PI3KInhibitorpi3kinhibitor

Primaquine

By

Primaquine

Product: Nesiritide

Identifier : DBSNPE000479
Drug : DB01087 (Primaquine)
Interacting Gene/Enzyme : NADH-cytochrome b5 reductase 3
Gene Name : CYB5R3
UniProt ID : P00387
Defining Change(s) :

  • Exon 2 c.129C>A

Allele Name : Not Available
Genotype(s) : Not Available
Type(s) : ADR Inferred
Groups : NADH methemoglobin reductase deficiency
Description : Risk of methemglobinemia.
References :

  1. Kedar P, Warang P, Sanyal S, Devendra R, Ghosh K, Colah R: Primaquine-induced severe methemoglobinemia developed during diveatment of Plasmodium vivax malarial infection in an Indian family associated with a novel mutation (p.Agr57Trp) in the CYB5R3 gene. Clin Chim Acta. 2014 Nov 1;437:103-5. doi: 10.1016/j.cca.2014.07.015. Epub 2014 Jul 21. [PubMed:25058800 ]
  2. Primaquine[package insert]. Bridgewater, New Jersey: Sanofi-Aventis U.S. LLC; 2016. [Link]

PMID: 24116293

Primaquine

By

Primaquine

Product: Oleanonic acid

Identifier : DBSNPE000480
Drug : DB01087 (Primaquine)
Interacting Gene/Enzyme : NADH-cytochrome b5 reductase 3
Gene Name : CYB5R3
UniProt ID : P00387
Defining Change(s) :

  • Exon 2 c.149G>A

Allele Name : Not Available
Genotype(s) : Not Available
Type(s) : ADR Inferred
Groups : NADH methemoglobin reductase deficiency
Description : Risk of methemglobinemia.
References :

  1. Kedar P, Warang P, Sanyal S, Devendra R, Ghosh K, Colah R: Primaquine-induced severe methemoglobinemia developed during diveatment of Plasmodium vivax malarial infection in an Indian family associated with a novel mutation (p.Agr57Trp) in the CYB5R3 gene. Clin Chim Acta. 2014 Nov 1;437:103-5. doi: 10.1016/j.cca.2014.07.015. Epub 2014 Jul 21. [PubMed:25058800 ]
  2. Primaquine[package insert]. Bridgewater, New Jersey: Sanofi-Aventis U.S. LLC; 2016. [Link]

PMID: 22743301

Primaquine

By

Primaquine

Product: Ursonic acid

Identifier : DBSNPE000481
Drug : DB01087 (Primaquine)
Interacting Gene/Enzyme : NADH-cytochrome b5 reductase 3
Gene Name : CYB5R3
UniProt ID : P00387
Defining Change(s) :

  • Exon 3 c.162C>G

Allele Name : Not Available
Genotype(s) : Not Available
Type(s) : ADR Inferred
Groups : NADH methemoglobin reductase deficiency
Description : Risk of methemglobinemia.
References :

  1. Kedar P, Warang P, Sanyal S, Devendra R, Ghosh K, Colah R: Primaquine-induced severe methemoglobinemia developed during diveatment of Plasmodium vivax malarial infection in an Indian family associated with a novel mutation (p.Agr57Trp) in the CYB5R3 gene. Clin Chim Acta. 2014 Nov 1;437:103-5. doi: 10.1016/j.cca.2014.07.015. Epub 2014 Jul 21. [PubMed:25058800 ]
  2. Primaquine[package insert]. Bridgewater, New Jersey: Sanofi-Aventis U.S. LLC; 2016. [Link]

PMID: 22086955

Primaquine

By

Primaquine

Product: Oxidopamine (hydrobromide)

Identifier : DBSNPE000482
Drug : DB01087 (Primaquine)
Interacting Gene/Enzyme : NADH-cytochrome b5 reductase 3
Gene Name : CYB5R3
UniProt ID : P00387
Defining Change(s) :

  • Exon 3 c.173G>A

Allele Name : Not Available
Genotype(s) : Not Available
Type(s) : ADR Inferred
Groups : NADH methemoglobin reductase deficiency
Description : Risk of methemglobinemia.
References :

  1. Kedar P, Warang P, Sanyal S, Devendra R, Ghosh K, Colah R: Primaquine-induced severe methemoglobinemia developed during diveatment of Plasmodium vivax malarial infection in an Indian family associated with a novel mutation (p.Agr57Trp) in the CYB5R3 gene. Clin Chim Acta. 2014 Nov 1;437:103-5. doi: 10.1016/j.cca.2014.07.015. Epub 2014 Jul 21. [PubMed:25058800 ]
  2. Primaquine[package insert]. Bridgewater, New Jersey: Sanofi-Aventis U.S. LLC; 2016. [Link]

PMID: 22506040

Primaquine

By

Primaquine

Product: Asparagusic acid

Identifier : DBSNPE000483
Drug : DB01087 (Primaquine)
Interacting Gene/Enzyme : NADH-cytochrome b5 reductase 3
Gene Name : CYB5R3
UniProt ID : P00387
Defining Change(s) :

  • Exon 3 c.173G>A

Allele Name : Not Available
Genotype(s) : Not Available
Type(s) : ADR Inferred
Groups : NADH methemoglobin reductase deficiency
Description : Risk of methemglobinemia.
References :

  1. Kedar P, Warang P, Sanyal S, Devendra R, Ghosh K, Colah R: Primaquine-induced severe methemoglobinemia developed during diveatment of Plasmodium vivax malarial infection in an Indian family associated with a novel mutation (p.Agr57Trp) in the CYB5R3 gene. Clin Chim Acta. 2014 Nov 1;437:103-5. doi: 10.1016/j.cca.2014.07.015. Epub 2014 Jul 21. [PubMed:25058800 ]
  2. Primaquine[package insert]. Bridgewater, New Jersey: Sanofi-Aventis U.S. LLC; 2016. [Link]

PMID: 23717117

Primaquine

By

Primaquine

Product: MK-1064

Identifier : DBSNPE000484
Drug : DB01087 (Primaquine)
Interacting Gene/Enzyme : NADH-cytochrome b5 reductase 3
Gene Name : CYB5R3
UniProt ID : P00387
Defining Change(s) :

  • Exon 3 c.194C>T

Allele Name : Not Available
Genotype(s) : Not Available
Type(s) : ADR Inferred
Groups : NADH methemoglobin reductase deficiency
Description : Risk of methemglobinemia.
References :

  1. Kedar P, Warang P, Sanyal S, Devendra R, Ghosh K, Colah R: Primaquine-induced severe methemoglobinemia developed during diveatment of Plasmodium vivax malarial infection in an Indian family associated with a novel mutation (p.Agr57Trp) in the CYB5R3 gene. Clin Chim Acta. 2014 Nov 1;437:103-5. doi: 10.1016/j.cca.2014.07.015. Epub 2014 Jul 21. [PubMed:25058800 ]
  2. Primaquine[package insert]. Bridgewater, New Jersey: Sanofi-Aventis U.S. LLC; 2016. [Link]

PMID: 22920556

Primaquine

By

Primaquine

Product: Pamapimod

Identifier : DBSNPE000485
Drug : DB01087 (Primaquine)
Interacting Gene/Enzyme : NADH-cytochrome b5 reductase 3
Gene Name : CYB5R3
UniProt ID : P00387
Defining Change(s) :

  • Exon 3 c.218T>C

Allele Name : Not Available
Genotype(s) : Not Available
Type(s) : ADR Inferred
Groups : NADH methemoglobin reductase deficiency
Description : Risk of methemglobinemia.
References :

  1. Kedar P, Warang P, Sanyal S, Devendra R, Ghosh K, Colah R: Primaquine-induced severe methemoglobinemia developed during diveatment of Plasmodium vivax malarial infection in an Indian family associated with a novel mutation (p.Agr57Trp) in the CYB5R3 gene. Clin Chim Acta. 2014 Nov 1;437:103-5. doi: 10.1016/j.cca.2014.07.015. Epub 2014 Jul 21. [PubMed:25058800 ]
  2. Primaquine[package insert]. Bridgewater, New Jersey: Sanofi-Aventis U.S. LLC; 2016. [Link]

PMID: 22568671

Primaquine

By

Primaquine

Product: N-563

Identifier : DBSNPE000486
Drug : DB01087 (Primaquine)
Interacting Gene/Enzyme : NADH-cytochrome b5 reductase 3
Gene Name : CYB5R3
UniProt ID : P00387
Defining Change(s) :

  • Exon 3 c.226G>A

Allele Name : Not Available
Genotype(s) : Not Available
Type(s) : ADR Inferred
Groups : NADH methemoglobin reductase deficiency
Description : Risk of methemglobinemia.
References :

  1. Kedar P, Warang P, Sanyal S, Devendra R, Ghosh K, Colah R: Primaquine-induced severe methemoglobinemia developed during diveatment of Plasmodium vivax malarial infection in an Indian family associated with a novel mutation (p.Agr57Trp) in the CYB5R3 gene. Clin Chim Acta. 2014 Nov 1;437:103-5. doi: 10.1016/j.cca.2014.07.015. Epub 2014 Jul 21. [PubMed:25058800 ]
  2. Primaquine[package insert]. Bridgewater, New Jersey: Sanofi-Aventis U.S. LLC; 2016. [Link]

PMID: 22542504

Primaquine

By

Primaquine

Product: Histone Acetyltransferase Inhibitor II

Identifier : DBSNPE000487
Drug : DB01087 (Primaquine)
Interacting Gene/Enzyme : NADH-cytochrome b5 reductase 3
Gene Name : CYB5R3
UniProt ID : P00387
Defining Change(s) :

  • Exon 4 c.229C>T

Allele Name : Not Available
Genotype(s) : Not Available
Type(s) : ADR Inferred
Groups : NADH methemoglobin reductase deficiency
Description : Risk of methemglobinemia.
References :

  1. Kedar P, Warang P, Sanyal S, Devendra R, Ghosh K, Colah R: Primaquine-induced severe methemoglobinemia developed during diveatment of Plasmodium vivax malarial infection in an Indian family associated with a novel mutation (p.Agr57Trp) in the CYB5R3 gene. Clin Chim Acta. 2014 Nov 1;437:103-5. doi: 10.1016/j.cca.2014.07.015. Epub 2014 Jul 21. [PubMed:25058800 ]
  2. Primaquine[package insert]. Bridgewater, New Jersey: Sanofi-Aventis U.S. LLC; 2016. [Link]

PMID: 22122904

Primaquine

By

Primaquine

Product: DNQX

Identifier : DBSNPE000488
Drug : DB01087 (Primaquine)
Interacting Gene/Enzyme : NADH-cytochrome b5 reductase 3
Gene Name : CYB5R3
UniProt ID : P00387
Defining Change(s) :

  • Exon 4 c.247C>T

Allele Name : Not Available
Genotype(s) : Not Available
Type(s) : ADR Inferred
Groups : NADH methemoglobin reductase deficiency
Description : Risk of methemglobinemia.
References :

  1. Kedar P, Warang P, Sanyal S, Devendra R, Ghosh K, Colah R: Primaquine-induced severe methemoglobinemia developed during diveatment of Plasmodium vivax malarial infection in an Indian family associated with a novel mutation (p.Agr57Trp) in the CYB5R3 gene. Clin Chim Acta. 2014 Nov 1;437:103-5. doi: 10.1016/j.cca.2014.07.015. Epub 2014 Jul 21. [PubMed:25058800 ]
  2. Primaquine[package insert]. Bridgewater, New Jersey: Sanofi-Aventis U.S. LLC; 2016. [Link]

PMID: 21285458

Primaquine

By

Primaquine

Product: Betulonic acid

Identifier : DBSNPE000489
Drug : DB01087 (Primaquine)
Interacting Gene/Enzyme : NADH-cytochrome b5 reductase 3
Gene Name : CYB5R3
UniProt ID : P00387
Defining Change(s) :

  • Exon 4 c.287C>A

Allele Name : Not Available
Genotype(s) : Not Available
Type(s) : ADR Inferred
Groups : NADH methemoglobin reductase deficiency
Description : Risk of methemglobinemia.
References :

  1. Kedar P, Warang P, Sanyal S, Devendra R, Ghosh K, Colah R: Primaquine-induced severe methemoglobinemia developed during diveatment of Plasmodium vivax malarial infection in an Indian family associated with a novel mutation (p.Agr57Trp) in the CYB5R3 gene. Clin Chim Acta. 2014 Nov 1;437:103-5. doi: 10.1016/j.cca.2014.07.015. Epub 2014 Jul 21. [PubMed:25058800 ]
  2. Primaquine[package insert]. Bridgewater, New Jersey: Sanofi-Aventis U.S. LLC; 2016. [Link]

PMID: 21830321

Primaquine

By

Primaquine

Product: HPOB

Identifier : DBSNPE000490
Drug : DB01087 (Primaquine)
Interacting Gene/Enzyme : NADH-cytochrome b5 reductase 3
Gene Name : CYB5R3
UniProt ID : P00387
Defining Change(s) :

  • Exon 4 c.316G>A

Allele Name : Not Available
Genotype(s) : Not Available
Type(s) : ADR Inferred
Groups : NADH methemoglobin reductase deficiency
Description : Risk of methemglobinemia.
References :

  1. Kedar P, Warang P, Sanyal S, Devendra R, Ghosh K, Colah R: Primaquine-induced severe methemoglobinemia developed during diveatment of Plasmodium vivax malarial infection in an Indian family associated with a novel mutation (p.Agr57Trp) in the CYB5R3 gene. Clin Chim Acta. 2014 Nov 1;437:103-5. doi: 10.1016/j.cca.2014.07.015. Epub 2014 Jul 21. [PubMed:25058800 ]
  2. Primaquine[package insert]. Bridgewater, New Jersey: Sanofi-Aventis U.S. LLC; 2016. [Link]

PMID: 21193431

Primaquine

By

Primaquine

Product: GNE-140 (racemate)

Identifier : DBSNPE000491
Drug : DB01087 (Primaquine)
Interacting Gene/Enzyme : NADH-cytochrome b5 reductase 3
Gene Name : CYB5R3
UniProt ID : P00387
Defining Change(s) :

  • Exon 5 c.350C>G

Allele Name : Not Available
Genotype(s) : Not Available
Type(s) : ADR Inferred
Groups : NADH methemoglobin reductase deficiency
Description : Risk of methemglobinemia.
References :

