier : DBSNPE003500
Drug : DB01015 (Sulfamethoxazole)
Interacting Gene/Enzyme : Glucose-6-phosphate 1-dehydrogenase
Gene Name : G6PD
UniProt ID : P11413
Defining Change(s) :

  • 1465C>T

Allele Name : Buenos Aires
Genotype(s) : Not Available
Type(s) : ADR Inferred
Groups : G6PD deficiency
Description : Increased risk of dose-related hemolysis.
References :

  1. Bacdivim™[package insert]. Philadelphia, Pennysylvania: Mutual Pharmaceutical Company; 2013. [Link]

PMID: 8045272

Sulfamethoxazole

Sulfamethoxazole

Product: Exatecan (Mesylate)

Identifier : DBSNPE003501
Drug : DB01015 (Sulfamethoxazole)
Interacting Gene/Enzyme : Glucose-6-phosphate 1-dehydrogenase
Gene Name : G6PD
UniProt ID : P11413
Defining Change(s) :

  • 1466C->T

Allele Name : Arakawa
Genotype(s) : Not Available
Type(s) : ADR Inferred
Groups : G6PD deficiency
Description : Increased risk of dose-related hemolysis.
References :

  1. Bacdivim™[package insert]. Philadelphia, Pennysylvania: Mutual Pharmaceutical Company; 2013. [Link]

PMID: 7679733

Sulfamethoxazole

Sulfamethoxazole

Product: Exatecan

Identifier : DBSNPE003502
Drug : DB01015 (Sulfamethoxazole)
Interacting Gene/Enzyme : Glucose-6-phosphate 1-dehydrogenase
Gene Name : G6PD
UniProt ID : P11413
Defining Change(s) :

  • 1488_1490delGAA

Allele Name : Brighton
Genotype(s) : Not Available
Type(s) : ADR Inferred
Groups : G6PD deficiency
Description : Increased risk of dose-related hemolysis.
References :

  1. Bacdivim™[package insert]. Philadelphia, Pennysylvania: Mutual Pharmaceutical Company; 2013. [Link]

PMID: 1320979

Sulfamethoxazole

Sulfamethoxazole

Product: Prulifloxacin

Identifier : DBSNPE003503
Drug : DB01015 (Sulfamethoxazole)
Interacting Gene/Enzyme : Glucose-6-phosphate 1-dehydrogenase
Gene Name : G6PD
UniProt ID : P11413
Defining Change(s) :

  • 159G->C

Allele Name : Kozukata
Genotype(s) : Not Available
Type(s) : ADR Inferred
Groups : G6PD deficiency
Description : Increased risk of dose-related hemolysis.
References :

  1. Bacdivim™[package insert]. Philadelphia, Pennysylvania: Mutual Pharmaceutical Company; 2013. [Link]

PMID: 24187130

Sulfamethoxazole

Sulfamethoxazole

Product: Udenafil

Identifier : DBSNPE003504
Drug : DB01015 (Sulfamethoxazole)
Interacting Gene/Enzyme : Glucose-6-phosphate 1-dehydrogenase
Gene Name : G6PD
UniProt ID : P11413
Defining Change(s) :

  • 180_182delTCT

Allele Name : Amsterdam
Genotype(s) : Not Available
Type(s) : ADR Inferred
Groups : G6PD deficiency
Description : Increased risk of dose-related hemolysis.
References :

  1. Bacdivim™[package insert]. Philadelphia, Pennysylvania: Mutual Pharmaceutical Company; 2013. [Link]

PMID: 1348110

Sulfamethoxazole

Sulfamethoxazole

Product: Nicergoline

Identifier : DBSNPE003505
Drug : DB01015 (Sulfamethoxazole)
Interacting Gene/Enzyme : Glucose-6-phosphate 1-dehydrogenase
Gene Name : G6PD
UniProt ID : P11413
Defining Change(s) :

  • 202G->A, 376A->G, 1264C>G

Allele Name : No name
Genotype(s) : Not Available
Type(s) : ADR Inferred
Groups : G6PD deficiency
Description : Increased risk of dose-related hemolysis.
References :

  1. Bacdivim™[package insert]. Philadelphia, Pennysylvania: Mutual Pharmaceutical Company; 2013. [Link]

PMID: 1656303

Sulfamethoxazole

Sulfamethoxazole

Product: Ceftibuten

Identifier : DBSNPE003506
Drug : DB01015 (Sulfamethoxazole)
Interacting Gene/Enzyme : Glucose-6-phosphate 1-dehydrogenase
Gene Name : G6PD
UniProt ID : P11413
Defining Change(s) :

  • 224T->C

Allele Name : Swansea
Genotype(s) : Not Available
Type(s) : ADR Inferred
Groups : G6PD deficiency
Description : Increased risk of dose-related hemolysis.
References :

  1. Bacdivim™[package insert]. Philadelphia, Pennysylvania: Mutual Pharmaceutical Company; 2013. [Link]

PMID: 2824750

Sulfamethoxazole

Sulfamethoxazole

Product: Formestane

Identifier : DBSNPE003507
Drug : DB01015 (Sulfamethoxazole)
Interacting Gene/Enzyme : Glucose-6-phosphate 1-dehydrogenase
Gene Name : G6PD
UniProt ID : P11413
Defining Change(s) :

  • 281_283delAGA

Allele Name : Urayasu
Genotype(s) : Not Available
Type(s) : ADR Inferred
Groups : G6PD deficiency
Description : Increased risk of dose-related hemolysis.
References :

  1. Bacdivim™[package insert]. Philadelphia, Pennysylvania: Mutual Pharmaceutical Company; 2013. [Link]

PMID: 9109509

Sulfamethoxazole

Sulfamethoxazole

Product: Tiagabine (hydrochloride)

Identifier : DBSNPE003508
Drug : DB01015 (Sulfamethoxazole)
Interacting Gene/Enzyme : Glucose-6-phosphate 1-dehydrogenase
Gene Name : G6PD
UniProt ID : P11413
Defining Change(s) :

  • 317C->G544C->T592C->T

Allele Name : Vancouver
Genotype(s) : Not Available
Type(s) : ADR Inferred
Groups : G6PD deficiency
Description : Increased risk of dose-related hemolysis.
References :

  1. Bacdivim™[package insert]. Philadelphia, Pennysylvania: Mutual Pharmaceutical Company; 2013. [Link]

PMID: 9353416

Sulfamethoxazole

Sulfamethoxazole

Product: Miltefosine

Identifier : DBSNPE003510
Drug : DB01015 (Sulfamethoxazole)
Interacting Gene/Enzyme : Glucose-6-phosphate 1-dehydrogenase
Gene Name : G6PD
UniProt ID : P11413
Defining Change(s) :

  • 488G->A

Allele Name : Plymouth
Genotype(s) : Not Available
Type(s) : ADR Inferred
Groups : G6PD deficiency
Description : Increased risk of dose-related hemolysis.
References :

  1. Bacdivim™[package insert]. Philadelphia, Pennysylvania: Mutual Pharmaceutical Company; 2013. [Link]

PMID: 8182708

Sulfamethoxazole

Sulfamethoxazole

Product: Indinavir (sulfate)

Identifier : DBSNPE003511
Drug : DB01015 (Sulfamethoxazole)
Interacting Gene/Enzyme : Glucose-6-phosphate 1-dehydrogenase
Gene Name : G6PD
UniProt ID : P11413
Defining Change(s) :

  • 514C->T

Allele Name : Volendam
Genotype(s) : Not Available
Type(s) : ADR Inferred
Groups : G6PD deficiency
Description : Increased risk of dose-related hemolysis.
References :

  1. Bacdivim™[package insert]. Philadelphia, Pennysylvania: Mutual Pharmaceutical Company; 2013. [Link]

PMID: 25663984

Sulfamethoxazole

Sulfamethoxazole

Product: Indinavir

Identifier : DBSNPE003512
Drug : DB01015 (Sulfamethoxazole)
Interacting Gene/Enzyme : Glucose-6-phosphate 1-dehydrogenase
Gene Name : G6PD
UniProt ID : P11413
Defining Change(s) :

  • 527A->G

Allele Name : Shinshu
Genotype(s) : Not Available
Type(s) : ADR Inferred
Groups : G6PD deficiency
Description : Increased risk of dose-related hemolysis.
References :

  1. Bacdivim™[package insert]. Philadelphia, Pennysylvania: Mutual Pharmaceutical Company; 2013. [Link]

PMID: 25490143

Sulfamethoxazole

Sulfamethoxazole

Product: Valrubicin

Identifier : DBSNPE003513
Drug : DB01015 (Sulfamethoxazole)
Interacting Gene/Enzyme : Glucose-6-phosphate 1-dehydrogenase
Gene Name : G6PD
UniProt ID : P11413
Defining Change(s) :

  • 535A->T

Allele Name : Chikugo
Genotype(s) : Not Available
Type(s) : ADR Inferred
Groups : G6PD deficiency
Description : Increased risk of dose-related hemolysis.
References :

  1. Bacdivim™[package insert]. Philadelphia, Pennysylvania: Mutual Pharmaceutical Company; 2013. [Link]

PMID: 24603327

Sulfamethoxazole

Sulfamethoxazole

Product: Dapsone

Identifier : DBSNPE003514
Drug : DB01015 (Sulfamethoxazole)
Interacting Gene/Enzyme : Glucose-6-phosphate 1-dehydrogenase
Gene Name : G6PD
UniProt ID : P11413
Defining Change(s) :

  • 561_563delCTC

Allele Name : Tsukui
Genotype(s) : Not Available
Type(s) : ADR Inferred
Groups : G6PD deficiency
Description : Increased risk of dose-related hemolysis.
References :

  1. Bacdivim™[package insert]. Philadelphia, Pennysylvania: Mutual Pharmaceutical Company; 2013. [Link]

PMID: 24105441

Sulfamethoxazole

Sulfamethoxazole

Product: Warfarin

Identifier : DBSNPE003515
Drug : DB01015 (Sulfamethoxazole)
Interacting Gene/Enzyme : Glucose-6-phosphate 1-dehydrogenase
Gene Name : G6PD
UniProt ID : P11413
Defining Change(s) :

  • 573C>G

Allele Name : Pedoplis-Ckaro
Genotype(s) : Not Available
Type(s) : ADR Inferred
Groups : G6PD deficiency
Description : Increased risk of dose-related hemolysis.
References :

  1. Bacdivim™[package insert]. Philadelphia, Pennysylvania: Mutual Pharmaceutical Company; 2013. [Link]

PMID: 23775075

Sulfamethoxazole

Sulfamethoxazole

Product: Rimantadine (hydrochloride)

Identifier : DBSNPE003516
Drug : DB01015 (Sulfamethoxazole)
Interacting Gene/Enzyme : Glucose-6-phosphate 1-dehydrogenase
Gene Name : G6PD
UniProt ID : P11413
Defining Change(s) :

  • 593G->C

Allele Name : Santiago
Genotype(s) : Not Available
Type(s) : ADR Inferred
Groups : G6PD deficiency
Description : Increased risk of dose-related hemolysis.
References :

  1. Bacdivim™[package insert]. Philadelphia, Pennysylvania: Mutual Pharmaceutical Company; 2013. [Link]

PMID: 23542927

Sulfamethoxazole

Sulfamethoxazole

Product: Enalapril

Identifier : DBSNPE003517
Drug : DB01015 (Sulfamethoxazole)
Interacting Gene/Enzyme : Glucose-6-phosphate 1-dehydrogenase
Gene Name : G6PD
UniProt ID : P11413
Defining Change(s) :

  • 637G->T

Allele Name : Minnesota, Marion, Gastonia, LeJeune
Genotype(s) : Not Available
Type(s) : ADR Inferred
Groups : G6PD deficiency
Description : Increased risk of dose-related hemolysis.
References :

  1. Bacdivim™[package insert]. Philadelphia, Pennysylvania: Mutual Pharmaceutical Company; 2013. [Link]

PMID: 22343623

Sulfamethoxazole

Sulfamethoxazole

Product: Sitagliptin (phosphate)

Identifier : DBSNPE003518
Drug : DB01015 (Sulfamethoxazole)
Interacting Gene/Enzyme : Glucose-6-phosphate 1-dehydrogenase
Gene Name : G6PD
UniProt ID : P11413
Defining Change(s) :

  • 637G->T, 1037A->T

Allele Name : Cincinnati
Genotype(s) : Not Available
Type(s) : ADR Inferred
Groups : G6PD deficiency
Description : Increased risk of dose-related hemolysis.
References :

  1. Bacdivim™[package insert]. Philadelphia, Pennysylvania: Mutual Pharmaceutical Company; 2013. [Link]

PMID: 23166745

Sulfamethoxazole

Sulfamethoxazole

Product: Sitagliptin

Identifier : DBSNPE003519
Drug : DB01015 (Sulfamethoxazole)
Interacting Gene/Enzyme : Glucose-6-phosphate 1-dehydrogenase
Gene Name : G6PD
UniProt ID : P11413
Defining Change(s) :

  • 648T->G

Allele Name : Harilaou
Genotype(s) : Not Available
Type(s) : ADR Inferred
Groups : G6PD deficiency
Description : Increased risk of dose-related hemolysis.
References :

  1. Bacdivim™[package insert]. Philadelphia, Pennysylvania: Mutual Pharmaceutical Company; 2013. [Link]

PMID: 21666232

Sulfamethoxazole

Sulfamethoxazole

Product: Pixantrone

Identifier : DBSNPE003520
Drug : DB01015 (Sulfamethoxazole)
Interacting Gene/Enzyme : Glucose-6-phosphate 1-dehydrogenase
Gene Name : G6PD
UniProt ID : P11413
Defining Change(s) :

  • 683_685delACA

Allele Name : North Dallas
Genotype(s) : Not Available
Type(s) : ADR Inferred
Groups : G6PD deficiency
Description : Increased risk of dose-related hemolysis.
References :

  1. Bacdivim™[package insert]. Philadelphia, Pennysylvania: Mutual Pharmaceutical Company; 2013. [Link]

PMID: 19924112

Sulfamethoxazole

Sulfamethoxazole

Product: Metaxalone

Identifier : DBSNPE003521
Drug : DB01015 (Sulfamethoxazole)
Interacting Gene/Enzyme : Glucose-6-phosphate 1-dehydrogenase
Gene Name : G6PD
UniProt ID : P11413
Defining Change(s) :

  • 695G->A

Allele Name : Asahikawa
Genotype(s) : Not Available
Type(s) : ADR Inferred
Groups : G6PD deficiency
Description : Increased risk of dose-related hemolysis.
References :

  1. Bacdivim™[package insert]. Philadelphia, Pennysylvania: Mutual Pharmaceutical Company; 2013. [Link]

PMID: 20696141

Sulfamethoxazole

Sulfamethoxazole

Product: Etizolam

Identifier : DBSNPE003522
Drug : DB01015 (Sulfamethoxazole)
Interacting Gene/Enzyme : Glucose-6-phosphate 1-dehydrogenase
Gene Name : G6PD
UniProt ID : P11413
Defining Change(s) :

  • 713A->G

Allele Name : Durham
Genotype(s) : Not Available
Type(s) : ADR Inferred
Groups : G6PD deficiency
Description : Increased risk of dose-related hemolysis.
References :

  1. Bacdivim™[package insert]. Philadelphia, Pennysylvania: Mutual Pharmaceutical Company; 2013. [Link]

PMID: 8201586

Sulfamethoxazole

Sulfamethoxazole

Product: Ebastine

Identifier : DBSNPE003523
Drug : DB01015 (Sulfamethoxazole)
Interacting Gene/Enzyme : Glucose-6-phosphate 1-dehydrogenase
Gene Name : G6PD
UniProt ID : P11413
Defining Change(s) :

  • 724_729delGGCACT

Allele Name : Stonybrook
Genotype(s) : Not Available
Type(s) : ADR Inferred
Groups : G6PD deficiency
Description : Increased risk of dose-related hemolysis.
References :

  1. Bacdivim™[package insert]. Philadelphia, Pennysylvania: Mutual Pharmaceutical Company; 2013. [Link]

PMID: 7799399

Sulfamethoxazole

Sulfamethoxazole

Product: Pirfenidone

Identifier : DBSNPE003524
Drug : DB01015 (Sulfamethoxazole)
Interacting Gene/Enzyme : Glucose-6-phosphate 1-dehydrogenase
Gene Name : G6PD
UniProt ID : P11413
Defining Change(s) :

  • 769C->G

Allele Name : Wayne
Genotype(s) : Not Available
Type(s) : ADR Inferred
Groups : G6PD deficiency
Description : Increased risk of dose-related hemolysis.
References :

  1. Bacdivim™[package insert]. Philadelphia, Pennysylvania: Mutual Pharmaceutical Company; 2013. [Link]

PMID: 11478923

Sulfamethoxazole

Sulfamethoxazole

Product: β-Estradiol 17-valerate

Identifier : DBSNPE003525
Drug : DB01015 (Sulfamethoxazole)
Interacting Gene/Enzyme : Glucose-6-phosphate 1-dehydrogenase
Gene Name : G6PD
UniProt ID : P11413
Defining Change(s) :

  • 806G->A

Allele Name : Aveiro
Genotype(s) : Not Available
Type(s) : ADR Inferred
Groups : G6PD deficiency
Description : Increased risk of dose-related hemolysis.
References :

  1. Bacdivim™[package insert]. Philadelphia, Pennysylvania: Mutual Pharmaceutical Company; 2013. [Link]

PMID: 10822054

Sulfamethoxazole

Sulfamethoxazole

Product: Dihydroergotamine (mesylate)

Identifier : DBSNPE003526
Drug : DB01015 (Sulfamethoxazole)
Interacting Gene/Enzyme : Glucose-6-phosphate 1-dehydrogenase
Gene Name : G6PD
UniProt ID : P11413
Defining Change(s) :

  • 820G->A

Allele Name : Cleveland Corum
Genotype(s) : Not Available
Type(s) : ADR Inferred
Groups : G6PD deficiency
Description : Increased risk of dose-related hemolysis.
References :

  1. Bacdivim™[package insert]. Philadelphia, Pennysylvania: Mutual Pharmaceutical Company; 2013. [Link]

PMID: 9836606

Sulfamethoxazole

Sulfamethoxazole

Product: Balsalazide

Identifier : DBSNPE003527
Drug : DB01015 (Sulfamethoxazole)
Interacting Gene/Enzyme : Glucose-6-phosphate 1-dehydrogenase
Gene Name : G6PD
UniProt ID : P11413
Defining Change(s) :

  • 821A>T

Allele Name : Lille
Genotype(s) : Not Available
Type(s) : ADR Inferred
Groups : G6PD deficiency
Description : Increased risk of dose-related hemolysis.
References :

  1. Bacdivim™[package insert]. Philadelphia, Pennysylvania: Mutual Pharmaceutical Company; 2013. [Link]

PMID: 22737280

Sulfamethoxazole

Sulfamethoxazole

Product: Ciprofibrate

Identifier : DBSNPE003529
Drug : DB01015 (Sulfamethoxazole)
Interacting Gene/Enzyme : Glucose-6-phosphate 1-dehydrogenase
Gene Name : G6PD
UniProt ID : P11413
Defining Change(s) :

  • 826C->T

Allele Name : Sugao
Genotype(s) : Not Available
Type(s) : ADR Inferred
Groups : G6PD deficiency
Description : Increased risk of dose-related hemolysis.
References :

  1. Bacdivim™[package insert]. Philadelphia, Pennysylvania: Mutual Pharmaceutical Company; 2013. [Link]

PMID: 22091479

Sulfamethoxazole

Sulfamethoxazole

Product: Tamsulosin (hydrochloride)

Identifier : DBSNPE003530
Drug : DB01015 (Sulfamethoxazole)
Interacting Gene/Enzyme : Glucose-6-phosphate 1-dehydrogenase
Gene Name : G6PD
UniProt ID : P11413
Defining Change(s) :

  • 832T->C

Allele Name : La Jolla
Genotype(s) : Not Available
Type(s) : ADR Inferred
Groups : G6PD deficiency
Description : Increased risk of dose-related hemolysis.
References :

  1. Bacdivim™[package insert]. Philadelphia, Pennysylvania: Mutual Pharmaceutical Company; 2013. [Link]

PMID: 25660025

Sulfamethoxazole

Sulfamethoxazole

Product: Tamsulosin

Identifier : DBSNPE003531
Drug : DB01015 (Sulfamethoxazole)
Interacting Gene/Enzyme : Glucose-6-phosphate 1-dehydrogenase
Gene Name : G6PD
UniProt ID : P11413
Defining Change(s) :

  • 833C->T

Allele Name : Wexham
Genotype(s) : Not Available
Type(s) : ADR Inferred
Groups : G6PD deficiency
Description : Increased risk of dose-related hemolysis.
References :

  1. Bacdivim™[package insert]. Philadelphia, Pennysylvania: Mutual Pharmaceutical Company; 2013. [Link]

PMID: 25402598

Sulfamethoxazole

Sulfamethoxazole

Product: Eicosapentaenoic Acid

Identifier : DBSNPE003532
Drug : DB01015 (Sulfamethoxazole)
Interacting Gene/Enzyme : Glucose-6-phosphate 1-dehydrogenase
Gene Name : G6PD
UniProt ID : P11413
Defining Change(s) :