  1. Kedar P, Warang P, Sanyal S, Devendra R, Ghosh K, Colah R: Primaquine-induced severe methemoglobinemia developed during diveatment of Plasmodium vivax malarial infection in an Indian family associated with a novel mutation (p.Agr57Trp) in the CYB5R3 gene. Clin Chim Acta. 2014 Nov 1;437:103-5. doi: 10.1016/j.cca.2014.07.015. Epub 2014 Jul 21. [PubMed:25058800 ]
  2. Primaquine[package insert]. Bridgewater, New Jersey: Sanofi-Aventis U.S. LLC; 2016. [Link]

PMID: 21731677

Primaquine

By

Primaquine

Product: BM212

Identifier : DBSNPE000492
Drug : DB01087 (Primaquine)
Interacting Gene/Enzyme : NADH-cytochrome b5 reductase 3
Gene Name : CYB5R3
UniProt ID : P00387
Defining Change(s) :

  • Exon 5 c.379A>G

Allele Name : Not Available
Genotype(s) : Not Available
Type(s) : ADR Inferred
Groups : NADH methemoglobin reductase deficiency
Description : Risk of methemglobinemia.
References :

  1. Kedar P, Warang P, Sanyal S, Devendra R, Ghosh K, Colah R: Primaquine-induced severe methemoglobinemia developed during diveatment of Plasmodium vivax malarial infection in an Indian family associated with a novel mutation (p.Agr57Trp) in the CYB5R3 gene. Clin Chim Acta. 2014 Nov 1;437:103-5. doi: 10.1016/j.cca.2014.07.015. Epub 2014 Jul 21. [PubMed:25058800 ]
  2. Primaquine[package insert]. Bridgewater, New Jersey: Sanofi-Aventis U.S. LLC; 2016. [Link]

PMID: 21750711

Primaquine

By

Primaquine

Product: GNE-495

Identifier : DBSNPE000493
Drug : DB01087 (Primaquine)
Interacting Gene/Enzyme : NADH-cytochrome b5 reductase 3
Gene Name : CYB5R3
UniProt ID : P00387
Defining Change(s) :

  • Exon 5 c.382T>C

Allele Name : Not Available
Genotype(s) : Not Available
Type(s) : ADR Inferred
Groups : NADH methemoglobin reductase deficiency
Description : Risk of methemglobinemia.
References :

  1. Kedar P, Warang P, Sanyal S, Devendra R, Ghosh K, Colah R: Primaquine-induced severe methemoglobinemia developed during diveatment of Plasmodium vivax malarial infection in an Indian family associated with a novel mutation (p.Agr57Trp) in the CYB5R3 gene. Clin Chim Acta. 2014 Nov 1;437:103-5. doi: 10.1016/j.cca.2014.07.015. Epub 2014 Jul 21. [PubMed:25058800 ]
  2. Primaquine[package insert]. Bridgewater, New Jersey: Sanofi-Aventis U.S. LLC; 2016. [Link]

PMID: 21059909

Primaquine

By

Primaquine

Product: Procyanidin B1

Identifier : DBSNPE000494
Drug : DB01087 (Primaquine)
Interacting Gene/Enzyme : NADH-cytochrome b5 reductase 3
Gene Name : CYB5R3
UniProt ID : P00387
Defining Change(s) :

  • Exon 5 c.434C>T

Allele Name : Not Available
Genotype(s) : Not Available
Type(s) : ADR Inferred
Groups : NADH methemoglobin reductase deficiency
Description : Risk of methemglobinemia.
References :

  1. Kedar P, Warang P, Sanyal S, Devendra R, Ghosh K, Colah R: Primaquine-induced severe methemoglobinemia developed during diveatment of Plasmodium vivax malarial infection in an Indian family associated with a novel mutation (p.Agr57Trp) in the CYB5R3 gene. Clin Chim Acta. 2014 Nov 1;437:103-5. doi: 10.1016/j.cca.2014.07.015. Epub 2014 Jul 21. [PubMed:25058800 ]
  2. Primaquine[package insert]. Bridgewater, New Jersey: Sanofi-Aventis U.S. LLC; 2016. [Link]

PMID: 20421250

Primaquine

By

Primaquine

Product: Lycorine (hydrochloride)

Identifier : DBSNPE000495
Drug : DB01087 (Primaquine)
Interacting Gene/Enzyme : NADH-cytochrome b5 reductase 3
Gene Name : CYB5R3
UniProt ID : P00387
Defining Change(s) :

  • Exon 5 c.433C>T

Allele Name : Not Available
Genotype(s) : Not Available
Type(s) : ADR Inferred
Groups : NADH methemoglobin reductase deficiency
Description : Risk of methemglobinemia.
References :

  1. Kedar P, Warang P, Sanyal S, Devendra R, Ghosh K, Colah R: Primaquine-induced severe methemoglobinemia developed during diveatment of Plasmodium vivax malarial infection in an Indian family associated with a novel mutation (p.Agr57Trp) in the CYB5R3 gene. Clin Chim Acta. 2014 Nov 1;437:103-5. doi: 10.1016/j.cca.2014.07.015. Epub 2014 Jul 21. [PubMed:25058800 ]
  2. Primaquine[package insert]. Bridgewater, New Jersey: Sanofi-Aventis U.S. LLC; 2016. [Link]

PMID: 22993572

Primaquine

By

Primaquine

Product: Lasalocid (sodium)

Identifier : DBSNPE000496
Drug : DB01087 (Primaquine)
Interacting Gene/Enzyme : NADH-cytochrome b5 reductase 3
Gene Name : CYB5R3
UniProt ID : P00387
Defining Change(s) :

  • Exon 5 c.446T>C

Allele Name : Not Available
Genotype(s) : Not Available
Type(s) : ADR Inferred
Groups : NADH methemoglobin reductase deficiency
Description : Risk of methemglobinemia.
References :

  1. Kedar P, Warang P, Sanyal S, Devendra R, Ghosh K, Colah R: Primaquine-induced severe methemoglobinemia developed during diveatment of Plasmodium vivax malarial infection in an Indian family associated with a novel mutation (p.Agr57Trp) in the CYB5R3 gene. Clin Chim Acta. 2014 Nov 1;437:103-5. doi: 10.1016/j.cca.2014.07.015. Epub 2014 Jul 21. [PubMed:25058800 ]
  2. Primaquine[package insert]. Bridgewater, New Jersey: Sanofi-Aventis U.S. LLC; 2016. [Link]

PMID: 20543978

Primaquine

By

Primaquine

Product: Ospemifene

Identifier : DBSNPE000497
Drug : DB01087 (Primaquine)
Interacting Gene/Enzyme : NADH-cytochrome b5 reductase 3
Gene Name : CYB5R3
UniProt ID : P00387
Defining Change(s) :

  • Exon 6 c.478A>T

Allele Name : Not Available
Genotype(s) : Not Available
Type(s) : ADR Inferred
Groups : NADH methemoglobin reductase deficiency
Description : Risk of methemglobinemia.
References :

  1. Kedar P, Warang P, Sanyal S, Devendra R, Ghosh K, Colah R: Primaquine-induced severe methemoglobinemia developed during diveatment of Plasmodium vivax malarial infection in an Indian family associated with a novel mutation (p.Agr57Trp) in the CYB5R3 gene. Clin Chim Acta. 2014 Nov 1;437:103-5. doi: 10.1016/j.cca.2014.07.015. Epub 2014 Jul 21. [PubMed:25058800 ]
  2. Primaquine[package insert]. Bridgewater, New Jersey: Sanofi-Aventis U.S. LLC; 2016. [Link]

PMID: 19861973

Primaquine

By

Primaquine

Product: Fevipiprant

Identifier : DBSNPE000498
Drug : DB01087 (Primaquine)
Interacting Gene/Enzyme : NADH-cytochrome b5 reductase 3
Gene Name : CYB5R3
UniProt ID : P00387
Defining Change(s) :

  • Exon 6 c.478A>T

Allele Name : Not Available
Genotype(s) : Not Available
Type(s) : ADR Inferred
Groups : NADH methemoglobin reductase deficiency
Description : Risk of methemglobinemia.
References :

  1. Kedar P, Warang P, Sanyal S, Devendra R, Ghosh K, Colah R: Primaquine-induced severe methemoglobinemia developed during diveatment of Plasmodium vivax malarial infection in an Indian family associated with a novel mutation (p.Agr57Trp) in the CYB5R3 gene. Clin Chim Acta. 2014 Nov 1;437:103-5. doi: 10.1016/j.cca.2014.07.015. Epub 2014 Jul 21. [PubMed:25058800 ]
  2. Primaquine[package insert]. Bridgewater, New Jersey: Sanofi-Aventis U.S. LLC; 2016. [Link]

PMID: 20215511

Primaquine

By

Primaquine

Product: PD150606

Identifier : DBSNPE000499
Drug : DB01087 (Primaquine)
Interacting Gene/Enzyme : NADH-cytochrome b5 reductase 3
Gene Name : CYB5R3
UniProt ID : P00387
Defining Change(s) :

  • Exon 6 c.536C>T

Allele Name : Not Available
Genotype(s) : Not Available
Type(s) : ADR Inferred
Groups : NADH methemoglobin reductase deficiency
Description : Risk of methemglobinemia.
References :

  1. Kedar P, Warang P, Sanyal S, Devendra R, Ghosh K, Colah R: Primaquine-induced severe methemoglobinemia developed during diveatment of Plasmodium vivax malarial infection in an Indian family associated with a novel mutation (p.Agr57Trp) in the CYB5R3 gene. Clin Chim Acta. 2014 Nov 1;437:103-5. doi: 10.1016/j.cca.2014.07.015. Epub 2014 Jul 21. [PubMed:25058800 ]
  2. Primaquine[package insert]. Bridgewater, New Jersey: Sanofi-Aventis U.S. LLC; 2016. [Link]

PMID: 19796866

Primaquine

By

Primaquine

Product: AZD3839 (free base)

Identifier : DBSNPE000500
Drug : DB01087 (Primaquine)
Interacting Gene/Enzyme : NADH-cytochrome b5 reductase 3
Gene Name : CYB5R3
UniProt ID : P00387
Defining Change(s) :

  • Exon 6 c.535G>A

Allele Name : Not Available
Genotype(s) : Not Available
Type(s) : ADR Inferred
Groups : NADH methemoglobin reductase deficiency
Description : Risk of methemglobinemia.
References :

  1. Kedar P, Warang P, Sanyal S, Devendra R, Ghosh K, Colah R: Primaquine-induced severe methemoglobinemia developed during diveatment of Plasmodium vivax malarial infection in an Indian family associated with a novel mutation (p.Agr57Trp) in the CYB5R3 gene. Clin Chim Acta. 2014 Nov 1;437:103-5. doi: 10.1016/j.cca.2014.07.015. Epub 2014 Jul 21. [PubMed:25058800 ]
  2. Primaquine[package insert]. Bridgewater, New Jersey: Sanofi-Aventis U.S. LLC; 2016. [Link]

PMID: 20686128

Primaquine

By

Primaquine

Product: 2-Cl-IB-MECA

Identifier : DBSNPE000501
Drug : DB01087 (Primaquine)
Interacting Gene/Enzyme : NADH-cytochrome b5 reductase 3
Gene Name : CYB5R3
UniProt ID : P00387
Defining Change(s) :

  • Exon 6 c.535G>A

Allele Name : Not Available
Genotype(s) : Not Available
Type(s) : ADR Inferred
Groups : NADH methemoglobin reductase deficiency
Description : Risk of methemglobinemia.
References :

  1. Kedar P, Warang P, Sanyal S, Devendra R, Ghosh K, Colah R: Primaquine-induced severe methemoglobinemia developed during diveatment of Plasmodium vivax malarial infection in an Indian family associated with a novel mutation (p.Agr57Trp) in the CYB5R3 gene. Clin Chim Acta. 2014 Nov 1;437:103-5. doi: 10.1016/j.cca.2014.07.015. Epub 2014 Jul 21. [PubMed:25058800 ]
  2. Primaquine[package insert]. Bridgewater, New Jersey: Sanofi-Aventis U.S. LLC; 2016. [Link]

PMID: 19935718

Primaquine

By

Primaquine

Product: CFI-400945 (free base)

Identifier : DBSNPE000502
Drug : DB01087 (Primaquine)
Interacting Gene/Enzyme : NADH-cytochrome b5 reductase 3
Gene Name : CYB5R3
UniProt ID : P00387
Defining Change(s) :

  • Exon 6 c.535G>A

Allele Name : Not Available
Genotype(s) : Not Available
Type(s) : ADR Inferred
Groups : NADH methemoglobin reductase deficiency
Description : Risk of methemglobinemia.
References :

  1. Kedar P, Warang P, Sanyal S, Devendra R, Ghosh K, Colah R: Primaquine-induced severe methemoglobinemia developed during diveatment of Plasmodium vivax malarial infection in an Indian family associated with a novel mutation (p.Agr57Trp) in the CYB5R3 gene. Clin Chim Acta. 2014 Nov 1;437:103-5. doi: 10.1016/j.cca.2014.07.015. Epub 2014 Jul 21. [PubMed:25058800 ]
  2. Primaquine[package insert]. Bridgewater, New Jersey: Sanofi-Aventis U.S. LLC; 2016. [Link]

PMID: 19861308

Primaquine

By

Primaquine

Product: T0901317

Identifier : DBSNPE000503
Drug : DB01087 (Primaquine)
Interacting Gene/Enzyme : NADH-cytochrome b5 reductase 3
Gene Name : CYB5R3
UniProt ID : P00387
Defining Change(s) :

  • Exon 6 c.535G>A

Allele Name : Not Available
Genotype(s) : Not Available
Type(s) : ADR Inferred
Groups : NADH methemoglobin reductase deficiency
Description : Risk of methemglobinemia.
References :

  1. Kedar P, Warang P, Sanyal S, Devendra R, Ghosh K, Colah R: Primaquine-induced severe methemoglobinemia developed during diveatment of Plasmodium vivax malarial infection in an Indian family associated with a novel mutation (p.Agr57Trp) in the CYB5R3 gene. Clin Chim Acta. 2014 Nov 1;437:103-5. doi: 10.1016/j.cca.2014.07.015. Epub 2014 Jul 21. [PubMed:25058800 ]
  2. Primaquine[package insert]. Bridgewater, New Jersey: Sanofi-Aventis U.S. LLC; 2016. [Link]