  • 851T>C

Allele Name : Piodivkow
Genotype(s) : Not Available
Type(s) : ADR Inferred
Groups : G6PD deficiency
Description : Increased risk of dose-related hemolysis.
References :

  1. Bacdivim™[package insert]. Philadelphia, Pennysylvania: Mutual Pharmaceutical Company; 2013. [Link]

PMID: 19856362

Sulfamethoxazole

Sulfamethoxazole

Product: UK 14,304

Identifier : DBSNPE003533
Drug : DB01015 (Sulfamethoxazole)
Interacting Gene/Enzyme : Glucose-6-phosphate 1-dehydrogenase
Gene Name : G6PD
UniProt ID : P11413
Defining Change(s) :

  • 910G->T

Allele Name : West Virginia
Genotype(s) : Not Available
Type(s) : ADR Inferred
Groups : G6PD deficiency
Description : Increased risk of dose-related hemolysis.
References :

  1. Bacdivim™[package insert]. Philadelphia, Pennysylvania: Mutual Pharmaceutical Company; 2013. [Link]

PMID: 21986572

Sulfamethoxazole

Sulfamethoxazole

Product: Rabeprazole (sodium)

Identifier : DBSNPE003534
Drug : DB01015 (Sulfamethoxazole)
Interacting Gene/Enzyme : Glucose-6-phosphate 1-dehydrogenase
Gene Name : G6PD
UniProt ID : P11413
Defining Change(s) :

  • 921G->C

Allele Name : Omiya
Genotype(s) : Not Available
Type(s) : ADR Inferred
Groups : G6PD deficiency
Description : Increased risk of dose-related hemolysis.
References :

  1. Bacdivim™[package insert]. Philadelphia, Pennysylvania: Mutual Pharmaceutical Company; 2013. [Link]

PMID: 20597485

Sulfamethoxazole

Sulfamethoxazole

Product: Rabeprazole

Identifier : DBSNPE003535
Drug : DB01015 (Sulfamethoxazole)
Interacting Gene/Enzyme : Glucose-6-phosphate 1-dehydrogenase
Gene Name : G6PD
UniProt ID : P11413
Defining Change(s) :

  • 953_976delCCACCAAAGGGTACCTGGAC GACC

Allele Name : Nara
Genotype(s) : Not Available
Type(s) : ADR Inferred
Groups : G6PD deficiency
Description : Increased risk of dose-related hemolysis.
References :

  1. Bacdivim™[package insert]. Philadelphia, Pennysylvania: Mutual Pharmaceutical Company; 2013. [Link]

PMID: 16627469

Sulfamethoxazole

Sulfamethoxazole

Product: Zofenopril (calcium)

Identifier : DBSNPE003536
Drug : DB01015 (Sulfamethoxazole)
Interacting Gene/Enzyme : Glucose-6-phosphate 1-dehydrogenase
Gene Name : G6PD
UniProt ID : P11413
Defining Change(s) :

  • 962G->A

Allele Name : Manhattan
Genotype(s) : Not Available
Type(s) : ADR Inferred
Groups : G6PD deficiency
Description : Increased risk of dose-related hemolysis.
References :

  1. Bacdivim™[package insert]. Philadelphia, Pennysylvania: Mutual Pharmaceutical Company; 2013. [Link]

PMID: 20068098

Sulfamethoxazole

Sulfamethoxazole

Product: Duloxetine

Identifier : DBSNPE003537
Drug : DB01015 (Sulfamethoxazole)
Interacting Gene/Enzyme : Glucose-6-phosphate 1-dehydrogenase
Gene Name : G6PD
UniProt ID : P11413
Defining Change(s) :

  • 964T->C

Allele Name : Rehevot
Genotype(s) : Not Available
Type(s) : ADR Inferred
Groups : G6PD deficiency
Description : Increased risk of dose-related hemolysis.
References :

  1. Bacdivim™[package insert]. Philadelphia, Pennysylvania: Mutual Pharmaceutical Company; 2013. [Link]

PMID: 18290633

Sulfamethoxazole

Sulfamethoxazole

Product: Etonogestrel

Identifier : DBSNPE003538
Drug : DB01015 (Sulfamethoxazole)
Interacting Gene/Enzyme : Glucose-6-phosphate 1-dehydrogenase
Gene Name : G6PD
UniProt ID : P11413
Defining Change(s) :

  • 99A->G
  • 1360C->T

Allele Name : Honiara
Genotype(s) : Not Available
Type(s) : ADR Inferred
Groups : G6PD deficiency
Description : Increased risk of dose-related hemolysis.
References :

  1. Bacdivim™[package insert]. Philadelphia, Pennysylvania: Mutual Pharmaceutical Company; 2013. [Link]

PMID: 16433906

Sulfamethoxazole

Sulfamethoxazole

Product: Medroxyprogesterone

Identifier : DBSNPE003539
Drug : DB01015 (Sulfamethoxazole)
Interacting Gene/Enzyme : Glucose-6-phosphate 1-dehydrogenase
Gene Name : G6PD
UniProt ID : P11413
Defining Change(s) :

  • 1246G->A

Allele Name : Tokyo, Fukushima
Genotype(s) : Not Available
Type(s) : ADR Inferred
Groups : G6PD deficiency
Description : Increased risk of dose-related hemolysis.
References :

  1. Bacdivim™[package insert]. Philadelphia, Pennysylvania: Mutual Pharmaceutical Company; 2013. [Link]

PMID: 19351824

Sulfamethoxazole

Sulfamethoxazole

Product: Prednisolone (disodium phosphate)

Identifier : DBSNPE003540
Drug : DB01015 (Sulfamethoxazole)
Interacting Gene/Enzyme : Glucose-6-phosphate 1-dehydrogenase
Gene Name : G6PD
UniProt ID : P11413
Defining Change(s) :

  • 1003G->A

Allele Name : Chatham
Genotype(s) : Not Available
Type(s) : ADR Inferred
Groups : G6PD deficiency
Description : Increased risk of dose-related hemolysis.
References :

  1. Bacdivim™[package insert]. Philadelphia, Pennysylvania: Mutual Pharmaceutical Company; 2013. [Link]

PMID: 10973989

Sulfamethoxazole

Sulfamethoxazole

Product: Dirithromycin

Identifier : DBSNPE003541
Drug : DB01015 (Sulfamethoxazole)
Interacting Gene/Enzyme : Glucose-6-phosphate 1-dehydrogenase
Gene Name : G6PD
UniProt ID : P11413
Defining Change(s) :

  • 1004C->A

Allele Name : Fushan
Genotype(s) : Not Available
Type(s) : ADR Inferred
Groups : G6PD deficiency
Description : Increased risk of dose-related hemolysis.
References :

  1. Bacdivim™[package insert]. Philadelphia, Pennysylvania: Mutual Pharmaceutical Company; 2013. [Link]

PMID: 10542155

Sulfamethoxazole

Sulfamethoxazole

Product: Epinastine

Identifier : DBSNPE003542
Drug : DB01015 (Sulfamethoxazole)
Interacting Gene/Enzyme : Glucose-6-phosphate 1-dehydrogenase
Gene Name : G6PD
UniProt ID : P11413
Defining Change(s) :

  • 1052G->T

Allele Name : Partenope
Genotype(s) : Not Available
Type(s) : ADR Inferred
Groups : G6PD deficiency
Description : Increased risk of dose-related hemolysis.
References :

  1. Bacdivim™[package insert]. Philadelphia, Pennysylvania: Mutual Pharmaceutical Company; 2013. [Link]

PMID: 25902731

Sulfamethoxazole

Sulfamethoxazole

Product: Amifostine

Identifier : DBSNPE003543
Drug : DB01015 (Sulfamethoxazole)
Interacting Gene/Enzyme : Glucose-6-phosphate 1-dehydrogenase
Gene Name : G6PD
UniProt ID : P11413
Defining Change(s) :

  • 1057C->T

Allele Name : Ierapediva
Genotype(s) : Not Available
Type(s) : ADR Inferred
Groups : G6PD deficiency
Description : Increased risk of dose-related hemolysis.
References :

  1. Bacdivim™[package insert]. Philadelphia, Pennysylvania: Mutual Pharmaceutical Company; 2013. [Link]

PMID: 24013174

Sulfamethoxazole

Sulfamethoxazole

Product: Bezafibrate

Identifier : DBSNPE003544
Drug : DB01015 (Sulfamethoxazole)
Interacting Gene/Enzyme : Glucose-6-phosphate 1-dehydrogenase
Gene Name : G6PD
UniProt ID : P11413
Defining Change(s) :

  • 1193A->G

Allele Name : Anadia
Genotype(s) : Not Available
Type(s) : ADR Inferred
Groups : G6PD deficiency
Description : Increased risk of dose-related hemolysis.
References :

  1. Bacdivim™[package insert]. Philadelphia, Pennysylvania: Mutual Pharmaceutical Company; 2013. [Link]

PMID: 23105120

Sulfamethoxazole

Sulfamethoxazole

Product: Triamcinolone (acetonide)

Identifier : DBSNPE003545
Drug : DB01015 (Sulfamethoxazole)
Interacting Gene/Enzyme : Glucose-6-phosphate 1-dehydrogenase
Gene Name : G6PD
UniProt ID : P11413
Defining Change(s) :

  • 1220A->C

Allele Name : Abeno
Genotype(s) : Not Available
Type(s) : ADR Inferred
Groups : G6PD deficiency
Description : Increased risk of dose-related hemolysis.
References :

  1. Bacdivim™[package insert]. Philadelphia, Pennysylvania: Mutual Pharmaceutical Company; 2013. [Link]

PMID: 12529430

Sulfamethoxazole

Sulfamethoxazole

Product: Aceclofenac

Identifier : DBSNPE003547
Drug : DB01015 (Sulfamethoxazole)
Interacting Gene/Enzyme : Glucose-6-phosphate 1-dehydrogenase
Gene Name : G6PD
UniProt ID : P11413
Defining Change(s) :

  • 1316G->C

Allele Name : Pawnee
Genotype(s) : Not Available
Type(s) : ADR Inferred
Groups : G6PD deficiency
Description : Increased risk of dose-related hemolysis.
References :

  1. Bacdivim™[package insert]. Philadelphia, Pennysylvania: Mutual Pharmaceutical Company; 2013. [Link]

PMID: 20857469

Sulfamethoxazole

Sulfamethoxazole

Product: Vinflunine

Identifier : DBSNPE003548
Drug : DB01015 (Sulfamethoxazole)
Interacting Gene/Enzyme : Glucose-6-phosphate 1-dehydrogenase
Gene Name : G6PD
UniProt ID : P11413
Defining Change(s) :