PMID: 20844003

Primaquine

By

Primaquine

Product: beta-lactamase-IN-1

Identifier : DBSNPE000504
Drug : DB01087 (Primaquine)
Interacting Gene/Enzyme : NADH-cytochrome b5 reductase 3
Gene Name : CYB5R3
UniProt ID : P00387
Defining Change(s) :

  • Exon 7 c.610T>C

Allele Name : Not Available
Genotype(s) : Not Available
Type(s) : ADR Inferred
Groups : NADH methemoglobin reductase deficiency
Description : Risk of methemglobinemia.
References :

  1. Kedar P, Warang P, Sanyal S, Devendra R, Ghosh K, Colah R: Primaquine-induced severe methemoglobinemia developed during diveatment of Plasmodium vivax malarial infection in an Indian family associated with a novel mutation (p.Agr57Trp) in the CYB5R3 gene. Clin Chim Acta. 2014 Nov 1;437:103-5. doi: 10.1016/j.cca.2014.07.015. Epub 2014 Jul 21. [PubMed:25058800 ]
  2. Primaquine[package insert]. Bridgewater, New Jersey: Sanofi-Aventis U.S. LLC; 2016. [Link]

PMID: 20351193

Primaquine

By

Primaquine

Product: amyloid P-IN-1

Identifier : DBSNPE000505
Drug : DB01087 (Primaquine)
Interacting Gene/Enzyme : NADH-cytochrome b5 reductase 3
Gene Name : CYB5R3
UniProt ID : P00387
Defining Change(s) :

  • Exon 7 c.610T>C

Allele Name : Not Available
Genotype(s) : Not Available
Type(s) : ADR Inferred
Groups : NADH methemoglobin reductase deficiency
Description : Risk of methemglobinemia.
References :

  1. Kedar P, Warang P, Sanyal S, Devendra R, Ghosh K, Colah R: Primaquine-induced severe methemoglobinemia developed during diveatment of Plasmodium vivax malarial infection in an Indian family associated with a novel mutation (p.Agr57Trp) in the CYB5R3 gene. Clin Chim Acta. 2014 Nov 1;437:103-5. doi: 10.1016/j.cca.2014.07.015. Epub 2014 Jul 21. [PubMed:25058800 ]
  2. Primaquine[package insert]. Bridgewater, New Jersey: Sanofi-Aventis U.S. LLC; 2016. [Link]

PMID: 21152324

Primaquine

By

Primaquine

Product: Lp-PLA2 -IN-1

Identifier : DBSNPE000506
Drug : DB01087 (Primaquine)
Interacting Gene/Enzyme : NADH-cytochrome b5 reductase 3
Gene Name : CYB5R3
UniProt ID : P00387
Defining Change(s) :

  • Exon 7 c.611G>A

Allele Name : Not Available
Genotype(s) : Not Available
Type(s) : ADR Inferred
Groups : NADH methemoglobin reductase deficiency
Description : Risk of methemglobinemia.
References :

  1. Kedar P, Warang P, Sanyal S, Devendra R, Ghosh K, Colah R: Primaquine-induced severe methemoglobinemia developed during diveatment of Plasmodium vivax malarial infection in an Indian family associated with a novel mutation (p.Agr57Trp) in the CYB5R3 gene. Clin Chim Acta. 2014 Nov 1;437:103-5. doi: 10.1016/j.cca.2014.07.015. Epub 2014 Jul 21. [PubMed:25058800 ]
  2. Primaquine[package insert]. Bridgewater, New Jersey: Sanofi-Aventis U.S. LLC; 2016. [Link]

PMID: 20540524

Primaquine

By

Primaquine

Product: STF-62247

Identifier : DBSNPE000507
Drug : DB01087 (Primaquine)
Interacting Gene/Enzyme : NADH-cytochrome b5 reductase 3
Gene Name : CYB5R3
UniProt ID : P00387
Defining Change(s) :

  • Exon 8 c.637G>A

Allele Name : Not Available
Genotype(s) : Not Available
Type(s) : ADR Inferred
Groups : NADH methemoglobin reductase deficiency
Description : Risk of methemglobinemia.
References :

  1. Kedar P, Warang P, Sanyal S, Devendra R, Ghosh K, Colah R: Primaquine-induced severe methemoglobinemia developed during diveatment of Plasmodium vivax malarial infection in an Indian family associated with a novel mutation (p.Agr57Trp) in the CYB5R3 gene. Clin Chim Acta. 2014 Nov 1;437:103-5. doi: 10.1016/j.cca.2014.07.015. Epub 2014 Jul 21. [PubMed:25058800 ]
  2. Primaquine[package insert]. Bridgewater, New Jersey: Sanofi-Aventis U.S. LLC; 2016. [Link]

PMID: 20705611

Primaquine

By

Primaquine

Product: CPI-637

Identifier : DBSNPE000508
Drug : DB01087 (Primaquine)
Interacting Gene/Enzyme : NADH-cytochrome b5 reductase 3
Gene Name : CYB5R3
UniProt ID : P00387
Defining Change(s) :

  • Exon 8 c.647T>C

Allele Name : Not Available
Genotype(s) : Not Available
Type(s) : ADR Inferred
Groups : NADH methemoglobin reductase deficiency
Description : Risk of methemglobinemia.
References :

  1. Kedar P, Warang P, Sanyal S, Devendra R, Ghosh K, Colah R: Primaquine-induced severe methemoglobinemia developed during diveatment of Plasmodium vivax malarial infection in an Indian family associated with a novel mutation (p.Agr57Trp) in the CYB5R3 gene. Clin Chim Acta. 2014 Nov 1;437:103-5. doi: 10.1016/j.cca.2014.07.015. Epub 2014 Jul 21. [PubMed:25058800 ]
  2. Primaquine[package insert]. Bridgewater, New Jersey: Sanofi-Aventis U.S. LLC; 2016. [Link]

PMID: 20145118

Primaquine

By

Primaquine

Product: KPT-8602

Identifier : DBSNPE000509
Drug : DB01087 (Primaquine)
Interacting Gene/Enzyme : NADH-cytochrome b5 reductase 3
Gene Name : CYB5R3
UniProt ID : P00387
Defining Change(s) :

  • Exon 8 c.650T>C

Allele Name : Not Available
Genotype(s) : Not Available
Type(s) : ADR Inferred
Groups : NADH methemoglobin reductase deficiency
Description : Risk of methemglobinemia.
References :

  1. Kedar P, Warang P, Sanyal S, Devendra R, Ghosh K, Colah R: Primaquine-induced severe methemoglobinemia developed during diveatment of Plasmodium vivax malarial infection in an Indian family associated with a novel mutation (p.Agr57Trp) in the CYB5R3 gene. Clin Chim Acta. 2014 Nov 1;437:103-5. doi: 10.1016/j.cca.2014.07.015. Epub 2014 Jul 21. [PubMed:25058800 ]
  2. Primaquine[package insert]. Bridgewater, New Jersey: Sanofi-Aventis U.S. LLC; 2016. [Link]

PMID: 20601496

Primaquine

By

Primaquine

Product: (S)-MCPG

Identifier : DBSNPE000510
Drug : DB01087 (Primaquine)
Interacting Gene/Enzyme : NADH-cytochrome b5 reductase 3
Gene Name : CYB5R3
UniProt ID : P00387
Defining Change(s) :

  • Exon 8 c.655C>T

Allele Name : Not Available
Genotype(s) : Not Available
Type(s) : ADR Inferred
Groups : NADH methemoglobin reductase deficiency
Description : Risk of methemglobinemia.
References :

  1. Kedar P, Warang P, Sanyal S, Devendra R, Ghosh K, Colah R: Primaquine-induced severe methemoglobinemia developed during diveatment of Plasmodium vivax malarial infection in an Indian family associated with a novel mutation (p.Agr57Trp) in the CYB5R3 gene. Clin Chim Acta. 2014 Nov 1;437:103-5. doi: 10.1016/j.cca.2014.07.015. Epub 2014 Jul 21. [PubMed:25058800 ]
  2. Primaquine[package insert]. Bridgewater, New Jersey: Sanofi-Aventis U.S. LLC; 2016. [Link]

PMID: 20880986

Primaquine

By

Primaquine

Product: PQR620

Identifier : DBSNPE000511
Drug : DB01087 (Primaquine)
Interacting Gene/Enzyme : NADH-cytochrome b5 reductase 3
Gene Name : CYB5R3
UniProt ID : P00387
Defining Change(s) :

  • Exon 8 c.716T>G

Allele Name : Not Available
Genotype(s) : Not Available
Type(s) : ADR Inferred
Groups : NADH methemoglobin reductase deficiency
Description : Risk of methemglobinemia.
References :

  1. Kedar P, Warang P, Sanyal S, Devendra R, Ghosh K, Colah R: Primaquine-induced severe methemoglobinemia developed during diveatment of Plasmodium vivax malarial infection in an Indian family associated with a novel mutation (p.Agr57Trp) in the CYB5R3 gene. Clin Chim Acta. 2014 Nov 1;437:103-5. doi: 10.1016/j.cca.2014.07.015. Epub 2014 Jul 21. [PubMed:25058800 ]
  2. Primaquine[package insert]. Bridgewater, New Jersey: Sanofi-Aventis U.S. LLC; 2016. [Link]

PMID: 20554919

Primaquine

By

Primaquine

Product: Vapreotide

Identifier : DBSNPE000512
Drug : DB01087 (Primaquine)
Interacting Gene/Enzyme : NADH-cytochrome b5 reductase 3
Gene Name : CYB5R3
UniProt ID : P00387
Defining Change(s) :

  • Exon 8 c.719A>G

Allele Name : Not Available
Genotype(s) : Not Available
Type(s) : ADR Inferred
Groups : NADH methemoglobin reductase deficiency
Description : Risk of methemglobinemia.
References :

  1. Kedar P, Warang P, Sanyal S, Devendra R, Ghosh K, Colah R: Primaquine-induced severe methemoglobinemia developed during diveatment of Plasmodium vivax malarial infection in an Indian family associated with a novel mutation (p.Agr57Trp) in the CYB5R3 gene. Clin Chim Acta. 2014 Nov 1;437:103-5. doi: 10.1016/j.cca.2014.07.015. Epub 2014 Jul 21. [PubMed:25058800 ]
  2. Primaquine[package insert]. Bridgewater, New Jersey: Sanofi-Aventis U.S. LLC; 2016. [Link]

PMID: 20048160

Primaquine

By

Primaquine

Product: Isorhamnetin

Identifier : DBSNPE000513
Drug : DB01087 (Primaquine)
Interacting Gene/Enzyme : NADH-cytochrome b5 reductase 3
Gene Name : CYB5R3
UniProt ID : P00387
Defining Change(s) :

  • Exon 8 c.719A>G

Allele Name : Not Available
Genotype(s) : Not Available
Type(s) : ADR Inferred
Groups : NADH methemoglobin reductase deficiency
Description : Risk of methemglobinemia.
References :

  1. Kedar P, Warang P, Sanyal S, Devendra R, Ghosh K, Colah R: Primaquine-induced severe methemoglobinemia developed during diveatment of Plasmodium vivax malarial infection in an Indian family associated with a novel mutation (p.Agr57Trp) in the CYB5R3 gene. Clin Chim Acta. 2014 Nov 1;437:103-5. doi: 10.1016/j.cca.2014.07.015. Epub 2014 Jul 21. [PubMed:25058800 ]
  2. Primaquine[package insert]. Bridgewater, New Jersey: Sanofi-Aventis U.S. LLC; 2016. [Link]

PMID: 20200160

Primaquine

By

Primaquine

Product: 2,3,5,4-Tetrahydroxystilbene 2-O-β-D-glucoside

Identifier : DBSNPE000514
Drug : DB01087 (Primaquine)
Interacting Gene/Enzyme : NADH-cytochrome b5 reductase 3
Gene Name : CYB5R3
UniProt ID : P00387
Defining Change(s) :

  • Exon 8 Not reported

Allele Name : Not Available
Genotype(s) : Not Available
Type(s) : ADR Inferred
Groups : NADH methemoglobin reductase deficiency
Description : Risk of methemglobinemia.
References :

  1. Kedar P, Warang P, Sanyal S, Devendra R, Ghosh K, Colah R: Primaquine-induced severe methemoglobinemia developed during diveatment of Plasmodium vivax malarial infection in an Indian family associated with a novel mutation (p.Agr57Trp) in the CYB5R3 gene. Clin Chim Acta. 2014 Nov 1;437:103-5. doi: 10.1016/j.cca.2014.07.015. Epub 2014 Jul 21. [PubMed:25058800 ]
  2. Primaquine[package insert]. Bridgewater, New Jersey: Sanofi-Aventis U.S. LLC; 2016. [Link]

PMID: 20089883

Primaquine

By

Primaquine

Product: Apigenin 7-glucoside

Identifier : DBSNPE000515
Drug : DB01087 (Primaquine)
Interacting Gene/Enzyme : NADH-cytochrome b5 reductase 3
Gene Name : CYB5R3
UniProt ID : P00387
Defining Change(s) :

  • Exon 9 c.757G>A

Allele Name : Not Available
Genotype(s) : Not Available
Type(s) : ADR Inferred
Groups : NADH methemoglobin reductase deficiency
Description : Risk of methemglobinemia.
References :

  1. Kedar P, Warang P, Sanyal S, Devendra R, Ghosh K, Colah R: Primaquine-induced severe methemoglobinemia developed during diveatment of Plasmodium vivax malarial infection in an Indian family associated with a novel mutation (p.Agr57Trp) in the CYB5R3 gene. Clin Chim Acta. 2014 Nov 1;437:103-5. doi: 10.1016/j.cca.2014.07.015. Epub 2014 Jul 21. [PubMed:25058800 ]
  2. Primaquine[package insert]. Bridgewater, New Jersey: Sanofi-Aventis U.S. LLC; 2016. [Link]

PMID: 21040551

Primaquine

By

Primaquine

Product: RO9021

Identifier : DBSNPE000516
Drug : DB01087 (Primaquine)
Interacting Gene/Enzyme : NADH-cytochrome b5 reductase 3
Gene Name : CYB5R3
UniProt ID : P00387
Defining Change(s) :

  • Exon 9 c.757G>A

Allele Name : Not Available
Genotype(s) : Not Available
Type(s) : ADR Inferred
Groups : NADH methemoglobin reductase deficiency
Description : Risk of methemglobinemia.
References :

  1. Kedar P, Warang P, Sanyal S, Devendra R, Ghosh K, Colah R: Primaquine-induced severe methemoglobinemia developed during diveatment of Plasmodium vivax malarial infection in an Indian family associated with a novel mutation (p.Agr57Trp) in the CYB5R3 gene. Clin Chim Acta. 2014 Nov 1;437:103-5. doi: 10.1016/j.cca.2014.07.015. Epub 2014 Jul 21. [PubMed:25058800 ]
  2. Primaquine[package insert]. Bridgewater, New Jersey: Sanofi-Aventis U.S. LLC; 2016. [Link]

PMID: 20147731

Primaquine

By

Primaquine

Product: Abarelix

Identifier : DBSNPE000517
Drug : DB01087 (Primaquine)
Interacting Gene/Enzyme : NADH-cytochrome b5 reductase 3
Gene Name : CYB5R3
UniProt ID : P00387
Defining Change(s) :

  • Exon 9 c.757G>A

Allele Name : Not Available
Genotype(s) : Not Available
Type(s) : ADR Inferred
Groups : NADH methemoglobin reductase deficiency
Description : Risk of methemglobinemia.
References :

  1. Kedar P, Warang P, Sanyal S, Devendra R, Ghosh K, Colah R: Primaquine-induced severe methemoglobinemia developed during diveatment of Plasmodium vivax malarial infection in an Indian family associated with a novel mutation (p.Agr57Trp) in the CYB5R3 gene. Clin Chim Acta. 2014 Nov 1;437:103-5. doi: 10.1016/j.cca.2014.07.015. Epub 2014 Jul 21. [PubMed:25058800 ]
  2. Primaquine[package insert]. Bridgewater, New Jersey: Sanofi-Aventis U.S. LLC; 2016. [Link]

PMID: 19996302

Primaquine

By

Primaquine

Product: ABT-239

Identifier : DBSNPE000518
Drug : DB01087 (Primaquine)
Interacting Gene/Enzyme : NADH-cytochrome b5 reductase 3
Gene Name : CYB5R3
UniProt ID : P00387
Defining Change(s) :

  • Exon 9 c.757G>A

Allele Name : Not Available
Genotype(s) : Not Available
Type(s) : ADR Inferred
Groups : NADH methemoglobin reductase deficiency
Description : Risk of methemglobinemia.
References :

  1. Kedar P, Warang P, Sanyal S, Devendra R, Ghosh K, Colah R: Primaquine-induced severe methemoglobinemia developed during diveatment of Plasmodium vivax malarial infection in an Indian family associated with a novel mutation (p.Agr57Trp) in the CYB5R3 gene. Clin Chim Acta. 2014 Nov 1;437:103-5. doi: 10.1016/j.cca.2014.07.015. Epub 2014 Jul 21. [PubMed:25058800 ]
  2. Primaquine[package insert]. Bridgewater, New Jersey: Sanofi-Aventis U.S. LLC; 2016. [Link]

PMID: 19955385

Primaquine

By

Primaquine

Product: SPQ

Identifier : DBSNPE000519
Drug : DB01087 (Primaquine)
Interacting Gene/Enzyme : NADH-cytochrome b5 reductase 3
Gene Name : CYB5R3
UniProt ID : P00387
Defining Change(s) :

  • Exon 9 c.766_768del

Allele Name : Not Available
Genotype(s) : Not Available
Type(s) : ADR Inferred
Groups : NADH methemoglobin reductase deficiency
Description : Risk of methemglobinemia.
References :

  1. Kedar P, Warang P, Sanyal S, Devendra R, Ghosh K, Colah R: Primaquine-induced severe methemoglobinemia developed during diveatment of Plasmodium vivax malarial infection in an Indian family associated with a novel mutation (p.Agr57Trp) in the CYB5R3 gene. Clin Chim Acta. 2014 Nov 1;437:103-5. doi: 10.1016/j.cca.2014.07.015. Epub 2014 Jul 21. [PubMed:25058800 ]
  2. Primaquine[package insert]. Bridgewater, New Jersey: Sanofi-Aventis U.S. LLC; 2016. [Link]

PMID: 19116342

Primaquine

By

Primaquine

Product: Polymyxin B (Sulfate)

Identifier : DBSNPE000520
Drug : DB01087 (Primaquine)
Interacting Gene/Enzyme : NADH-cytochrome b5 reductase 3
Gene Name : CYB5R3
UniProt ID : P00387
Defining Change(s) :

  • Exon 9 c.775C>T

Allele Name : Not Available
Genotype(s) : Not Available
Type(s) : ADR Inferred
Groups : NADH methemoglobin reductase deficiency
Description : Risk of methemglobinemia.
References :

  1. Kedar P, Warang P, Sanyal S, Devendra R, Ghosh K, Colah R: Primaquine-induced severe methemoglobinemia developed during diveatment of Plasmodium vivax malarial infection in an Indian family associated with a novel mutation (p.Agr57Trp) in the CYB5R3 gene. Clin Chim Acta. 2014 Nov 1;437:103-5. doi: 10.1016/j.cca.2014.07.015. Epub 2014 Jul 21. [PubMed:25058800 ]
  2. Primaquine[package insert]. Bridgewater, New Jersey: Sanofi-Aventis U.S. LLC; 2016. [Link]

PMID: 19462000

Primaquine

By

Primaquine

Product: PP58

Identifier : DBSNPE000521
Drug : DB01087 (Primaquine)
Interacting Gene/Enzyme : NADH-cytochrome b5 reductase 3
Gene Name : CYB5R3
UniProt ID : P00387
Defining Change(s) :

  • Exon 9 c.815_817del

Allele Name : Not Available
Genotype(s) : Not Available
Type(s) : ADR Inferred
Groups : NADH methemoglobin reductase deficiency
Description : Risk of methemglobinemia.
References :

  1. Kedar P, Warang P, Sanyal S, Devendra R, Ghosh K, Colah R: Primaquine-induced severe methemoglobinemia developed during diveatment of Plasmodium vivax malarial infection in an Indian family associated with a novel mutation (p.Agr57Trp) in the CYB5R3 gene. Clin Chim Acta. 2014 Nov 1;437:103-5. doi: 10.1016/j.cca.2014.07.015. Epub 2014 Jul 21. [PubMed:25058800 ]
  2. Primaquine[package insert]. Bridgewater, New Jersey: Sanofi-Aventis U.S. LLC; 2016. [Link]

PMID: 19491296

Primaquine

By

Primaquine

Product: PIM-447 (dihydrochloride)

Identifier : DBSNPE000522
Drug : DB01087 (Primaquine)
Interacting Gene/Enzyme : NADH-cytochrome b5 reductase 3
Gene Name : CYB5R3
UniProt ID : P00387
Defining Change(s) :

  • Exon 9 c.827C>T

Allele Name : Not Available
Genotype(s) : Not Available
Type(s) : ADR Inferred
Groups : NADH methemoglobin reductase deficiency
Description : Risk of methemglobinemia.
References :

  1. Kedar P, Warang P, Sanyal S, Devendra R, Ghosh K, Colah R: Primaquine-induced severe methemoglobinemia developed during diveatment of Plasmodium vivax malarial infection in an Indian family associated with a novel mutation (p.Agr57Trp) in the CYB5R3 gene. Clin Chim Acta. 2014 Nov 1;437:103-5. doi: 10.1016/j.cca.2014.07.015. Epub 2014 Jul 21. [PubMed:25058800 ]
  2. Primaquine[package insert]. Bridgewater, New Jersey: Sanofi-Aventis U.S. LLC; 2016. [Link]

PMID: 19541800

Primaquine

By

Primaquine

Product: Human growth hormone-releasing factor

Identifier : DBSNPE000523
Drug : DB01087 (Primaquine)
Interacting Gene/Enzyme : NADH-cytochrome b5 reductase 3
Gene Name : CYB5R3
UniProt ID : P00387
Defining Change(s) :

  • Exon 9 c.875G>A

Allele Name : Not Available
Genotype(s) : Not Available
Type(s) : ADR Inferred
Groups : NADH methemoglobin reductase deficiency
Description : Risk of methemglobinemia.
References :

  1. Kedar P, Warang P, Sanyal S, Devendra R, Ghosh K, Colah R: Primaquine-induced severe methemoglobinemia developed during diveatment of Plasmodium vivax malarial infection in an Indian family associated with a novel mutation (p.Agr57Trp) in the CYB5R3 gene. Clin Chim Acta. 2014 Nov 1;437:103-5. doi: 10.1016/j.cca.2014.07.015. Epub 2014 Jul 21. [PubMed:25058800 ]
  2. Primaquine[package insert]. Bridgewater, New Jersey: Sanofi-Aventis U.S. LLC; 2016. [Link]

PMID: 19435816

Primaquine

By

Primaquine

Product: Porcine dynorphin A(1-13)

Identifier : DBSNPE000524
Drug : DB01087 (Primaquine)
Interacting Gene/Enzyme : NADH-cytochrome b5 reductase 3
Gene Name : CYB5R3
UniProt ID : P00387
Defining Change(s) :

  • Exon 9 c.875G>A

Allele Name : Not Available
Genotype(s) : Not Available
Type(s) : ADR Inferred
Groups : NADH methemoglobin reductase deficiency
Description : Risk of methemglobinemia.
References :

  1. Kedar P, Warang P, Sanyal S, Devendra R, Ghosh K, Colah R: Primaquine-induced severe methemoglobinemia developed during diveatment of Plasmodium vivax malarial infection in an Indian family associated with a novel mutation (p.Agr57Trp) in the CYB5R3 gene. Clin Chim Acta. 2014 Nov 1;437:103-5. doi: 10.1016/j.cca.2014.07.015. Epub 2014 Jul 21. [PubMed:25058800 ]
  2. Primaquine[package insert]. Bridgewater, New Jersey: Sanofi-Aventis U.S. LLC; 2016. [Link]

PMID: 19891787

Primaquine

By

Primaquine

Product: Methoxy-PMS

Identifier : DBSNPE000525
Drug : DB01087 (Primaquine)
Interacting Gene/Enzyme : NADH-cytochrome b5 reductase 3
Gene Name : CYB5R3
UniProt ID : P00387
Defining Change(s) :

  • Exon 9 c.875G>A

Allele Name : Not Available
Genotype(s) : Not Available
Type(s) : ADR Inferred
Groups : NADH methemoglobin reductase deficiency
Description : Risk of methemglobinemia.
References :

  1. Kedar P, Warang P, Sanyal S, Devendra R, Ghosh K, Colah R: Primaquine-induced severe methemoglobinemia developed during diveatment of Plasmodium vivax malarial infection in an Indian family associated with a novel mutation (p.Agr57Trp) in the CYB5R3 gene. Clin Chim Acta. 2014 Nov 1;437:103-5. doi: 10.1016/j.cca.2014.07.015. Epub 2014 Jul 21. [PubMed:25058800 ]
  2. Primaquine[package insert]. Bridgewater, New Jersey: Sanofi-Aventis U.S. LLC; 2016. [Link]

PMID: 19299741

Primaquine

By

Primaquine

Product: MK-0812 (Succinate)

Identifier : DBSNPE000526
Drug : DB01087 (Primaquine)
Interacting Gene/Enzyme : NADH-cytochrome b5 reductase 3
Gene Name : CYB5R3
UniProt ID : P00387
Defining Change(s) :

  • Exon 9 c.882_884delinsAA

Allele Name : Not Available
Genotype(s) : Not Available
Type(s) : ADR Inferred
Groups : NADH methemoglobin reductase deficiency
Description : Risk of methemglobinemia.
References :

  1. Kedar P, Warang P, Sanyal S, Devendra R, Ghosh K, Colah R: Primaquine-induced severe methemoglobinemia developed during diveatment of Plasmodium vivax malarial infection in an Indian family associated with a novel mutation (p.Agr57Trp) in the CYB5R3 gene. Clin Chim Acta. 2014 Nov 1;437:103-5. doi: 10.1016/j.cca.2014.07.015. Epub 2014 Jul 21. [PubMed:25058800 ]
  2. Primaquine[package insert]. Bridgewater, New Jersey: Sanofi-Aventis U.S. LLC; 2016. [Link]

PMID: 19651820

Primaquine

By

Primaquine

Product: GDC-0853

Identifier : DBSNPE000527
Drug : DB01087 (Primaquine)
Interacting Gene/Enzyme : NADH-cytochrome b5 reductase 3
Gene Name : CYB5R3
UniProt ID : P00387
Defining Change(s) :

  • Exon 9 c.895_897del

Allele Name : Not Available
Genotype(s) : Not Available
Type(s) : ADR Inferred
Groups : NADH methemoglobin reductase deficiency
Description : Risk of methemglobinemia.
References :

  1. Kedar P, Warang P, Sanyal S, Devendra R, Ghosh K, Colah R: Primaquine-induced severe methemoglobinemia developed during diveatment of Plasmodium vivax malarial infection in an Indian family associated with a novel mutation (p.Agr57Trp) in the CYB5R3 gene. Clin Chim Acta. 2014 Nov 1;437:103-5. doi: 10.1016/j.cca.2014.07.015. Epub 2014 Jul 21. [PubMed:25058800 ]
  2. Primaquine[package insert]. Bridgewater, New Jersey: Sanofi-Aventis U.S. LLC; 2016. [Link]

PMID: 19474185

Primaquine

By

Primaquine

Product: NAMI-A

Identifier : DBSNPE000529
Drug : DB01087 (Primaquine)
Interacting Gene/Enzyme : NADH-cytochrome b5 reductase 3
Gene Name : CYB5R3
UniProt ID : P00387
Defining Change(s) :

  • Indivon 4 c.418-1G>A

Allele Name : Not Available
Genotype(s) : Not Available
Type(s) : ADR Inferred
Groups : NADH methemoglobin reductase deficiency
Description : Risk of methemglobinemia.
References :

  1. Kedar P, Warang P, Sanyal S, Devendra R, Ghosh K, Colah R: Primaquine-induced severe methemoglobinemia developed during diveatment of Plasmodium vivax malarial infection in an Indian family associated with a novel mutation (p.Agr57Trp) in the CYB5R3 gene. Clin Chim Acta. 2014 Nov 1;437:103-5. doi: 10.1016/j.cca.2014.07.015. Epub 2014 Jul 21. [PubMed:25058800 ]
  2. Primaquine[package insert]. Bridgewater, New Jersey: Sanofi-Aventis U.S. LLC; 2016. [Link]

PMID: 19608654

Primaquine

By

Primaquine

Product: PIM447

Identifier : DBSNPE000530
Drug : DB01087 (Primaquine)
Interacting Gene/Enzyme : NADH-cytochrome b5 reductase 3
Gene Name : CYB5R3
UniProt ID : P00387
Defining Change(s) :