  • 1342A->G

Allele Name : S. Antioco
Genotype(s) : Not Available
Type(s) : ADR Inferred
Groups : G6PD deficiency
Description : Increased risk of dose-related hemolysis.
References :

  1. Bacdivim™[package insert]. Philadelphia, Pennysylvania: Mutual Pharmaceutical Company; 2013. [Link]

PMID: 23394180

Sulfamethoxazole

Sulfamethoxazole

Product: Ciclesonide

Identifier : DBSNPE003549
Drug : DB01015 (Sulfamethoxazole)
Interacting Gene/Enzyme : Glucose-6-phosphate 1-dehydrogenase
Gene Name : G6PD
UniProt ID : P11413
Defining Change(s) :

  • 1347G->C

Allele Name : Cassano
Genotype(s) : Not Available
Type(s) : ADR Inferred
Groups : G6PD deficiency
Description : Increased risk of dose-related hemolysis.
References :

  1. Bacdivim™[package insert]. Philadelphia, Pennysylvania: Mutual Pharmaceutical Company; 2013. [Link]

PMID: 23875972

Sulfamethoxazole

Sulfamethoxazole

Product: Ropinirole (hydrochloride)

Identifier : DBSNPE003550
Drug : DB01015 (Sulfamethoxazole)
Interacting Gene/Enzyme : Glucose-6-phosphate 1-dehydrogenase
Gene Name : G6PD
UniProt ID : P11413
Defining Change(s) :

  • 1347G->C
  • 1360C->T

Allele Name : Hermoupolis
Genotype(s) : Not Available
Type(s) : ADR Inferred
Groups : G6PD deficiency
Description : Increased risk of dose-related hemolysis.
References :

  1. Bacdivim™[package insert]. Philadelphia, Pennysylvania: Mutual Pharmaceutical Company; 2013. [Link]

PMID: 15476401

Sulfamethoxazole

Sulfamethoxazole

Product: Triclabendazole

Identifier : DBSNPE003551
Drug : DB01015 (Sulfamethoxazole)
Interacting Gene/Enzyme : Glucose-6-phosphate 1-dehydrogenase
Gene Name : G6PD
UniProt ID : P11413
Defining Change(s) :

  • 1360C->T

Allele Name : Union,Maewo, Chinese-2, Kalo
Genotype(s) : Not Available
Type(s) : ADR Inferred
Groups : G6PD deficiency
Description : Increased risk of dose-related hemolysis.
References :

  1. Bacdivim™[package insert]. Philadelphia, Pennysylvania: Mutual Pharmaceutical Company; 2013. [Link]

PMID: 15367702

Sulfamethoxazole

Sulfamethoxazole

Product: Dextromethorphan (hydrobromide)

Identifier : DBSNPE003552
Drug : DB01015 (Sulfamethoxazole)
Interacting Gene/Enzyme : Glucose-6-phosphate 1-dehydrogenase
Gene Name : G6PD
UniProt ID : P11413
Defining Change(s) :

  • 1361G->A

Allele Name : Andalus
Genotype(s) : Not Available
Type(s) : ADR Inferred
Groups : G6PD deficiency
Description : Increased risk of dose-related hemolysis.
References :

  1. Bacdivim™[package insert]. Philadelphia, Pennysylvania: Mutual Pharmaceutical Company; 2013. [Link]

PMID: 28561035

Sulfamethoxazole

Sulfamethoxazole

Product: Moricizine

Identifier : DBSNPE003553
Drug : DB01015 (Sulfamethoxazole)
Interacting Gene/Enzyme : Glucose-6-phosphate 1-dehydrogenase
Gene Name : G6PD
UniProt ID : P11413
Defining Change(s) :

  • 1376G->C

Allele Name : Cosenza
Genotype(s) : Not Available
Type(s) : ADR Inferred
Groups : G6PD deficiency
Description : Increased risk of dose-related hemolysis.
References :

  1. Bacdivim™[package insert]. Philadelphia, Pennysylvania: Mutual Pharmaceutical Company; 2013. [Link]

PMID: 23303071

Sulfamethoxazole

Sulfamethoxazole

Product: Mafenide (Acetate)

Identifier : DBSNPE003554
Drug : DB01015 (Sulfamethoxazole)
Interacting Gene/Enzyme : Glucose-6-phosphate 1-dehydrogenase
Gene Name : G6PD
UniProt ID : P11413
Defining Change(s) :

  • 1376G->T

Allele Name : Canton, Taiwan- Hakka, Gifu-like, Agrigento-like
Genotype(s) : Not Available
Type(s) : ADR Inferred
Groups : G6PD deficiency
Description : Increased risk of dose-related hemolysis.
References :

  1. Bacdivim™[package insert]. Philadelphia, Pennysylvania: Mutual Pharmaceutical Company; 2013. [Link]

PMID: 24121008

Sulfamethoxazole

Sulfamethoxazole

Product: Mafenide

Identifier : DBSNPE003555
Drug : DB01015 (Sulfamethoxazole)
Interacting Gene/Enzyme : Glucose-6-phosphate 1-dehydrogenase
Gene Name : G6PD
UniProt ID : P11413
Defining Change(s) :

  • 1387C->A

Allele Name : Flores
Genotype(s) : Not Available
Type(s) : ADR Inferred
Groups : G6PD deficiency
Description : Increased risk of dose-related hemolysis.
References :

  1. Bacdivim™[package insert]. Philadelphia, Pennysylvania: Mutual Pharmaceutical Company; 2013. [Link]

PMID: 7991613

Sulfamethoxazole

Sulfamethoxazole

Product: Lercanidipine (hydrochloride)

Identifier : DBSNPE003557
Drug : DB01015 (Sulfamethoxazole)
Interacting Gene/Enzyme : Glucose-6-phosphate 1-dehydrogenase
Gene Name : G6PD
UniProt ID : P11413
Defining Change(s) :

  • 169C->T

Allele Name : Kamogawa
Genotype(s) : Not Available
Type(s) : ADR Inferred
Groups : G6PD deficiency
Description : Increased risk of dose-related hemolysis.
References :

  1. Bacdivim™[package insert]. Philadelphia, Pennysylvania: Mutual Pharmaceutical Company; 2013. [Link]

PMID: 20708942

Sulfamethoxazole

Sulfamethoxazole

Product: Lercanidipine

Identifier : DBSNPE003558
Drug : DB01015 (Sulfamethoxazole)
Interacting Gene/Enzyme : Glucose-6-phosphate 1-dehydrogenase
Gene Name : G6PD
UniProt ID : P11413
Defining Change(s) :

  • 179T>C

Allele Name : Costanzo
Genotype(s) : Not Available
Type(s) : ADR Inferred
Groups : G6PD deficiency
Description : Increased risk of dose-related hemolysis.
References :

  1. Bacdivim™[package insert]. Philadelphia, Pennysylvania: Mutual Pharmaceutical Company; 2013. [Link]

PMID: 11279259

Sulfamethoxazole

Sulfamethoxazole

Product: Misoprostol

Identifier : DBSNPE003559
Drug : DB01015 (Sulfamethoxazole)
Interacting Gene/Enzyme : Glucose-6-phosphate 1-dehydrogenase
Gene Name : G6PD
UniProt ID : P11413
Defining Change(s) :

  • 185C->A

Allele Name : Amazonia
Genotype(s) : Not Available
Type(s) : ADR Inferred
Groups : G6PD deficiency
Description : Increased risk of dose-related hemolysis.
References :

  1. Bacdivim™[package insert]. Philadelphia, Pennysylvania: Mutual Pharmaceutical Company; 2013. [Link]

PMID: 1637285

Sulfamethoxazole

Sulfamethoxazole

Product: Mifamurtide

Identifier : DBSNPE003560
Drug : DB01015 (Sulfamethoxazole)
Interacting Gene/Enzyme : Glucose-6-phosphate 1-dehydrogenase
Gene Name : G6PD
UniProt ID : P11413
Defining Change(s) :

  • 196T->A

Allele Name : Songklanagarind
Genotype(s) : Not Available
Type(s) : ADR Inferred
Groups : G6PD deficiency
Description : Increased risk of dose-related hemolysis.
References :

  1. Bacdivim™[package insert]. Philadelphia, Pennysylvania: Mutual Pharmaceutical Company; 2013. [Link]

PMID: 23237800

Sulfamethoxazole

Sulfamethoxazole

Product: Eslicarbazepine (acetate)

Identifier : DBSNPE003561
Drug : DB01015 (Sulfamethoxazole)
Interacting Gene/Enzyme : Glucose-6-phosphate 1-dehydrogenase
Gene Name : G6PD
UniProt ID : P11413
Defining Change(s) :

  • 202G->A
  • 871G->A

Allele Name : Hechi
Genotype(s) : Not Available
Type(s) : ADR Inferred
Groups : G6PD deficiency
Description : Increased risk of dose-related hemolysis.
References :

  1. Bacdivim™[package insert]. Philadelphia, Pennysylvania: Mutual Pharmaceutical Company; 2013. [Link]

PMID: 22954722

Sulfamethoxazole

Sulfamethoxazole

Product: Tiagabine

Identifier : DBSNPE003562
Drug : DB01015 (Sulfamethoxazole)
Interacting Gene/Enzyme : Glucose-6-phosphate 1-dehydrogenase
Gene Name : G6PD
UniProt ID : P11413
Defining Change(s) :

  • 208T->C

Allele Name : Namouru
Genotype(s) : Not Available
Type(s) : ADR Inferred
Groups : G6PD deficiency
Description : Increased risk of dose-related hemolysis.
References :

  1. Bacdivim™[package insert]. Philadelphia, Pennysylvania: Mutual Pharmaceutical Company; 2013. [Link]

PMID: 22052811

Sulfamethoxazole

Sulfamethoxazole

Product: Carmustine

Identifier : DBSNPE003563
Drug : DB01015 (Sulfamethoxazole)
Interacting Gene/Enzyme : Glucose-6-phosphate 1-dehydrogenase
Gene Name : G6PD
UniProt ID : P11413
Defining Change(s) :

  • 352T>C

Allele Name : Bao Loc
Genotype(s) : Not Available
Type(s) : ADR Inferred
Groups : G6PD deficiency
Description : Increased risk of dose-related hemolysis.
References :