  • Indivon 5 c.548

Allele Name : Not Available
Genotype(s) : Not Available
Type(s) : ADR Inferred
Groups : NADH methemoglobin reductase deficiency
Description : Risk of methemglobinemia.
References :

  1. Kedar P, Warang P, Sanyal S, Devendra R, Ghosh K, Colah R: Primaquine-induced severe methemoglobinemia developed during diveatment of Plasmodium vivax malarial infection in an Indian family associated with a novel mutation (p.Agr57Trp) in the CYB5R3 gene. Clin Chim Acta. 2014 Nov 1;437:103-5. doi: 10.1016/j.cca.2014.07.015. Epub 2014 Jul 21. [PubMed:25058800 ]
  2. Primaquine[package insert]. Bridgewater, New Jersey: Sanofi-Aventis U.S. LLC; 2016. [Link]

PMID: 19299443

Primaquine

By

Primaquine

Product: CCT244747

Identifier : DBSNPE000531
Drug : DB01087 (Primaquine)
Interacting Gene/Enzyme : NADH-cytochrome b5 reductase 3
Gene Name : CYB5R3
UniProt ID : P00387
Defining Change(s) :

  • Indivon 5 c.548

Allele Name : Not Available
Genotype(s) : Not Available
Type(s) : ADR Inferred
Groups : NADH methemoglobin reductase deficiency
Description : Risk of methemglobinemia.
References :

  1. Kedar P, Warang P, Sanyal S, Devendra R, Ghosh K, Colah R: Primaquine-induced severe methemoglobinemia developed during diveatment of Plasmodium vivax malarial infection in an Indian family associated with a novel mutation (p.Agr57Trp) in the CYB5R3 gene. Clin Chim Acta. 2014 Nov 1;437:103-5. doi: 10.1016/j.cca.2014.07.015. Epub 2014 Jul 21. [PubMed:25058800 ]
  2. Primaquine[package insert]. Bridgewater, New Jersey: Sanofi-Aventis U.S. LLC; 2016. [Link]

PMID: 19279395

Primaquine

By

Primaquine

Product: Doravirine

Identifier : DBSNPE000532
Drug : DB01087 (Primaquine)
Interacting Gene/Enzyme : NADH-cytochrome b5 reductase 3
Gene Name : CYB5R3
UniProt ID : P00387
Defining Change(s) :

  • Indivon 5 c.547+2T>C

Allele Name : Not Available
Genotype(s) : Not Available
Type(s) : ADR Inferred
Groups : NADH methemoglobin reductase deficiency
Description : Risk of methemglobinemia.
References :

  1. Kedar P, Warang P, Sanyal S, Devendra R, Ghosh K, Colah R: Primaquine-induced severe methemoglobinemia developed during diveatment of Plasmodium vivax malarial infection in an Indian family associated with a novel mutation (p.Agr57Trp) in the CYB5R3 gene. Clin Chim Acta. 2014 Nov 1;437:103-5. doi: 10.1016/j.cca.2014.07.015. Epub 2014 Jul 21. [PubMed:25058800 ]
  2. Primaquine[package insert]. Bridgewater, New Jersey: Sanofi-Aventis U.S. LLC; 2016. [Link]

PMID: 19171042

Primaquine

By

Primaquine

Product: Relugolix

Identifier : DBSNPE000533
Drug : DB01087 (Primaquine)
Interacting Gene/Enzyme : NADH-cytochrome b5 reductase 3
Gene Name : CYB5R3
UniProt ID : P00387
Defining Change(s) :

  • Indivon 5 c.547+8G>C

Allele Name : Not Available
Genotype(s) : Not Available
Type(s) : ADR Inferred
Groups : NADH methemoglobin reductase deficiency
Description : Risk of methemglobinemia.
References :

  1. Kedar P, Warang P, Sanyal S, Devendra R, Ghosh K, Colah R: Primaquine-induced severe methemoglobinemia developed during diveatment of Plasmodium vivax malarial infection in an Indian family associated with a novel mutation (p.Agr57Trp) in the CYB5R3 gene. Clin Chim Acta. 2014 Nov 1;437:103-5. doi: 10.1016/j.cca.2014.07.015. Epub 2014 Jul 21. [PubMed:25058800 ]
  2. Primaquine[package insert]. Bridgewater, New Jersey: Sanofi-Aventis U.S. LLC; 2016. [Link]

PMID: 19168586

Primaquine

By

Primaquine

Product: D-3263 (hydrochloride)

Identifier : DBSNPE000534
Drug : DB01087 (Primaquine)
Interacting Gene/Enzyme : NADH-cytochrome b5 reductase 3
Gene Name : CYB5R3
UniProt ID : P00387
Defining Change(s) :

  • Indivon 6 c.631+1G>A

Allele Name : Not Available
Genotype(s) : Not Available
Type(s) : ADR Inferred
Groups : NADH methemoglobin reductase deficiency
Description : Risk of methemglobinemia.
References :

  1. Kedar P, Warang P, Sanyal S, Devendra R, Ghosh K, Colah R: Primaquine-induced severe methemoglobinemia developed during diveatment of Plasmodium vivax malarial infection in an Indian family associated with a novel mutation (p.Agr57Trp) in the CYB5R3 gene. Clin Chim Acta. 2014 Nov 1;437:103-5. doi: 10.1016/j.cca.2014.07.015. Epub 2014 Jul 21. [PubMed:25058800 ]
  2. Primaquine[package insert]. Bridgewater, New Jersey: Sanofi-Aventis U.S. LLC; 2016. [Link]

PMID: 19079715

Primaquine

By

Primaquine

Product: Tenofovir (Disoproxil)

Identifier : DBSNPE000535
Drug : DB01087 (Primaquine)
Interacting Gene/Enzyme : NADH-cytochrome b5 reductase 3
Gene Name : CYB5R3
UniProt ID : P00387
Defining Change(s) :

  • Indivon 8 c.818-1G>T

Allele Name : Not Available
Genotype(s) : Not Available
Type(s) : ADR Inferred
Groups : NADH methemoglobin reductase deficiency
Description : Risk of methemglobinemia.
References :

  1. Kedar P, Warang P, Sanyal S, Devendra R, Ghosh K, Colah R: Primaquine-induced severe methemoglobinemia developed during diveatment of Plasmodium vivax malarial infection in an Indian family associated with a novel mutation (p.Agr57Trp) in the CYB5R3 gene. Clin Chim Acta. 2014 Nov 1;437:103-5. doi: 10.1016/j.cca.2014.07.015. Epub 2014 Jul 21. [PubMed:25058800 ]
  2. Primaquine[package insert]. Bridgewater, New Jersey: Sanofi-Aventis U.S. LLC; 2016. [Link]

PMID: 18832446

Primaquine

By

Primaquine

Product: Atractylenolide III

Identifier : DBSNPE002772
Drug : DB01087 (Primaquine)
Interacting Gene/Enzyme : Glucose-6-phosphate 1-dehydrogenase
Gene Name : G6PD
UniProt ID : P11413
Defining Change(s) :

  • 1000_1002delACC

Allele Name : Villeurbanne
Genotype(s) : Not Available
Type(s) : ADR Inferred
Groups : G6PD deficiency
Description : Increased risk of potentially fatal hemolysis.
References :

  1. Burgoine KL, Bancone G, Nosten F: The reality of using primaquine. Malar J. 2010 Dec 27;9:376. doi: 10.1186/1475-2875-9-376. [PubMed:21184691 ]
  2. Primaquine[package insert]. Bridgewater, New Jersey: Sanofi-Aventis U.S. LLC; 2016. [Link]

PMID: 21890694

Primaquine

By

Primaquine

Product: Atractylenolide II

Identifier : DBSNPE002773
Drug : DB01087 (Primaquine)
Interacting Gene/Enzyme : Glucose-6-phosphate 1-dehydrogenase
Gene Name : G6PD
UniProt ID : P11413
Defining Change(s) :

  • 1006A->G

Allele Name : Torun
Genotype(s) : Not Available
Type(s) : ADR Inferred
Groups : G6PD deficiency
Description : Increased risk of potentially fatal hemolysis.
References :

  1. Burgoine KL, Bancone G, Nosten F: The reality of using primaquine. Malar J. 2010 Dec 27;9:376. doi: 10.1186/1475-2875-9-376. [PubMed:21184691 ]
  2. Primaquine[package insert]. Bridgewater, New Jersey: Sanofi-Aventis U.S. LLC; 2016. [Link]

PMID: 20164346

Primaquine

By

Primaquine

Product: Aloin

Identifier : DBSNPE002774
Drug : DB01087 (Primaquine)
Interacting Gene/Enzyme : Glucose-6-phosphate 1-dehydrogenase
Gene Name : G6PD
UniProt ID : P11413
Defining Change(s) :

  • 105_107delCAT

Allele Name : Sunderland
Genotype(s) : Not Available
Type(s) : ADR Inferred
Groups : G6PD deficiency
Description : Increased risk of potentially fatal hemolysis.
References :

  1. Burgoine KL, Bancone G, Nosten F: The reality of using primaquine. Malar J. 2010 Dec 27;9:376. doi: 10.1186/1475-2875-9-376. [PubMed:21184691 ]
  2. Primaquine[package insert]. Bridgewater, New Jersey: Sanofi-Aventis U.S. LLC; 2016. [Link]

PMID: 20463230

Primaquine

By

Primaquine

Product: Indirubin

Identifier : DBSNPE002775
Drug : DB01087 (Primaquine)
Interacting Gene/Enzyme : Glucose-6-phosphate 1-dehydrogenase
Gene Name : G6PD
UniProt ID : P11413
Defining Change(s) :

  • 1081G->A

Allele Name : Iwatsuki
Genotype(s) : Not Available
Type(s) : ADR Inferred
Groups : G6PD deficiency
Description : Increased risk of potentially fatal hemolysis.
References :

  1. Burgoine KL, Bancone G, Nosten F: The reality of using primaquine. Malar J. 2010 Dec 27;9:376. doi: 10.1186/1475-2875-9-376. [PubMed:21184691 ]
  2. Primaquine[package insert]. Bridgewater, New Jersey: Sanofi-Aventis U.S. LLC; 2016. [Link]

PMID: 19277784

Primaquine

By

Primaquine

Product: Psoralen

Identifier : DBSNPE002776
Drug : DB01087 (Primaquine)
Interacting Gene/Enzyme : Glucose-6-phosphate 1-dehydrogenase
Gene Name : G6PD
UniProt ID : P11413
Defining Change(s) :

  • 1082C->T

Allele Name : Serres
Genotype(s) : Not Available
Type(s) : ADR Inferred
Groups : G6PD deficiency
Description : Increased risk of potentially fatal hemolysis.
References :

  1. Burgoine KL, Bancone G, Nosten F: The reality of using primaquine. Malar J. 2010 Dec 27;9:376. doi: 10.1186/1475-2875-9-376. [PubMed:21184691 ]
  2. Primaquine[package insert]. Bridgewater, New Jersey: Sanofi-Aventis U.S. LLC; 2016. [Link]

PMID: 19386902

Primaquine

By

Primaquine

Product: Bisdemethoxycurcumin

Identifier : DBSNPE002777
Drug : DB01087 (Primaquine)
Interacting Gene/Enzyme : Glucose-6-phosphate 1-dehydrogenase
Gene Name : G6PD
UniProt ID : P11413
Defining Change(s) :

  • 1084_1101delCTGAACGAGCGCAAGGCC

Allele Name : Tondela
Genotype(s) : Not Available
Type(s) : ADR Inferred
Groups : G6PD deficiency
Description : Increased risk of potentially fatal hemolysis.
References :

  1. Burgoine KL, Bancone G, Nosten F: The reality of using primaquine. Malar J. 2010 Dec 27;9:376. doi: 10.1186/1475-2875-9-376. [PubMed:21184691 ]
  2. Primaquine[package insert]. Bridgewater, New Jersey: Sanofi-Aventis U.S. LLC; 2016. [Link]

PMID: 17687042

Primaquine

By

Primaquine

Product: Demethoxycurcumin

Identifier : DBSNPE002778
Drug : DB01087 (Primaquine)
Interacting Gene/Enzyme : Glucose-6-phosphate 1-dehydrogenase
Gene Name : G6PD
UniProt ID : P11413
Defining Change(s) :

  • 1089C->A

Allele Name : Loma Linda
Genotype(s) : Not Available
Type(s) : ADR Inferred
Groups : G6PD deficiency
Description : Increased risk of potentially fatal hemolysis.
References :

  1. Burgoine KL, Bancone G, Nosten F: The reality of using primaquine. Malar J. 2010 Dec 27;9:376. doi: 10.1186/1475-2875-9-376. [PubMed:21184691 ]
  2. Primaquine[package insert]. Bridgewater, New Jersey: Sanofi-Aventis U.S. LLC; 2016. [Link]

PMID: 17488978

Primaquine

By

Primaquine

Product: GLPG0492

Identifier : DBSNPE002779
Drug : DB01087 (Primaquine)
Interacting Gene/Enzyme : Glucose-6-phosphate 1-dehydrogenase
Gene Name : G6PD
UniProt ID : P11413
Defining Change(s) :

  • 1089C->G

Allele Name : Aachen
Genotype(s) : Not Available
Type(s) : ADR Inferred
Groups : G6PD deficiency
Description : Increased risk of potentially fatal hemolysis.
References :

  1. Burgoine KL, Bancone G, Nosten F: The reality of using primaquine. Malar J. 2010 Dec 27;9:376. doi: 10.1186/1475-2875-9-376. [PubMed:21184691 ]
  2. Primaquine[package insert]. Bridgewater, New Jersey: Sanofi-Aventis U.S. LLC; 2016. [Link]

PMID: 17567814

Primaquine

By

Primaquine

Product: ACTB-1003

Identifier : DBSNPE002780
Drug : DB01087 (Primaquine)
Interacting Gene/Enzyme : Glucose-6-phosphate 1-dehydrogenase
Gene Name : G6PD
UniProt ID : P11413
Defining Change(s) :

  • 1096A->G

Allele Name : Tenri
Genotype(s) : Not Available
Type(s) : ADR Inferred
Groups : G6PD deficiency
Description : Increased risk of potentially fatal hemolysis.
References :