  1. Bacdivim™[package insert]. Philadelphia, Pennysylvania: Mutual Pharmaceutical Company; 2013. [Link]

PMID: 24726384

Sulfamethoxazole

Sulfamethoxazole

Product: Eptifibatide

Identifier : DBSNPE003564
Drug : DB01015 (Sulfamethoxazole)
Interacting Gene/Enzyme : Glucose-6-phosphate 1-dehydrogenase
Gene Name : G6PD
UniProt ID : P11413
Defining Change(s) :

  • 375G->T, 379G->T383T->C384C>T

Allele Name : Crispim
Genotype(s) : Not Available
Type(s) : ADR Inferred
Groups : G6PD deficiency
Description : Increased risk of dose-related hemolysis.
References :

  1. Bacdivim™[package insert]. Philadelphia, Pennysylvania: Mutual Pharmaceutical Company; 2013. [Link]

PMID: 24280423

Sulfamethoxazole

Sulfamethoxazole

Product: Bedaquiline (fumarate)

Identifier : DBSNPE003565
Drug : DB01015 (Sulfamethoxazole)
Interacting Gene/Enzyme : Glucose-6-phosphate 1-dehydrogenase
Gene Name : G6PD
UniProt ID : P11413
Defining Change(s) :

  • 376A->G
  • 463C->G

Allele Name : Acrokorinthos
Genotype(s) : Not Available
Type(s) : ADR Inferred
Groups : G6PD deficiency
Description : Increased risk of dose-related hemolysis.
References :

  1. Bacdivim™[package insert]. Philadelphia, Pennysylvania: Mutual Pharmaceutical Company; 2013. [Link]

PMID: 28257841

Sulfamethoxazole

Sulfamethoxazole

Product: Bedaquiline

Identifier : DBSNPE003566
Drug : DB01015 (Sulfamethoxazole)
Interacting Gene/Enzyme : Glucose-6-phosphate 1-dehydrogenase
Gene Name : G6PD
UniProt ID : P11413
Defining Change(s) :

  • 376A->G
  • 542A->T

Allele Name : Santa Maria
Genotype(s) : Not Available
Type(s) : ADR Inferred
Groups : G6PD deficiency
Description : Increased risk of dose-related hemolysis.
References :

  1. Bacdivim™[package insert]. Philadelphia, Pennysylvania: Mutual Pharmaceutical Company; 2013. [Link]

PMID: 24178759

Sulfamethoxazole

Sulfamethoxazole

Product: Iopamidol

Identifier : DBSNPE003567
Drug : DB01015 (Sulfamethoxazole)
Interacting Gene/Enzyme : Glucose-6-phosphate 1-dehydrogenase
Gene Name : G6PD
UniProt ID : P11413
Defining Change(s) :

  • 376A->G
  • 871G->A

Allele Name : Ananindeua
Genotype(s) : Not Available
Type(s) : ADR Inferred
Groups : G6PD deficiency
Description : Increased risk of dose-related hemolysis.
References :

  1. Bacdivim™[package insert]. Philadelphia, Pennysylvania: Mutual Pharmaceutical Company; 2013. [Link]

PMID: 24174263

Sulfamethoxazole

Sulfamethoxazole

Product: Sarpogrelate (hydrochloride)

Identifier : DBSNPE003568
Drug : DB01015 (Sulfamethoxazole)
Interacting Gene/Enzyme : Glucose-6-phosphate 1-dehydrogenase
Gene Name : G6PD
UniProt ID : P11413
Defining Change(s) :

  • 383T->C

Allele Name : Vanua Lava
Genotype(s) : Not Available
Type(s) : ADR Inferred
Groups : G6PD deficiency
Description : Increased risk of dose-related hemolysis.
References :

  1. Bacdivim™[package insert]. Philadelphia, Pennysylvania: Mutual Pharmaceutical Company; 2013. [Link]

PMID: 23986182

Sulfamethoxazole

Sulfamethoxazole

Product: Limaprost

Identifier : DBSNPE003569
Drug : DB01015 (Sulfamethoxazole)
Interacting Gene/Enzyme : Glucose-6-phosphate 1-dehydrogenase
Gene Name : G6PD
UniProt ID : P11413
Defining Change(s) :

  • 406C->T

Allele Name : Valladolid
Genotype(s) : Not Available
Type(s) : ADR Inferred
Groups : G6PD deficiency
Description : Increased risk of dose-related hemolysis.
References :

  1. Bacdivim™[package insert]. Philadelphia, Pennysylvania: Mutual Pharmaceutical Company; 2013. [Link]

PMID: 10875251

Sulfamethoxazole

Sulfamethoxazole

Product: Lubiprostone

Identifier : DBSNPE003570
Drug : DB01015 (Sulfamethoxazole)
Interacting Gene/Enzyme : Glucose-6-phosphate 1-dehydrogenase
Gene Name : G6PD
UniProt ID : P11413
Defining Change(s) :

  • 409C->T

Allele Name : Belem
Genotype(s) : Not Available
Type(s) : ADR Inferred
Groups : G6PD deficiency
Description : Increased risk of dose-related hemolysis.
References :

  1. Bacdivim™[package insert]. Philadelphia, Pennysylvania: Mutual Pharmaceutical Company; 2013. [Link]

PMID: 10535455

Sulfamethoxazole

Sulfamethoxazole

Product: Rasagiline

Identifier : DBSNPE003571
Drug : DB01015 (Sulfamethoxazole)
Interacting Gene/Enzyme : Glucose-6-phosphate 1-dehydrogenase
Gene Name : G6PD
UniProt ID : P11413
Defining Change(s) :

  • 442G->A

Allele Name : Liuzhou
Genotype(s) : Not Available
Type(s) : ADR Inferred
Groups : G6PD deficiency
Description : Increased risk of dose-related hemolysis.
References :

  1. Bacdivim™[package insert]. Philadelphia, Pennysylvania: Mutual Pharmaceutical Company; 2013. [Link]

PMID: 9075696

Sulfamethoxazole

Sulfamethoxazole

Product: Fingolimod

Identifier : DBSNPE003572
Drug : DB01015 (Sulfamethoxazole)
Interacting Gene/Enzyme : Glucose-6-phosphate 1-dehydrogenase
Gene Name : G6PD
UniProt ID : P11413
Defining Change(s) :

  • 473G>A

Allele Name : Shenzen
Genotype(s) : Not Available
Type(s) : ADR Inferred
Groups : G6PD deficiency
Description : Increased risk of dose-related hemolysis.
References :

  1. Bacdivim™[package insert]. Philadelphia, Pennysylvania: Mutual Pharmaceutical Company; 2013. [Link]

PMID: 10650151

Sulfamethoxazole

Sulfamethoxazole

Product: Raltitrexed

Identifier : DBSNPE003573
Drug : DB01015 (Sulfamethoxazole)
Interacting Gene/Enzyme : Glucose-6-phosphate 1-dehydrogenase
Gene Name : G6PD
UniProt ID : P11413
Defining Change(s) :

  • 493A->G

Allele Name : Taipei “Chinese- 3”
Genotype(s) : Not Available
Type(s) : ADR Inferred
Groups : G6PD deficiency
Description : Increased risk of dose-related hemolysis.
References :

  1. Bacdivim™[package insert]. Philadelphia, Pennysylvania: Mutual Pharmaceutical Company; 2013. [Link]

PMID: 7547985

Sulfamethoxazole

Sulfamethoxazole

Product: Cyproterone (acetate)

Identifier : DBSNPE003574
Drug : DB01015 (Sulfamethoxazole)
Interacting Gene/Enzyme : Glucose-6-phosphate 1-dehydrogenase
Gene Name : G6PD
UniProt ID : P11413
Defining Change(s) :

  • 496C>T

Allele Name : Toledo
Genotype(s) : Not Available
Type(s) : ADR Inferred
Groups : G6PD deficiency
Description : Increased risk of dose-related hemolysis.
References :

  1. Bacdivim™[package insert]. Philadelphia, Pennysylvania: Mutual Pharmaceutical Company; 2013. [Link]

PMID: 7693328

Sulfamethoxazole

Sulfamethoxazole

Product: Doxycycline (hyclate)

Identifier : DBSNPE003575
Drug : DB01015 (Sulfamethoxazole)
Interacting Gene/Enzyme : Glucose-6-phosphate 1-dehydrogenase
Gene Name : G6PD
UniProt ID : P11413
Defining Change(s) :

  • 497G->A

Allele Name : Naone
Genotype(s) : Not Available
Type(s) : ADR Inferred
Groups : G6PD deficiency
Description : Increased risk of dose-related hemolysis.
References :

  1. Bacdivim™[package insert]. Philadelphia, Pennysylvania: Mutual Pharmaceutical Company; 2013. [Link]

PMID: 22496574

Sulfamethoxazole

Sulfamethoxazole

Product: Topotecan

Identifier : DBSNPE003576
Drug : DB01015 (Sulfamethoxazole)
Interacting Gene/Enzyme : Glucose-6-phosphate 1-dehydrogenase
Gene Name : G6PD
UniProt ID : P11413
Defining Change(s) :

  • 517T->C

Allele Name : Nankang
Genotype(s) : Not Available
Type(s) : ADR Inferred
Groups : G6PD deficiency
Description : Increased risk of dose-related hemolysis.
References :

  1. Bacdivim™[package insert]. Philadelphia, Pennysylvania: Mutual Pharmaceutical Company; 2013. [Link]

PMID: 20876278

Sulfamethoxazole

Sulfamethoxazole

Product: Azelastine

Identifier : DBSNPE003577
Drug : DB01015 (Sulfamethoxazole)
Interacting Gene/Enzyme : Glucose-6-phosphate 1-dehydrogenase
Gene Name : G6PD
UniProt ID : P11413
Defining Change(s) :

  • 519C->G

Allele Name : Miaoli
Genotype(s) : Not Available
Type(s) : ADR Inferred
Groups : G6PD deficiency
Description : Increased risk of dose-related hemolysis.
References :

  1. Bacdivim™[package insert]. Philadelphia, Pennysylvania: Mutual Pharmaceutical Company; 2013. [Link]

PMID: 19001433

Sulfamethoxazole

Sulfamethoxazole

Product: Miconazole (nitrate)

Identifier : DBSNPE003578
Drug : DB01015 (Sulfamethoxazole)
Interacting Gene/Enzyme : Glucose-6-phosphate 1-dehydrogenase
Gene Name : G6PD
UniProt ID : P11413
Defining Change(s) :

  • 563C->T

Allele Name : Mediterranean, Dallas, Panama‚ Sassari, Cagliari, Birmingham
Genotype(s) : Not Available
Type(s) : ADR Inferred
Groups : G6PD deficiency
Description : Increased risk of dose-related hemolysis.
References :