  1. Burgoine KL, Bancone G, Nosten F: The reality of using primaquine. Malar J. 2010 Dec 27;9:376. doi: 10.1186/1475-2875-9-376. [PubMed:21184691 ]
  2. Primaquine[package insert]. Bridgewater, New Jersey: Sanofi-Aventis U.S. LLC; 2016. [Link]

PMID: 15056713

Primaquine

By

Primaquine

Product: E-4031

Identifier : DBSNPE002781
Drug : DB01087 (Primaquine)
Interacting Gene/Enzyme : Glucose-6-phosphate 1-dehydrogenase
Gene Name : G6PD
UniProt ID : P11413
Defining Change(s) :

  • 1132G>A

Allele Name : Montpellier
Genotype(s) : Not Available
Type(s) : ADR Inferred
Groups : G6PD deficiency
Description : Increased risk of potentially fatal hemolysis.
References :

  1. Burgoine KL, Bancone G, Nosten F: The reality of using primaquine. Malar J. 2010 Dec 27;9:376. doi: 10.1186/1475-2875-9-376. [PubMed:21184691 ]
  2. Primaquine[package insert]. Bridgewater, New Jersey: Sanofi-Aventis U.S. LLC; 2016. [Link]

PMID: 14657189

Primaquine

By

Primaquine

Product: Telatinib

Identifier : DBSNPE002782
Drug : DB01087 (Primaquine)
Interacting Gene/Enzyme : Glucose-6-phosphate 1-dehydrogenase
Gene Name : G6PD
UniProt ID : P11413
Defining Change(s) :

  • 1138A->G

Allele Name : Calvo Mackenna
Genotype(s) : Not Available
Type(s) : ADR Inferred
Groups : G6PD deficiency
Description : Increased risk of potentially fatal hemolysis.
References :

  1. Burgoine KL, Bancone G, Nosten F: The reality of using primaquine. Malar J. 2010 Dec 27;9:376. doi: 10.1186/1475-2875-9-376. [PubMed:21184691 ]
  2. Primaquine[package insert]. Bridgewater, New Jersey: Sanofi-Aventis U.S. LLC; 2016. [Link]

PMID: 27064299

Primaquine

By

Primaquine

Product: Sitagliptin (phosphate monohydrate)

Identifier : DBSNPE002783
Drug : DB01087 (Primaquine)
Interacting Gene/Enzyme : Glucose-6-phosphate 1-dehydrogenase
Gene Name : G6PD
UniProt ID : P11413
Defining Change(s) :

  • 1139T->C

Allele Name : Riley
Genotype(s) : Not Available
Type(s) : ADR Inferred
Groups : G6PD deficiency
Description : Increased risk of potentially fatal hemolysis.
References :

  1. Burgoine KL, Bancone G, Nosten F: The reality of using primaquine. Malar J. 2010 Dec 27;9:376. doi: 10.1186/1475-2875-9-376. [PubMed:21184691 ]
  2. Primaquine[package insert]. Bridgewater, New Jersey: Sanofi-Aventis U.S. LLC; 2016. [Link]

PMID: 24439381

Primaquine

By

Primaquine

Product: PF-06380101

Identifier : DBSNPE002784
Drug : DB01087 (Primaquine)
Interacting Gene/Enzyme : Glucose-6-phosphate 1-dehydrogenase
Gene Name : G6PD
UniProt ID : P11413
Defining Change(s) :

  • 1141T->C

Allele Name : Olomouc
Genotype(s) : Not Available
Type(s) : ADR Inferred
Groups : G6PD deficiency
Description : Increased risk of potentially fatal hemolysis.
References :

  1. Burgoine KL, Bancone G, Nosten F: The reality of using primaquine. Malar J. 2010 Dec 27;9:376. doi: 10.1186/1475-2875-9-376. [PubMed:21184691 ]
  2. Primaquine[package insert]. Bridgewater, New Jersey: Sanofi-Aventis U.S. LLC; 2016. [Link]

PMID: 17455259

Primaquine

By

Primaquine

Product: Tubeimoside I

Identifier : DBSNPE002785
Drug : DB01087 (Primaquine)
Interacting Gene/Enzyme : Glucose-6-phosphate 1-dehydrogenase
Gene Name : G6PD
UniProt ID : P11413
Defining Change(s) :

  • 1153T->C

Allele Name : Tomah
Genotype(s) : Not Available
Type(s) : ADR Inferred
Groups : G6PD deficiency
Description : Increased risk of potentially fatal hemolysis.
References :

  1. Burgoine KL, Bancone G, Nosten F: The reality of using primaquine. Malar J. 2010 Dec 27;9:376. doi: 10.1186/1475-2875-9-376. [PubMed:21184691 ]
  2. Primaquine[package insert]. Bridgewater, New Jersey: Sanofi-Aventis U.S. LLC; 2016. [Link]

PMID: 12700284

Primaquine

By

Primaquine

Product: Atractylodin

Identifier : DBSNPE002787
Drug : DB01087 (Primaquine)
Interacting Gene/Enzyme : Glucose-6-phosphate 1-dehydrogenase
Gene Name : G6PD
UniProt ID : P11413
Defining Change(s) :

  • 1155C->G

Allele Name : Madrid
Genotype(s) : Not Available
Type(s) : ADR Inferred
Groups : G6PD deficiency
Description : Increased risk of potentially fatal hemolysis.
References :

  1. Burgoine KL, Bancone G, Nosten F: The reality of using primaquine. Malar J. 2010 Dec 27;9:376. doi: 10.1186/1475-2875-9-376. [PubMed:21184691 ]
  2. Primaquine[package insert]. Bridgewater, New Jersey: Sanofi-Aventis U.S. LLC; 2016. [Link]

PMID: 19073909

Primaquine

By

Primaquine

Product: Benzoylmesaconine

Identifier : DBSNPE002788
Drug : DB01087 (Primaquine)
Interacting Gene/Enzyme : Glucose-6-phosphate 1-dehydrogenase
Gene Name : G6PD
UniProt ID : P11413
Defining Change(s) :

  • 1156A->G

Allele Name : Iowa, Walter Reed, Springfield
Genotype(s) : Not Available
Type(s) : ADR Inferred
Groups : G6PD deficiency
Description : Increased risk of potentially fatal hemolysis.
References :

  1. Burgoine KL, Bancone G, Nosten F: The reality of using primaquine. Malar J. 2010 Dec 27;9:376. doi: 10.1186/1475-2875-9-376. [PubMed:21184691 ]
  2. Primaquine[package insert]. Bridgewater, New Jersey: Sanofi-Aventis U.S. LLC; 2016. [Link]

PMID: 12767524

Primaquine

By

Primaquine

Product: Benzoylaconine

Identifier : DBSNPE002789
Drug : DB01087 (Primaquine)
Interacting Gene/Enzyme : Glucose-6-phosphate 1-dehydrogenase
Gene Name : G6PD
UniProt ID : P11413
Defining Change(s) :

  • 1160G->A

Allele Name : Beverly Hills, Genova, Iwate, Niigata, Yamaguchi
Genotype(s) : Not Available
Type(s) : ADR Inferred
Groups : G6PD deficiency
Description : Increased risk of potentially fatal hemolysis.
References :

  1. Burgoine KL, Bancone G, Nosten F: The reality of using primaquine. Malar J. 2010 Dec 27;9:376. doi: 10.1186/1475-2875-9-376. [PubMed:21184691 ]
  2. Primaquine[package insert]. Bridgewater, New Jersey: Sanofi-Aventis U.S. LLC; 2016. [Link]

PMID: 12208741

Primaquine

By

Primaquine

Product: Astragaloside A

Identifier : DBSNPE002790
Drug : DB01087 (Primaquine)
Interacting Gene/Enzyme : Glucose-6-phosphate 1-dehydrogenase
Gene Name : G6PD
UniProt ID : P11413
Defining Change(s) :

  • 1162A->G

Allele Name : Hartford
Genotype(s) : Not Available
Type(s) : ADR Inferred
Groups : G6PD deficiency
Description : Increased risk of potentially fatal hemolysis.
References :

  1. Burgoine KL, Bancone G, Nosten F: The reality of using primaquine. Malar J. 2010 Dec 27;9:376. doi: 10.1186/1475-2875-9-376. [PubMed:21184691 ]
  2. Primaquine[package insert]. Bridgewater, New Jersey: Sanofi-Aventis U.S. LLC; 2016. [Link]

PMID: 26053117

Primaquine

By

Primaquine

Product: Ginkgolic Acid

Identifier : DBSNPE002791
Drug : DB01087 (Primaquine)
Interacting Gene/Enzyme : Glucose-6-phosphate 1-dehydrogenase
Gene Name : G6PD
UniProt ID : P11413
Defining Change(s) :

  • 1166A->G

Allele Name : Praha
Genotype(s) : Not Available
Type(s) : ADR Inferred
Groups : G6PD deficiency
Description : Increased risk of potentially fatal hemolysis.
References :

  1. Burgoine KL, Bancone G, Nosten F: The reality of using primaquine. Malar J. 2010 Dec 27;9:376. doi: 10.1186/1475-2875-9-376. [PubMed:21184691 ]
  2. Primaquine[package insert]. Bridgewater, New Jersey: Sanofi-Aventis U.S. LLC; 2016. [Link]

PMID: 23252603

Primaquine

By

Primaquine

Product: Astragalin

Identifier : DBSNPE002792
Drug : DB01087 (Primaquine)
Interacting Gene/Enzyme : Glucose-6-phosphate 1-dehydrogenase
Gene Name : G6PD
UniProt ID : P11413
Defining Change(s) :

  • 1175T>C

Allele Name : Krakow
Genotype(s) : Not Available
Type(s) : ADR Inferred
Groups : G6PD deficiency
Description : Increased risk of potentially fatal hemolysis.
References :

  1. Burgoine KL, Bancone G, Nosten F: The reality of using primaquine. Malar J. 2010 Dec 27;9:376. doi: 10.1186/1475-2875-9-376. [PubMed:21184691 ]
  2. Primaquine[package insert]. Bridgewater, New Jersey: Sanofi-Aventis U.S. LLC; 2016. [Link]

PMID: 26061431

Primaquine

By

Primaquine

Product: Imidafenacin

Identifier : DBSNPE002794
Drug : DB01087 (Primaquine)
Interacting Gene/Enzyme : Glucose-6-phosphate 1-dehydrogenase
Gene Name : G6PD
UniProt ID : P11413
Defining Change(s) :

  • 1178G->A

Allele Name : Nashville, Anaheim, Portici
Genotype(s) : Not Available
Type(s) : ADR Inferred
Groups : G6PD deficiency
Description : Increased risk of potentially fatal hemolysis.
References :

  1. Burgoine KL, Bancone G, Nosten F: The reality of using primaquine. Malar J. 2010 Dec 27;9:376. doi: 10.1186/1475-2875-9-376. [PubMed:21184691 ]
  2. Primaquine[package insert]. Bridgewater, New Jersey: Sanofi-Aventis U.S. LLC; 2016. [Link]

PMID: 16724231

Primaquine

By

Primaquine

Product: GDC-0994

Identifier : DBSNPE002795
Drug : DB01087 (Primaquine)
Interacting Gene/Enzyme : Glucose-6-phosphate 1-dehydrogenase
Gene Name : G6PD
UniProt ID : P11413
Defining Change(s) :

  • 1180G->C

Allele Name : Alhambra
Genotype(s) : Not Available
Type(s) : ADR Inferred
Groups : G6PD deficiency
Description : Increased risk of potentially fatal hemolysis.
References :

  1. Burgoine KL, Bancone G, Nosten F: The reality of using primaquine. Malar J. 2010 Dec 27;9:376. doi: 10.1186/1475-2875-9-376. [PubMed:21184691 ]
  2. Primaquine[package insert]. Bridgewater, New Jersey: Sanofi-Aventis U.S. LLC; 2016. [Link]

PMID: 16263156

Primaquine

By

Primaquine

Product: Lagociclovir

Identifier : DBSNPE002796
Drug : DB01087 (Primaquine)
Interacting Gene/Enzyme : Glucose-6-phosphate 1-dehydrogenase
Gene Name : G6PD
UniProt ID : P11413
Defining Change(s) :

  • 1187C->T

Allele Name : Bari
Genotype(s) : Not Available
Type(s) : ADR Inferred
Groups : G6PD deficiency
Description : Increased risk of potentially fatal hemolysis.
References :

  1. Burgoine KL, Bancone G, Nosten F: The reality of using primaquine. Malar J. 2010 Dec 27;9:376. doi: 10.1186/1475-2875-9-376. [PubMed:21184691 ]
  2. Primaquine[package insert]. Bridgewater, New Jersey: Sanofi-Aventis U.S. LLC; 2016. [Link]

PMID: 10579829

Primaquine

By

Primaquine

Product: CCG-1423

Identifier : DBSNPE002797
Drug : DB01087 (Primaquine)
Interacting Gene/Enzyme : Glucose-6-phosphate 1-dehydrogenase
Gene Name : G6PD
UniProt ID : P11413
Defining Change(s) :

  • 1192G->A

Allele Name : Puerto Limon
Genotype(s) : Not Available
Type(s) : ADR Inferred
Groups : G6PD deficiency
Description : Increased risk of potentially fatal hemolysis.
References :

  1. Burgoine KL, Bancone G, Nosten F: The reality of using primaquine. Malar J. 2010 Dec 27;9:376. doi: 10.1186/1475-2875-9-376. [PubMed:21184691 ]
  2. Primaquine[package insert]. Bridgewater, New Jersey: Sanofi-Aventis U.S. LLC; 2016. [Link]

PMID: 17666592

Primaquine

By

Primaquine

Product: J-147

Identifier : DBSNPE002798
Drug : DB01087 (Primaquine)
Interacting Gene/Enzyme : Glucose-6-phosphate 1-dehydrogenase
Gene Name : G6PD
UniProt ID : P11413
Defining Change(s) :

  • 1205C>A

Allele Name : Covao do Lobo
Genotype(s) : Not Available
Type(s) : ADR Inferred
Groups : G6PD deficiency
Description : Increased risk of potentially fatal hemolysis.
References :

  1. Burgoine KL, Bancone G, Nosten F: The reality of using primaquine. Malar J. 2010 Dec 27;9:376. doi: 10.1186/1475-2875-9-376. [PubMed:21184691 ]
  2. Primaquine[package insert]. Bridgewater, New Jersey: Sanofi-Aventis U.S. LLC; 2016. [Link]

PMID: 15857140

Primaquine

By

Primaquine

Product: β-Lapachone

Identifier : DBSNPE002799
Drug : DB01087 (Primaquine)
Interacting Gene/Enzyme : Glucose-6-phosphate 1-dehydrogenase
Gene Name : G6PD
UniProt ID : P11413
Defining Change(s) :

  • 1215G->A

Allele Name : Clinic
Genotype(s) : Not Available
Type(s) : ADR Inferred
Groups : G6PD deficiency
Description : Increased risk of potentially fatal hemolysis.
References :

  1. Burgoine KL, Bancone G, Nosten F: The reality of using primaquine. Malar J. 2010 Dec 27;9:376. doi: 10.1186/1475-2875-9-376. [PubMed:21184691 ]
  2. Primaquine[package insert]. Bridgewater, New Jersey: Sanofi-Aventis U.S. LLC; 2016. [Link]

PMID: 22818799

Primaquine

By

Primaquine

Product: GSK-5498A

Identifier : DBSNPE002800
Drug : DB01087 (Primaquine)
Interacting Gene/Enzyme : Glucose-6-phosphate 1-dehydrogenase
Gene Name : G6PD
UniProt ID : P11413
Defining Change(s) :

  • 1225C->T

Allele Name : Udivecht
Genotype(s) : Not Available
Type(s) : ADR Inferred
Groups : G6PD deficiency
Description : Increased risk of potentially fatal hemolysis.
References :

  1. Burgoine KL, Bancone G, Nosten F: The reality of using primaquine. Malar J. 2010 Dec 27;9:376. doi: 10.1186/1475-2875-9-376. [PubMed:21184691 ]
  2. Primaquine[package insert]. Bridgewater, New Jersey: Sanofi-Aventis U.S. LLC; 2016. [Link]

PMID: 21952924

Primaquine

By

Primaquine

Product: OF-1

Identifier : DBSNPE002801
Drug : DB01087 (Primaquine)
Interacting Gene/Enzyme : Glucose-6-phosphate 1-dehydrogenase
Gene Name : G6PD
UniProt ID : P11413
Defining Change(s) :

  • 1226C->G

Allele Name : Suwalki
Genotype(s) : Not Available
Type(s) : ADR Inferred
Groups : G6PD deficiency
Description : Increased risk of potentially fatal hemolysis.
References :

  1. Burgoine KL, Bancone G, Nosten F: The reality of using primaquine. Malar J. 2010 Dec 27;9:376. doi: 10.1186/1475-2875-9-376. [PubMed:21184691 ]
  2. Primaquine[package insert]. Bridgewater, New Jersey: Sanofi-Aventis U.S. LLC; 2016. [Link]

PMID: 25467131

Primaquine

By

Primaquine

Product: Desogestrel

Identifier : DBSNPE002802
Drug : DB01087 (Primaquine)
Interacting Gene/Enzyme : Glucose-6-phosphate 1-dehydrogenase
Gene Name : G6PD
UniProt ID : P11413
Defining Change(s) :

  • 1228G->T

Allele Name : Riverside
Genotype(s) : Not Available
Type(s) : ADR Inferred
Groups : G6PD deficiency
Description : Increased risk of potentially fatal hemolysis.
References :

  1. Burgoine KL, Bancone G, Nosten F: The reality of using primaquine. Malar J. 2010 Dec 27;9:376. doi: 10.1186/1475-2875-9-376. [PubMed:21184691 ]
  2. Primaquine[package insert]. Bridgewater, New Jersey: Sanofi-Aventis U.S. LLC; 2016. [Link]

PMID: 21245100

Primaquine

By

Primaquine

Product: Nicardipine (Hydrochloride)

Identifier : DBSNPE002803
Drug : DB01087 (Primaquine)
Interacting Gene/Enzyme : Glucose-6-phosphate 1-dehydrogenase
Gene Name : G6PD
UniProt ID : P11413
Defining Change(s) :

  • 1229G->A

Allele Name : Japan, Shinagawa
Genotype(s) : Not Available
Type(s) : ADR Inferred
Groups : G6PD deficiency
Description : Increased risk of potentially fatal hemolysis.
References :

  1. Burgoine KL, Bancone G, Nosten F: The reality of using primaquine. Malar J. 2010 Dec 27;9:376. doi: 10.1186/1475-2875-9-376. [PubMed:21184691 ]
  2. Primaquine[package insert]. Bridgewater, New Jersey: Sanofi-Aventis U.S. LLC; 2016. [Link]

PMID: 10200307

Primaquine

By

Primaquine

Product: Nicardipine

Identifier : DBSNPE002804
Drug : DB01087 (Primaquine)
Interacting Gene/Enzyme : Glucose-6-phosphate 1-dehydrogenase
Gene Name : G6PD
UniProt ID : P11413
Defining Change(s) :

  • 1229G->C

Allele Name : Kawasaki
Genotype(s) : Not Available
Type(s) : ADR Inferred
Groups : G6PD deficiency
Description : Increased risk of potentially fatal hemolysis.
References :

  1. Burgoine KL, Bancone G, Nosten F: The reality of using primaquine. Malar J. 2010 Dec 27;9:376. doi: 10.1186/1475-2875-9-376. [PubMed:21184691 ]
  2. Primaquine[package insert]. Bridgewater, New Jersey: Sanofi-Aventis U.S. LLC; 2016. [Link]

PMID: 17690692

Primaquine

By

Primaquine

Product: Atractylenolide I

Identifier : DBSNPE002805
Drug : DB01087 (Primaquine)
Interacting Gene/Enzyme : Glucose-6-phosphate 1-dehydrogenase
Gene Name : G6PD
UniProt ID : P11413
Defining Change(s) :

  • 1231A->G

Allele Name : Munich
Genotype(s) : Not Available
Type(s) : ADR Inferred
Groups : G6PD deficiency
Description : Increased risk of potentially fatal hemolysis.
References :

  1. Burgoine KL, Bancone G, Nosten F: The reality of using primaquine. Malar J. 2010 Dec 27;9:376. doi: 10.1186/1475-2875-9-376. [PubMed:21184691 ]
  2. Primaquine[package insert]. Bridgewater, New Jersey: Sanofi-Aventis U.S. LLC; 2016. [Link]

PMID: 15715470

Primaquine

By

Primaquine

Product: Schisandrin B

Identifier : DBSNPE002806
Drug : DB01087 (Primaquine)
Interacting Gene/Enzyme : Glucose-6-phosphate 1-dehydrogenase
Gene Name : G6PD
UniProt ID : P11413
Defining Change(s) :

  • 1284C->A

Allele Name : Georgia
Genotype(s) : Not Available
Type(s) : ADR Inferred
Groups : G6PD deficiency
Description : Increased risk of potentially fatal hemolysis.
References :

  1. Burgoine KL, Bancone G, Nosten F: The reality of using primaquine. Malar J. 2010 Dec 27;9:376. doi: 10.1186/1475-2875-9-376. [PubMed:21184691 ]
  2. Primaquine[package insert]. Bridgewater, New Jersey: Sanofi-Aventis U.S. LLC; 2016. [Link]

PMID: 16497787

Primaquine

By

Primaquine

Product: Macelignan

Identifier : DBSNPE002807
Drug : DB01087 (Primaquine)
Interacting Gene/Enzyme : Glucose-6-phosphate 1-dehydrogenase
Gene Name : G6PD
UniProt ID : P11413
Defining Change(s) :

  • 1292T->G

Allele Name : Sumare
Genotype(s) : Not Available
Type(s) : ADR Inferred
Groups : G6PD deficiency
Description : Increased risk of potentially fatal hemolysis.
References :

  1. Burgoine KL, Bancone G, Nosten F: The reality of using primaquine. Malar J. 2010 Dec 27;9:376. doi: 10.1186/1475-2875-9-376. [PubMed:21184691 ]
  2. Primaquine[package insert]. Bridgewater, New Jersey: Sanofi-Aventis U.S. LLC; 2016. [Link]

PMID: 15450938

Primaquine

By

Primaquine

Product: Alantolactone

Identifier : DBSNPE002808
Drug : DB01087 (Primaquine)
Interacting Gene/Enzyme : Glucose-6-phosphate 1-dehydrogenase
Gene Name : G6PD
UniProt ID : P11413
Defining Change(s) :

  • 1318C->T

Allele Name : Telti/Kobe
Genotype(s) : Not Available
Type(s) : ADR Inferred
Groups : G6PD deficiency
Description : Increased risk of potentially fatal hemolysis.
References :

  1. Burgoine KL, Bancone G, Nosten F: The reality of using primaquine. Malar J. 2010 Dec 27;9:376. doi: 10.1186/1475-2875-9-376. [PubMed:21184691 ]
  2. Primaquine[package insert]. Bridgewater, New Jersey: Sanofi-Aventis U.S. LLC; 2016. [Link]

PMID: 21894430

Primaquine

By

Primaquine

Product: Albiflorin

Identifier : DBSNPE002809
Drug : DB01087 (Primaquine)
Interacting Gene/Enzyme : Glucose-6-phosphate 1-dehydrogenase
Gene Name : G6PD
UniProt ID : P11413
Defining Change(s) :

  • 1339G->A

Allele Name : Santiago de Cuba, Morioka
Genotype(s) : Not Available
Type(s) : ADR Inferred
Groups : G6PD deficiency
Description : Increased risk of potentially fatal hemolysis.
References :

  1. Burgoine KL, Bancone G, Nosten F: The reality of using primaquine. Malar J. 2010 Dec 27;9:376. doi: 10.1186/1475-2875-9-376. [PubMed:21184691 ]
  2. Primaquine[package insert]. Bridgewater, New Jersey: Sanofi-Aventis U.S. LLC; 2016. [Link]

PMID: 17164759

Primaquine

By

Primaquine

Product: Icariin

Identifier : DBSNPE002810
Drug : DB01087 (Primaquine)
Interacting Gene/Enzyme : Glucose-6-phosphate 1-dehydrogenase
Gene Name : G6PD
UniProt ID : P11413
Defining Change(s) :

  • 1358T->A

Allele Name : Harima
Genotype(s) : Not Available
Type(s) : ADR Inferred
Groups : G6PD deficiency
Description : Increased risk of potentially fatal hemolysis.
References :

  1. Burgoine KL, Bancone G, Nosten F: The reality of using primaquine. Malar J. 2010 Dec 27;9:376. doi: 10.1186/1475-2875-9-376. [PubMed:21184691 ]
  2. Primaquine[package insert]. Bridgewater, New Jersey: Sanofi-Aventis U.S. LLC; 2016. [Link]

PMID: 15138583

Primaquine

By

Primaquine

Product: Baohuoside I

Identifier : DBSNPE002811
Drug : DB01087 (Primaquine)
Interacting Gene/Enzyme : Glucose-6-phosphate 1-dehydrogenase
Gene Name : G6PD
UniProt ID : P11413
Defining Change(s) :

  • 1366G->C

Allele Name : Figuera da Foz
Genotype(s) : Not Available
Type(s) : ADR Inferred
Groups : G6PD deficiency
Description : Increased risk of potentially fatal hemolysis.
References :

  1. Burgoine KL, Bancone G, Nosten F: The reality of using primaquine. Malar J. 2010 Dec 27;9:376. doi: 10.1186/1475-2875-9-376. [PubMed:21184691 ]
  2. Primaquine[package insert]. Bridgewater, New Jersey: Sanofi-Aventis U.S. LLC; 2016. [Link]

PMID: 26664810

Primaquine

By

Primaquine

Product: XL-647

Identifier : DBSNPE002812
Drug : DB01087 (Primaquine)
Interacting Gene/Enzyme : Glucose-6-phosphate 1-dehydrogenase
Gene Name : G6PD
UniProt ID : P11413
Defining Change(s) :

  • 1367A>T

Allele Name : Amiens
Genotype(s) : Not Available
Type(s) : ADR Inferred
Groups : G6PD deficiency
Description : Increased risk of potentially fatal hemolysis.
References :

  1. Burgoine KL, Bancone G, Nosten F: The reality of using primaquine. Malar J. 2010 Dec 27;9:376. doi: 10.1186/1475-2875-9-376. [PubMed:21184691 ]
  2. Primaquine[package insert]. Bridgewater, New Jersey: Sanofi-Aventis U.S. LLC; 2016. [Link]

PMID: 20139990

Primaquine

By

Primaquine

Product: Z-Ile-Leu-aldehyde

Identifier : DBSNPE002813
Drug : DB01087 (Primaquine)
Interacting Gene/Enzyme : Glucose-6-phosphate 1-dehydrogenase
Gene Name : G6PD
UniProt ID : P11413
Defining Change(s) :

  • 1376G->T, 1502T->G

Allele Name : Bangkok Noi
Genotype(s) : Not Available
Type(s) : ADR Inferred
Groups : G6PD deficiency
Description : Increased risk of potentially fatal hemolysis.
References :

  1. Burgoine KL, Bancone G, Nosten F: The reality of using primaquine. Malar J. 2010 Dec 27;9:376. doi: 10.1186/1475-2875-9-376. [PubMed:21184691 ]
  2. Primaquine[package insert]. Bridgewater, New Jersey: Sanofi-Aventis U.S. LLC; 2016. [Link]

PMID: 11831887

Primaquine

By

Primaquine

Product: 4-Azido-L-phenylalanine (hydrochloride)

Identifier : DBSNPE002814
Drug : DB01087 (Primaquine)
Interacting Gene/Enzyme : Glucose-6-phosphate 1-dehydrogenase
Gene Name : G6PD
UniProt ID : P11413
Defining Change(s) :

  • 1462G->A

Allele Name : Fukaya
Genotype(s) : Not Available
Type(s) : ADR Inferred
Groups : G6PD deficiency
Description : Increased risk of potentially fatal hemolysis.
References :

  1. Burgoine KL, Bancone G, Nosten F: The reality of using primaquine. Malar J. 2010 Dec 27;9:376. doi: 10.1186/1475-2875-9-376. [PubMed:21184691 ]
  2. Primaquine[package insert]. Bridgewater, New Jersey: Sanofi-Aventis U.S. LLC; 2016. [Link]

PMID: 11309347

Primaquine

By

Primaquine

Product: 4-Azido-L-phenylalanine

Identifier : DBSNPE002815
Drug : DB01087 (Primaquine)
Interacting Gene/Enzyme : Glucose-6-phosphate 1-dehydrogenase
Gene Name : G6PD
UniProt ID : P11413
Defining Change(s) :

  • 1463G->T

Allele Name : Campinas
Genotype(s) : Not Available
Type(s) : ADR Inferred
Groups : G6PD deficiency
Description : Increased risk of potentially fatal hemolysis.
References :