  1. Bacdivim™[package insert]. Philadelphia, Pennysylvania: Mutual Pharmaceutical Company; 2013. [Link]

PMID: 25621531

Sulfamethoxazole

Sulfamethoxazole

Product: Diacerein

Identifier : DBSNPE003579
Drug : DB01015 (Sulfamethoxazole)
Interacting Gene/Enzyme : Glucose-6-phosphate 1-dehydrogenase
Gene Name : G6PD
UniProt ID : P11413
Defining Change(s) :

  • 592C->T

Allele Name : Coimbra Shunde
Genotype(s) : Not Available
Type(s) : ADR Inferred
Groups : G6PD deficiency
Description : Increased risk of dose-related hemolysis.
References :

  1. Bacdivim™[package insert]. Philadelphia, Pennysylvania: Mutual Pharmaceutical Company; 2013. [Link]

PMID: 25593987

Sulfamethoxazole

Sulfamethoxazole

Product: Lomefloxacin

Identifier : DBSNPE003580
Drug : DB01015 (Sulfamethoxazole)
Interacting Gene/Enzyme : Glucose-6-phosphate 1-dehydrogenase
Gene Name : G6PD
UniProt ID : P11413
Defining Change(s) :

  • 593G>A

Allele Name : Nilgiri
Genotype(s) : Not Available
Type(s) : ADR Inferred
Groups : G6PD deficiency
Description : Increased risk of dose-related hemolysis.
References :

  1. Bacdivim™[package insert]. Philadelphia, Pennysylvania: Mutual Pharmaceutical Company; 2013. [Link]

PMID: 22776759

Sulfamethoxazole

Sulfamethoxazole

Product: Paroxetine (hydrochloride hemihydrate)

Identifier : DBSNPE003581
Drug : DB01015 (Sulfamethoxazole)
Interacting Gene/Enzyme : Glucose-6-phosphate 1-dehydrogenase
Gene Name : G6PD
UniProt ID : P11413
Defining Change(s) :

  • 679C->T

Allele Name : Radlowo
Genotype(s) : Not Available
Type(s) : ADR Inferred
Groups : G6PD deficiency
Description : Increased risk of dose-related hemolysis.
References :

  1. Bacdivim™[package insert]. Philadelphia, Pennysylvania: Mutual Pharmaceutical Company; 2013. [Link]

PMID: 22952994

Sulfamethoxazole

Sulfamethoxazole

Product: Homoharringtonine

Identifier : DBSNPE003582
Drug : DB01015 (Sulfamethoxazole)
Interacting Gene/Enzyme : Glucose-6-phosphate 1-dehydrogenase
Gene Name : G6PD
UniProt ID : P11413
Defining Change(s) :

  • 811G>C

Allele Name : Roubaix
Genotype(s) : Not Available
Type(s) : ADR Inferred
Groups : G6PD deficiency
Description : Increased risk of dose-related hemolysis.
References :

  1. Bacdivim™[package insert]. Philadelphia, Pennysylvania: Mutual Pharmaceutical Company; 2013. [Link]

PMID: 17554340

Sulfamethoxazole

Sulfamethoxazole

Product: Tamoxifen

Identifier : DBSNPE003584
Drug : DB01015 (Sulfamethoxazole)
Interacting Gene/Enzyme : Glucose-6-phosphate 1-dehydrogenase
Gene Name : G6PD
UniProt ID : P11413
Defining Change(s) :

  • 835A->T

Allele Name : Chinese-1
Genotype(s) : Not Available
Type(s) : ADR Inferred
Groups : G6PD deficiency
Description : Increased risk of dose-related hemolysis.
References :

  1. Bacdivim™[package insert]. Philadelphia, Pennysylvania: Mutual Pharmaceutical Company; 2013. [Link]

PMID: 17502136

Sulfamethoxazole

Sulfamethoxazole

Product: Donepezil

Identifier : DBSNPE003585
Drug : DB01015 (Sulfamethoxazole)
Interacting Gene/Enzyme : Glucose-6-phosphate 1-dehydrogenase
Gene Name : G6PD
UniProt ID : P11413
Defining Change(s) :

  • 848A>G

Allele Name : Mizushima
Genotype(s) : Not Available
Type(s) : ADR Inferred
Groups : G6PD deficiency
Description : Increased risk of dose-related hemolysis.
References :

  1. Bacdivim™[package insert]. Philadelphia, Pennysylvania: Mutual Pharmaceutical Company; 2013. [Link]

PMID: 21481589

Sulfamethoxazole

Sulfamethoxazole

Product: Voglibose

Identifier : DBSNPE003586
Drug : DB01015 (Sulfamethoxazole)
Interacting Gene/Enzyme : Glucose-6-phosphate 1-dehydrogenase
Gene Name : G6PD
UniProt ID : P11413
Defining Change(s) :

  • 853C->T

Allele Name : Osaka
Genotype(s) : Not Available
Type(s) : ADR Inferred
Groups : G6PD deficiency
Description : Increased risk of dose-related hemolysis.
References :

  1. Bacdivim™[package insert]. Philadelphia, Pennysylvania: Mutual Pharmaceutical Company; 2013. [Link]

PMID: 21538437

Sulfamethoxazole

Sulfamethoxazole

Product: PPQ-102

Identifier : DBSNPE003587
Drug : DB01015 (Sulfamethoxazole)
Interacting Gene/Enzyme : Glucose-6-phosphate 1-dehydrogenase
Gene Name : G6PD
UniProt ID : P11413
Defining Change(s) :

  • 871G->A

Allele Name : Viangchan, Jammu
Genotype(s) : Not Available
Type(s) : ADR Inferred
Groups : G6PD deficiency
Description : Increased risk of dose-related hemolysis.
References :

  1. Bacdivim™[package insert]. Philadelphia, Pennysylvania: Mutual Pharmaceutical Company; 2013. [Link]

PMID: 18762160

Sulfamethoxazole

Sulfamethoxazole

Product: Diclofenac

Identifier : DBSNPE003588
Drug : DB01015 (Sulfamethoxazole)
Interacting Gene/Enzyme : Glucose-6-phosphate 1-dehydrogenase
Gene Name : G6PD
UniProt ID : P11413
Defining Change(s) :

  • 916G->A

Allele Name : Seoul
Genotype(s) : Not Available
Type(s) : ADR Inferred
Groups : G6PD deficiency
Description : Increased risk of dose-related hemolysis.
References :

  1. Bacdivim™[package insert]. Philadelphia, Pennysylvania: Mutual Pharmaceutical Company; 2013. [Link]

PMID: 8222273

Sulfamethoxazole

Sulfamethoxazole

Product: Fluoxetine

Identifier : DBSNPE003589
Drug : DB01015 (Sulfamethoxazole)
Interacting Gene/Enzyme : Glucose-6-phosphate 1-dehydrogenase
Gene Name : G6PD
UniProt ID : P11413
Defining Change(s) :

  • 929G->A

Allele Name : Ludhiana
Genotype(s) : Not Available
Type(s) : ADR Inferred
Groups : G6PD deficiency
Description : Increased risk of dose-related hemolysis.
References :

  1. Bacdivim™[package insert]. Philadelphia, Pennysylvania: Mutual Pharmaceutical Company; 2013. [Link]

PMID: 1431593

Sulfamethoxazole

Sulfamethoxazole

Product: Talipexole

Identifier : DBSNPE003590
Drug : DB01015 (Sulfamethoxazole)
Interacting Gene/Enzyme : Glucose-6-phosphate 1-dehydrogenase
Gene Name : G6PD
UniProt ID : P11413
Defining Change(s) :

  • 977C->A

Allele Name : Farroupilha
Genotype(s) : Not Available
Type(s) : ADR Inferred
Groups : G6PD deficiency
Description : Increased risk of dose-related hemolysis.
References :

  1. Bacdivim™[package insert]. Philadelphia, Pennysylvania: Mutual Pharmaceutical Company; 2013. [Link]

PMID: 6441143

Sulfamethoxazole

Sulfamethoxazole

Product: Sibutramine (hydrochloride monohydrate)

Identifier : DBSNPE003591
Drug : DB01015 (Sulfamethoxazole)
Interacting Gene/Enzyme : Glucose-6-phosphate 1-dehydrogenase
Gene Name : G6PD
UniProt ID : P11413
Defining Change(s) :

  • 1024C->T

Allele Name : Chinese-5
Genotype(s) : Not Available
Type(s) : ADR Inferred
Groups : G6PD deficiency
Description : Increased risk of dose-related hemolysis.
References :

  1. Bacdivim™[package insert]. Philadelphia, Pennysylvania: Mutual Pharmaceutical Company; 2013. [Link]

PMID: 23524670

Sulfamethoxazole

Sulfamethoxazole

Product: Sibutramine (hydrochloride)

Identifier : DBSNPE003592
Drug : DB01015 (Sulfamethoxazole)
Interacting Gene/Enzyme : Glucose-6-phosphate 1-dehydrogenase
Gene Name : G6PD
UniProt ID : P11413
Defining Change(s) :

  • 130G>A

Allele Name : Rignano
Genotype(s) : Not Available
Type(s) : ADR Inferred
Groups : G6PD deficiency
Description : Increased risk of dose-related hemolysis.
References :

  1. Bacdivim™[package insert]. Philadelphia, Pennysylvania: Mutual Pharmaceutical Company; 2013. [Link]

PMID: 12176665

Sulfamethoxazole

Sulfamethoxazole

Product: Zaltoprofen

Identifier : DBSNPE003593
Drug : DB01015 (Sulfamethoxazole)
Interacting Gene/Enzyme : Glucose-6-phosphate 1-dehydrogenase
Gene Name : G6PD
UniProt ID : P11413
Defining Change(s) :

  • 131C->G

Allele Name : Orissa
Genotype(s) : Not Available
Type(s) : ADR Inferred
Groups : G6PD deficiency
Description : Increased risk of dose-related hemolysis.
References :

  1. Bacdivim™[package insert]. Philadelphia, Pennysylvania: Mutual Pharmaceutical Company; 2013. [Link]

PMID: 21614002

Sulfamethoxazole

Sulfamethoxazole

Product: Nimorazole

Identifier : DBSNPE003594
Drug : DB01015 (Sulfamethoxazole)
Interacting Gene/Enzyme : Glucose-6-phosphate 1-dehydrogenase
Gene Name : G6PD
UniProt ID : P11413
Defining Change(s) :

  • 1380G>C

Allele Name : G6PDNice
Genotype(s) : Not Available
Type(s) : ADR Inferred
Groups : G6PD deficiency
Description : Increased risk of dose-related hemolysis.
References :

  1. Bacdivim™[package insert]. Philadelphia, Pennysylvania: Mutual Pharmaceutical Company; 2013. [Link]

PMID: 7654694

Sulfamethoxazole

Sulfamethoxazole

Product: Mirodenafil

Identifier : DBSNPE003595
Drug : DB01015 (Sulfamethoxazole)
Interacting Gene/Enzyme : Glucose-6-phosphate 1-dehydrogenase
Gene Name : G6PD
UniProt ID : P11413
Defining Change(s) :

  • 1387C->T

Allele Name : Kamiube, Keelung
Genotype(s) : Not Available
Type(s) : ADR Inferred
Groups : G6PD deficiency
Description : Increased risk of dose-related hemolysis.
References :

  1. Bacdivim™[package insert]. Philadelphia, Pennysylvania: Mutual Pharmaceutical Company; 2013. [Link]

PMID: 1691947

Sulfamethoxazole

Sulfamethoxazole

Product: Ademetionine

Identifier : DBSNPE003596
Drug : DB01015 (Sulfamethoxazole)
Interacting Gene/Enzyme : Glucose-6-phosphate 1-dehydrogenase
Gene Name : G6PD
UniProt ID : P11413
Defining Change(s) :

  • 1400C->G

Allele Name : Neapolis
Genotype(s) : Not Available
Type(s) : ADR Inferred
Groups : G6PD deficiency
Description : Increased risk of dose-related hemolysis.
References :

  1. Bacdivim™[package insert]. Philadelphia, Pennysylvania: Mutual Pharmaceutical Company; 2013. [Link]

PMID: 1696151

Sulfamethoxazole

Sulfamethoxazole

Product: DUBs-IN-1

Identifier : DBSNPE003597
Drug : DB01015 (Sulfamethoxazole)
Interacting Gene/Enzyme : Glucose-6-phosphate 1-dehydrogenase
Gene Name : G6PD
UniProt ID : P11413
Defining Change(s) :

  • 143T->C

Allele Name : Aures
Genotype(s) : Not Available
Type(s) : ADR Inferred
Groups : G6PD deficiency
Description : Increased risk of dose-related hemolysis.
References :

  1. Bacdivim™[package insert]. Philadelphia, Pennysylvania: Mutual Pharmaceutical Company; 2013. [Link]

PMID: 3479247

Sulfamethoxazole

Sulfamethoxazole

Product: DUBs-IN-2

Identifier : DBSNPE003598
Drug : DB01015 (Sulfamethoxazole)
Interacting Gene/Enzyme : Glucose-6-phosphate 1-dehydrogenase
Gene Name : G6PD
UniProt ID : P11413
Defining Change(s) :

  • 1442C->G

Allele Name : Split
Genotype(s) : Not Available
Type(s) : ADR Inferred
Groups : G6PD deficiency
Description : Increased risk of dose-related hemolysis.
References :

  1. Bacdivim™[package insert]. Philadelphia, Pennysylvania: Mutual Pharmaceutical Company; 2013. [Link]

PMID: 8480540

Sulfamethoxazole

Sulfamethoxazole

Product: DUBs-IN-3

Identifier : DBSNPE003599
Drug : DB01015 (Sulfamethoxazole)
Interacting Gene/Enzyme : Glucose-6-phosphate 1-dehydrogenase
Gene Name : G6PD
UniProt ID : P11413
Defining Change(s) :

  • 148C->T

Allele Name : Kambos
Genotype(s) : Not Available
Type(s) : ADR Inferred
Groups : G6PD deficiency
Description : Increased risk of dose-related hemolysis.
References :

  1. Bacdivim™[package insert]. Philadelphia, Pennysylvania: Mutual Pharmaceutical Company; 2013. [Link]

PMID: 1793063

Sulfamethoxazole

Sulfamethoxazole

Product: Maribavir

Identifier : DBSNPE003600
Drug : DB01015 (Sulfamethoxazole)
Interacting Gene/Enzyme : Glucose-6-phosphate 1-dehydrogenase
Gene Name : G6PD
UniProt ID : P11413
Defining Change(s) :

  • 170G>A

Allele Name : Palesdivina
Genotype(s) : Not Available
Type(s) : ADR Inferred
Groups : G6PD deficiency
Description : Increased risk of dose-related hemolysis.
References :

  1. Bacdivim™[package insert]. Philadelphia, Pennysylvania: Mutual Pharmaceutical Company; 2013. [Link]

PMID: 1847758

Sulfamethoxazole

Sulfamethoxazole

Product: VER-49009

Identifier : DBSNPE003601
Drug : DB01015 (Sulfamethoxazole)
Interacting Gene/Enzyme : Glucose-6-phosphate 1-dehydrogenase
Gene Name : G6PD
UniProt ID : P11413
Defining Change(s) :

  • 172G->A

Allele Name : Metaponto
Genotype(s) : Not Available
Type(s) : ADR Inferred
Groups : G6PD deficiency
Description : Increased risk of dose-related hemolysis.
References :

  1. Bacdivim™[package insert]. Philadelphia, Pennysylvania: Mutual Pharmaceutical Company; 2013. [Link]

PMID: 15967159

Sulfamethoxazole

Sulfamethoxazole

Product: VER-50589

Identifier : DBSNPE003602
Drug : DB01015 (Sulfamethoxazole)
Interacting Gene/Enzyme : Glucose-6-phosphate 1-dehydrogenase
Gene Name : G6PD
UniProt ID : P11413
Defining Change(s) :

  • 185C->T

Allele Name : Musashino
Genotype(s) : Not Available
Type(s) : ADR Inferred
Groups : G6PD deficiency
Description : Increased risk of dose-related hemolysis.
References :

  1. Bacdivim™[package insert]. Philadelphia, Pennysylvania: Mutual Pharmaceutical Company; 2013. [Link]

PMID: 9543090

Sulfamethoxazole

Sulfamethoxazole

Product: Alcaftadine

Identifier : DBSNPE003603
Drug : DB01015 (Sulfamethoxazole)
Interacting Gene/Enzyme : Glucose-6-phosphate 1-dehydrogenase
Gene Name : G6PD
UniProt ID : P11413
Defining Change(s) :

  • 202G->A

Allele Name : Asahi
Genotype(s) : Not Available
Type(s) : ADR Inferred
Groups : G6PD deficiency
Description : Increased risk of dose-related hemolysis.
References :

  1. Bacdivim™[package insert]. Philadelphia, Pennysylvania: Mutual Pharmaceutical Company; 2013. [Link]

PMID: 9105693

Sulfamethoxazole

Sulfamethoxazole

Product: Cefepime (Dihydrochloride Monohydrate)

Identifier : DBSNPE003604
Drug : DB01015 (Sulfamethoxazole)
Interacting Gene/Enzyme : Glucose-6-phosphate 1-dehydrogenase
Gene Name : G6PD
UniProt ID : P11413
Defining Change(s) :

  • 202G->A
  • 376A->G

Allele Name : A- (202), Ferrara I
Genotype(s) : Not Available
Type(s) : ADR Inferred
Groups : G6PD deficiency
Description : Increased risk of dose-related hemolysis.
References :

  1. Bacdivim™[package insert]. Philadelphia, Pennysylvania: Mutual Pharmaceutical Company; 2013. [Link]

PMID: 15289293

Sulfamethoxazole

Sulfamethoxazole

Product: Amrubicin (hydrochloride)

Identifier : DBSNPE003606
Drug : DB01015 (Sulfamethoxazole)
Interacting Gene/Enzyme : Glucose-6-phosphate 1-dehydrogenase
Gene Name : G6PD
UniProt ID : P11413
Defining Change(s) :

  • 241C->T

Allele Name : Ube Konan
Genotype(s) : Not Available
Type(s) : ADR Inferred
Groups : G6PD deficiency
Description : Increased risk of dose-related hemolysis.
References :

  1. Bacdivim™[package insert]. Philadelphia, Pennysylvania: Mutual Pharmaceutical Company; 2013. [Link]

PMID: 12569099

Sulfamethoxazole

Sulfamethoxazole

Product: Amrubicin

Identifier : DBSNPE003607
Drug : DB01015 (Sulfamethoxazole)
Interacting Gene/Enzyme : Glucose-6-phosphate 1-dehydrogenase
Gene Name : G6PD
UniProt ID : P11413
Defining Change(s) :

  • 242G->A

Allele Name : Lagosanto
Genotype(s) : Not Available
Type(s) : ADR Inferred
Groups : G6PD deficiency
Description : Increased risk of dose-related hemolysis.
References :

  1. Bacdivim™[package insert]. Philadelphia, Pennysylvania: Mutual Pharmaceutical Company; 2013. [Link]

PMID: 28591579

Sulfamethoxazole

Sulfamethoxazole

Product: Clevudine

Identifier : DBSNPE003608
Drug : DB01015 (Sulfamethoxazole)
Interacting Gene/Enzyme : Glucose-6-phosphate 1-dehydrogenase
Gene Name : G6PD
UniProt ID : P11413
Defining Change(s) :

  • 274C->T

Allele Name : Guangzhou
Genotype(s) : Not Available
Type(s) : ADR Inferred
Groups : G6PD deficiency
Description : Increased risk of dose-related hemolysis.
References :

  1. Bacdivim™[package insert]. Philadelphia, Pennysylvania: Mutual Pharmaceutical Company; 2013. [Link]

PMID: 2016727

Sulfamethoxazole

Sulfamethoxazole

Product: Amiodarone

Identifier : DBSNPE003609
Drug : DB01015 (Sulfamethoxazole)
Interacting Gene/Enzyme : Glucose-6-phosphate 1-dehydrogenase
Gene Name : G6PD
UniProt ID : P11413
Defining Change(s) :

  • 323T->A

Allele Name : Hammersmith
Genotype(s) : Not Available
Type(s) : ADR Inferred
Groups : G6PD deficiency
Description : Increased risk of dose-related hemolysis.
References :

  1. Bacdivim™[package insert]. Philadelphia, Pennysylvania: Mutual Pharmaceutical Company; 2013. [Link]

PMID: 14570767

Sulfamethoxazole

Sulfamethoxazole

Product: Fasudil

Identifier : DBSNPE003610
Drug : DB01015 (Sulfamethoxazole)
Interacting Gene/Enzyme : Glucose-6-phosphate 1-dehydrogenase
Gene Name : G6PD
UniProt ID : P11413
Defining Change(s) :

  • 34G->T

Allele Name : Sinnai
Genotype(s) : Not Available
Type(s) : ADR Inferred
Groups : G6PD deficiency
Description : Increased risk of dose-related hemolysis.
References :

  1. Bacdivim™[package insert]. Philadelphia, Pennysylvania: Mutual Pharmaceutical Company; 2013. [Link]

PMID: 8081074

Sulfamethoxazole

Sulfamethoxazole

Product: Bilastine

Identifier : DBSNPE003611
Drug : DB01015 (Sulfamethoxazole)
Interacting Gene/Enzyme : Glucose-6-phosphate 1-dehydrogenase
Gene Name : G6PD
UniProt ID : P11413
Defining Change(s) :

  • 376A->G
  • 680G->T

Allele Name : A- (680)
Genotype(s) : Not Available
Type(s) : ADR Inferred
Groups : G6PD deficiency
Description : Increased risk of dose-related hemolysis.
References :

  1. Bacdivim™[package insert]. Philadelphia, Pennysylvania: Mutual Pharmaceutical Company; 2013. [Link]

PMID: 1334748

Sulfamethoxazole

Sulfamethoxazole

Product: Tirofiban

Identifier : DBSNPE003612
Drug : DB01015 (Sulfamethoxazole)
Interacting Gene/Enzyme : Glucose-6-phosphate 1-dehydrogenase
Gene Name : G6PD
UniProt ID : P11413
Defining Change(s) :

  • 376A->G
  • 968T->C

Allele Name : A- (968), Betica,Selma, Guantanamo
Genotype(s) : Not Available
Type(s) : ADR Inferred
Groups : G6PD deficiency
Description : Increased risk of dose-related hemolysis.
References :

  1. Bacdivim™[package insert]. Philadelphia, Pennysylvania: Mutual Pharmaceutical Company; 2013. [Link]

PMID: 24335295

Sulfamethoxazole

Sulfamethoxazole

Product: Chlorhexidine (digluconate)

Identifier : DBSNPE003613
Drug : DB01015 (Sulfamethoxazole)
Interacting Gene/Enzyme : Glucose-6-phosphate 1-dehydrogenase
Gene Name : G6PD
UniProt ID : P11413
Defining Change(s) :

  • 383T>G

Allele Name : Salerno Pyrgos
Genotype(s) : Not Available
Type(s) : ADR Inferred
Groups : G6PD deficiency
Description : Increased risk of dose-related hemolysis.
References :

  1. Bacdivim™[package insert]. Philadelphia, Pennysylvania: Mutual Pharmaceutical Company; 2013. [Link]

PMID: 22688342

Sulfamethoxazole

Sulfamethoxazole

Product: Nitisinone

Identifier : DBSNPE003614
Drug : DB01015 (Sulfamethoxazole)
Interacting Gene/Enzyme : Glucose-6-phosphate 1-dehydrogenase
Gene Name : G6PD
UniProt ID : P11413
Defining Change(s) :

  • 392G->T

Allele Name : Quing Yan
Genotype(s) : Not Available
Type(s) : ADR Inferred
Groups : G6PD deficiency
Description : Increased risk of dose-related hemolysis.
References :

  1. Bacdivim™[package insert]. Philadelphia, Pennysylvania: Mutual Pharmaceutical Company; 2013. [Link]

PMID: 21169551

Sulfamethoxazole

Sulfamethoxazole

Product: Epirubicin

Identifier : DBSNPE003615
Drug : DB01015 (Sulfamethoxazole)
Interacting Gene/Enzyme : Glucose-6-phosphate 1-dehydrogenase
Gene Name : G6PD
UniProt ID : P11413
Defining Change(s) :

  • 40G->A

Allele Name : Lages
Genotype(s) : Not Available
Type(s) : ADR Inferred
Groups : G6PD deficiency
Description : Increased risk of dose-related hemolysis.
References :

  1. Bacdivim™[package insert]. Philadelphia, Pennysylvania: Mutual Pharmaceutical Company; 2013. [Link]

PMID: 16574785

Sulfamethoxazole

Sulfamethoxazole

Product: 4-Aminopyridine

Identifier : DBSNPE003616
Drug : DB01015 (Sulfamethoxazole)
Interacting Gene/Enzyme : Glucose-6-phosphate 1-dehydrogenase
Gene Name : G6PD
UniProt ID : P11413
Defining Change(s) :

  • 466G->A

Allele Name : Ilesha
Genotype(s) : Not Available
Type(s) : ADR Inferred
Groups : G6PD deficiency
Description : Increased risk of dose-related hemolysis.
References :

  1. Bacdivim™[package insert]. Philadelphia, Pennysylvania: Mutual Pharmaceutical Company; 2013. [Link]

PMID: 16006512

Sulfamethoxazole

Sulfamethoxazole

Product: Tafamidis

Identifier : DBSNPE003617
Drug : DB01015 (Sulfamethoxazole)
Interacting Gene/Enzyme : Glucose-6-phosphate 1-dehydrogenase
Gene Name : G6PD
UniProt ID : P11413
Defining Change(s) :

  • 487G->A

Allele Name : Mahidol
Genotype(s) : Not Available
Type(s) : ADR Inferred
Groups : G6PD deficiency
Description : Increased risk of dose-related hemolysis.
References :

  1. Bacdivim™[package insert]. Philadelphia, Pennysylvania: Mutual Pharmaceutical Company; 2013. [Link]

PMID: 9653548

Sulfamethoxazole

Sulfamethoxazole

Product: (R)-Lansoprazole

Identifier : DBSNPE003618
Drug : DB01015 (Sulfamethoxazole)
Interacting Gene/Enzyme : Glucose-6-phosphate 1-dehydrogenase
Gene Name : G6PD
UniProt ID : P11413
Defining Change(s) :

  • 542A->T

Allele Name : Malaga
Genotype(s) : Not Available
Type(s) : ADR Inferred
Groups : G6PD deficiency
Description : Increased risk of dose-related hemolysis.
References :

  1. Bacdivim™[package insert]. Philadelphia, Pennysylvania: Mutual Pharmaceutical Company; 2013. [Link]

PMID: 18055761

Sulfamethoxazole

Sulfamethoxazole

Product: Acetaminophen

Identifier : DBSNPE003619
Drug : DB01015 (Sulfamethoxazole)
Interacting Gene/Enzyme : Glucose-6-phosphate 1-dehydrogenase
Gene Name : G6PD
UniProt ID : P11413
Defining Change(s) :

  • 634A->G

Allele Name : Sibari
Genotype(s) : Not Available
Type(s) : ADR Inferred
Groups : G6PD deficiency
Description : Increased risk of dose-related hemolysis.
References :

  1. Bacdivim™[package insert]. Philadelphia, Pennysylvania: Mutual Pharmaceutical Company; 2013. [Link]

PMID: 23166964

Sulfamethoxazole

Sulfamethoxazole

Product: Desvenlafaxine

Identifier : DBSNPE003621
Drug : DB01015 (Sulfamethoxazole)
Interacting Gene/Enzyme : Glucose-6-phosphate 1-dehydrogenase
Gene Name : G6PD
UniProt ID : P11413
Defining Change(s) :

  • 703C->T

Allele Name : Nanning
Genotype(s) : Not Available
Type(s) : ADR Inferred
Groups : G6PD deficiency
Description : Increased risk of dose-related hemolysis.
References :

  1. Bacdivim™[package insert]. Philadelphia, Pennysylvania: Mutual Pharmaceutical Company; 2013. [Link]

PMID: 18334597

Sulfamethoxazole

Sulfamethoxazole

Product: Tafluprost

Identifier : DBSNPE003622
Drug : DB01015 (Sulfamethoxazole)
Interacting Gene/Enzyme : Glucose-6-phosphate 1-dehydrogenase
Gene Name : G6PD
UniProt ID : P11413
Defining Change(s) :

  • 844G->C

Allele Name : Seattle, Lodi, Modena, Ferrara II, Athens-like
Genotype(s) : Not Available
Type(s) : ADR Inferred
Groups : G6PD deficiency
Description : Increased risk of dose-related hemolysis.
References :

  1. Bacdivim™[package insert]. Philadelphia, Pennysylvania: Mutual Pharmaceutical Company; 2013. [Link]

PMID: 18374567

Sulfamethoxazole

Sulfamethoxazole

Product: Camostat (mesylate)

Identifier : DBSNPE003623
Drug : DB01015 (Sulfamethoxazole)
Interacting Gene/Enzyme : Glucose-6-phosphate 1-dehydrogenase
Gene Name : G6PD
UniProt ID : P11413
Defining Change(s) :

  • 844G->T

Allele Name : Bajo Maumere
Genotype(s) : Not Available
Type(s) : ADR Inferred
Groups : G6PD deficiency
Description : Increased risk of dose-related hemolysis.
References :

  1. Bacdivim™[package insert]. Philadelphia, Pennysylvania: Mutual Pharmaceutical Company; 2013. [Link]

PMID: 15602004

Sulfamethoxazole

Sulfamethoxazole

Product: Salmeterol

Identifier : DBSNPE003624
Drug : DB01015 (Sulfamethoxazole)
Interacting Gene/Enzyme : Glucose-6-phosphate 1-dehydrogenase
Gene Name : G6PD
UniProt ID : P11413
Defining Change(s) :

  • 854G->A

Allele Name : Montalbano
Genotype(s) : Not Available
Type(s) : ADR Inferred
Groups : G6PD deficiency
Description : Increased risk of dose-related hemolysis.
References :

  1. Bacdivim™[package insert]. Philadelphia, Pennysylvania: Mutual Pharmaceutical Company; 2013. [Link]

PMID: 16250653

Sulfamethoxazole

Sulfamethoxazole

Product: Taltirelin

Identifier : DBSNPE003625
Drug : DB01015 (Sulfamethoxazole)
Interacting Gene/Enzyme : Glucose-6-phosphate 1-dehydrogenase
Gene Name : G6PD
UniProt ID : P11413
Defining Change(s) :

  • 949G->A

Allele Name : Kalyan-Kerala, Jamnaga, Rohini
Genotype(s) : Not Available
Type(s) : ADR Inferred
Groups : G6PD deficiency
Description : Increased risk of dose-related hemolysis.
References :

  1. Bacdivim™[package insert]. Philadelphia, Pennysylvania: Mutual Pharmaceutical Company; 2013. [Link]

PMID: 18202020

Sulfamethoxazole

Sulfamethoxazole

Product: Ramosetron (Hydrochloride)

Identifier : DBSNPE003626
Drug : DB01015 (Sulfamethoxazole)
Interacting Gene/Enzyme : Glucose-6-phosphate 1-dehydrogenase
Gene Name : G6PD
UniProt ID : P11413
Defining Change(s) :

  • 95A->G

Allele Name : Gaohe
Genotype(s) : Not Available
Type(s) : ADR Inferred
Groups : G6PD deficiency
Description : Increased risk of dose-related hemolysis.
References :

  1. Bacdivim™[package insert]. Philadelphia, Pennysylvania: Mutual Pharmaceutical Company; 2013. [Link]

PMID: 17671214

By