  1. Burgoine KL, Bancone G, Nosten F: The reality of using primaquine. Malar J. 2010 Dec 27;9:376. doi: 10.1186/1475-2875-9-376. [PubMed:21184691 ]
  2. Primaquine[package insert]. Bridgewater, New Jersey: Sanofi-Aventis U.S. LLC; 2016. [Link]

PMID: 15078986

Primaquine

By

Primaquine

Product: (S)-(-)-5-Fluorowillardiine (hydrochloride)

Identifier : DBSNPE002816
Drug : DB01087 (Primaquine)
Interacting Gene/Enzyme : Glucose-6-phosphate 1-dehydrogenase
Gene Name : G6PD
UniProt ID : P11413
Defining Change(s) :

  • 1465C>T

Allele Name : Buenos Aires
Genotype(s) : Not Available
Type(s) : ADR Inferred
Groups : G6PD deficiency
Description : Increased risk of potentially fatal hemolysis.
References :

  1. Burgoine KL, Bancone G, Nosten F: The reality of using primaquine. Malar J. 2010 Dec 27;9:376. doi: 10.1186/1475-2875-9-376. [PubMed:21184691 ]
  2. Primaquine[package insert]. Bridgewater, New Jersey: Sanofi-Aventis U.S. LLC; 2016. [Link]

PMID: 11304533

Primaquine

By

Primaquine

Product: (S)-(-)-5-Fluorowillardiine

Identifier : DBSNPE002817
Drug : DB01087 (Primaquine)
Interacting Gene/Enzyme : Glucose-6-phosphate 1-dehydrogenase
Gene Name : G6PD
UniProt ID : P11413
Defining Change(s) :

  • 1466C->T

Allele Name : Arakawa
Genotype(s) : Not Available
Type(s) : ADR Inferred
Groups : G6PD deficiency
Description : Increased risk of potentially fatal hemolysis.
References :

  1. Burgoine KL, Bancone G, Nosten F: The reality of using primaquine. Malar J. 2010 Dec 27;9:376. doi: 10.1186/1475-2875-9-376. [PubMed:21184691 ]
  2. Primaquine[package insert]. Bridgewater, New Jersey: Sanofi-Aventis U.S. LLC; 2016. [Link]

PMID: 9501205

Primaquine

By

Primaquine

Product: FGH10019

Identifier : DBSNPE002818
Drug : DB01087 (Primaquine)
Interacting Gene/Enzyme : Glucose-6-phosphate 1-dehydrogenase
Gene Name : G6PD
UniProt ID : P11413
Defining Change(s) :

  • 1488_1490delGAA

Allele Name : Brighton
Genotype(s) : Not Available
Type(s) : ADR Inferred
Groups : G6PD deficiency
Description : Increased risk of potentially fatal hemolysis.
References :

  1. Burgoine KL, Bancone G, Nosten F: The reality of using primaquine. Malar J. 2010 Dec 27;9:376. doi: 10.1186/1475-2875-9-376. [PubMed:21184691 ]
  2. Primaquine[package insert]. Bridgewater, New Jersey: Sanofi-Aventis U.S. LLC; 2016. [Link]

PMID: 10866300

Primaquine

By

Primaquine

Product: Methoxy-PEPy

Identifier : DBSNPE002819
Drug : DB01087 (Primaquine)
Interacting Gene/Enzyme : Glucose-6-phosphate 1-dehydrogenase
Gene Name : G6PD
UniProt ID : P11413
Defining Change(s) :

  • 159G->C

Allele Name : Kozukata
Genotype(s) : Not Available
Type(s) : ADR Inferred
Groups : G6PD deficiency
Description : Increased risk of potentially fatal hemolysis.
References :

  1. Burgoine KL, Bancone G, Nosten F: The reality of using primaquine. Malar J. 2010 Dec 27;9:376. doi: 10.1186/1475-2875-9-376. [PubMed:21184691 ]
  2. Primaquine[package insert]. Bridgewater, New Jersey: Sanofi-Aventis U.S. LLC; 2016. [Link]

PMID: 20010553

Primaquine

By

Primaquine

Product: PEPA

Identifier : DBSNPE002820
Drug : DB01087 (Primaquine)
Interacting Gene/Enzyme : Glucose-6-phosphate 1-dehydrogenase
Gene Name : G6PD
UniProt ID : P11413
Defining Change(s) :

  • 180_182delTCT

Allele Name : Amsterdam
Genotype(s) : Not Available
Type(s) : ADR Inferred
Groups : G6PD deficiency
Description : Increased risk of potentially fatal hemolysis.
References :

  1. Burgoine KL, Bancone G, Nosten F: The reality of using primaquine. Malar J. 2010 Dec 27;9:376. doi: 10.1186/1475-2875-9-376. [PubMed:21184691 ]
  2. Primaquine[package insert]. Bridgewater, New Jersey: Sanofi-Aventis U.S. LLC; 2016. [Link]

PMID: 20554530

Primaquine

By

Primaquine

Product: CMPDA

Identifier : DBSNPE002821
Drug : DB01087 (Primaquine)
Interacting Gene/Enzyme : Glucose-6-phosphate 1-dehydrogenase
Gene Name : G6PD
UniProt ID : P11413
Defining Change(s) :

  • 202G->A, 376A->G, 1264C>G

Allele Name : No name
Genotype(s) : Not Available
Type(s) : ADR Inferred
Groups : G6PD deficiency
Description : Increased risk of potentially fatal hemolysis.
References :

  1. Burgoine KL, Bancone G, Nosten F: The reality of using primaquine. Malar J. 2010 Dec 27;9:376. doi: 10.1186/1475-2875-9-376. [PubMed:21184691 ]
  2. Primaquine[package insert]. Bridgewater, New Jersey: Sanofi-Aventis U.S. LLC; 2016. [Link]

PMID: 19911386

Primaquine

By

Primaquine

Product: Naspm (trihydrochloride)

Identifier : DBSNPE002822
Drug : DB01087 (Primaquine)
Interacting Gene/Enzyme : Glucose-6-phosphate 1-dehydrogenase
Gene Name : G6PD
UniProt ID : P11413
Defining Change(s) :

  • 224T->C

Allele Name : Swansea
Genotype(s) : Not Available
Type(s) : ADR Inferred
Groups : G6PD deficiency
Description : Increased risk of potentially fatal hemolysis.
References :

  1. Burgoine KL, Bancone G, Nosten F: The reality of using primaquine. Malar J. 2010 Dec 27;9:376. doi: 10.1186/1475-2875-9-376. [PubMed:21184691 ]
  2. Primaquine[package insert]. Bridgewater, New Jersey: Sanofi-Aventis U.S. LLC; 2016. [Link]

PMID: 20039312

Primaquine

By

Primaquine

Product: Naspm

Identifier : DBSNPE002823
Drug : DB01087 (Primaquine)
Interacting Gene/Enzyme : Glucose-6-phosphate 1-dehydrogenase
Gene Name : G6PD
UniProt ID : P11413
Defining Change(s) :

  • 281_283delAGA

Allele Name : Urayasu
Genotype(s) : Not Available
Type(s) : ADR Inferred
Groups : G6PD deficiency
Description : Increased risk of potentially fatal hemolysis.
References :

  1. Burgoine KL, Bancone G, Nosten F: The reality of using primaquine. Malar J. 2010 Dec 27;9:376. doi: 10.1186/1475-2875-9-376. [PubMed:21184691 ]
  2. Primaquine[package insert]. Bridgewater, New Jersey: Sanofi-Aventis U.S. LLC; 2016. [Link]

PMID: 649576

Primaquine

By

Primaquine

Product: CX546

Identifier : DBSNPE002824
Drug : DB01087 (Primaquine)
Interacting Gene/Enzyme : Glucose-6-phosphate 1-dehydrogenase
Gene Name : G6PD
UniProt ID : P11413
Defining Change(s) :

  • 317C->G544C->T592C->T

Allele Name : Vancouver
Genotype(s) : Not Available
Type(s) : ADR Inferred
Groups : G6PD deficiency
Description : Increased risk of potentially fatal hemolysis.
References :

  1. Burgoine KL, Bancone G, Nosten F: The reality of using primaquine. Malar J. 2010 Dec 27;9:376. doi: 10.1186/1475-2875-9-376. [PubMed:21184691 ]
  2. Primaquine[package insert]. Bridgewater, New Jersey: Sanofi-Aventis U.S. LLC; 2016. [Link]

PMID: 19778726

Primaquine

By

Primaquine

Product: ITI214

Identifier : DBSNPE002825
Drug : DB01087 (Primaquine)
Interacting Gene/Enzyme : Glucose-6-phosphate 1-dehydrogenase
Gene Name : G6PD
UniProt ID : P11413
Defining Change(s) :

  • 376A->G, 1159C->T

Allele Name : Mt Sinai
Genotype(s) : Not Available
Type(s) : ADR Inferred
Groups : G6PD deficiency
Description : Increased risk of potentially fatal hemolysis.
References :

  1. Burgoine KL, Bancone G, Nosten F: The reality of using primaquine. Malar J. 2010 Dec 27;9:376. doi: 10.1186/1475-2875-9-376. [PubMed:21184691 ]
  2. Primaquine[package insert]. Bridgewater, New Jersey: Sanofi-Aventis U.S. LLC; 2016. [Link]

PMID: 18953021

Primaquine

By

Primaquine

Product: Pyr6

Identifier : DBSNPE002826
Drug : DB01087 (Primaquine)
Interacting Gene/Enzyme : Glucose-6-phosphate 1-dehydrogenase
Gene Name : G6PD
UniProt ID : P11413
Defining Change(s) :

  • 488G->A

Allele Name : Plymouth
Genotype(s) : Not Available
Type(s) : ADR Inferred
Groups : G6PD deficiency
Description : Increased risk of potentially fatal hemolysis.
References :

  1. Burgoine KL, Bancone G, Nosten F: The reality of using primaquine. Malar J. 2010 Dec 27;9:376. doi: 10.1186/1475-2875-9-376. [PubMed:21184691 ]
  2. Primaquine[package insert]. Bridgewater, New Jersey: Sanofi-Aventis U.S. LLC; 2016. [Link]

PMID: 18463734

Primaquine

By

Primaquine

Product: CFM-2

Identifier : DBSNPE002827
Drug : DB01087 (Primaquine)
Interacting Gene/Enzyme : Glucose-6-phosphate 1-dehydrogenase
Gene Name : G6PD
UniProt ID : P11413
Defining Change(s) :

  • 514C->T

Allele Name : Volendam
Genotype(s) : Not Available
Type(s) : ADR Inferred
Groups : G6PD deficiency
Description : Increased risk of potentially fatal hemolysis.
References :

  1. Burgoine KL, Bancone G, Nosten F: The reality of using primaquine. Malar J. 2010 Dec 27;9:376. doi: 10.1186/1475-2875-9-376. [PubMed:21184691 ]
  2. Primaquine[package insert]. Bridgewater, New Jersey: Sanofi-Aventis U.S. LLC; 2016. [Link]

PMID: 17929798

Primaquine

By

Primaquine

Product: Efonidipine (hydrochloride)

Identifier : DBSNPE002828
Drug : DB01087 (Primaquine)
Interacting Gene/Enzyme : Glucose-6-phosphate 1-dehydrogenase
Gene Name : G6PD
UniProt ID : P11413
Defining Change(s) :

  • 527A->G

Allele Name : Shinshu
Genotype(s) : Not Available
Type(s) : ADR Inferred
Groups : G6PD deficiency
Description : Increased risk of potentially fatal hemolysis.
References :

  1. Burgoine KL, Bancone G, Nosten F: The reality of using primaquine. Malar J. 2010 Dec 27;9:376. doi: 10.1186/1475-2875-9-376. [PubMed:21184691 ]
  2. Primaquine[package insert]. Bridgewater, New Jersey: Sanofi-Aventis U.S. LLC; 2016. [Link]

PMID: 19036992

Primaquine

By

Primaquine

Product: Efonidipine

Identifier : DBSNPE002829
Drug : DB01087 (Primaquine)
Interacting Gene/Enzyme : Glucose-6-phosphate 1-dehydrogenase
Gene Name : G6PD
UniProt ID : P11413
Defining Change(s) :

  • 535A->T

Allele Name : Chikugo
Genotype(s) : Not Available
Type(s) : ADR Inferred
Groups : G6PD deficiency
Description : Increased risk of potentially fatal hemolysis.
References :

  1. Burgoine KL, Bancone G, Nosten F: The reality of using primaquine. Malar J. 2010 Dec 27;9:376. doi: 10.1186/1475-2875-9-376. [PubMed:21184691 ]
  2. Primaquine[package insert]. Bridgewater, New Jersey: Sanofi-Aventis U.S. LLC; 2016. [Link]

PMID: 12770821

Primaquine

By

Primaquine

Product: Efonidipine (hydrochloride monoethanolate)

Identifier : DBSNPE002830
Drug : DB01087 (Primaquine)
Interacting Gene/Enzyme : Glucose-6-phosphate 1-dehydrogenase
Gene Name : G6PD
UniProt ID : P11413
Defining Change(s) :

  • 561_563delCTC

Allele Name : Tsukui
Genotype(s) : Not Available
Type(s) : ADR Inferred
Groups : G6PD deficiency
Description : Increased risk of potentially fatal hemolysis.
References :

  1. Burgoine KL, Bancone G, Nosten F: The reality of using primaquine. Malar J. 2010 Dec 27;9:376. doi: 10.1186/1475-2875-9-376. [PubMed:21184691 ]
  2. Primaquine[package insert]. Bridgewater, New Jersey: Sanofi-Aventis U.S. LLC; 2016. [Link]

PMID: 12677000

Primaquine

By

Primaquine

Product: ITI214 (free base)

Identifier : DBSNPE002831
Drug : DB01087 (Primaquine)
Interacting Gene/Enzyme : Glucose-6-phosphate 1-dehydrogenase
Gene Name : G6PD
UniProt ID : P11413
Defining Change(s) :

  • 573C>G

Allele Name : Pedoplis-Ckaro
Genotype(s) : Not Available
Type(s) : ADR Inferred
Groups : G6PD deficiency
Description : Increased risk of potentially fatal hemolysis.
References :

  1. Burgoine KL, Bancone G, Nosten F: The reality of using primaquine. Malar J. 2010 Dec 27;9:376. doi: 10.1186/1475-2875-9-376. [PubMed:21184691 ]
  2. Primaquine[package insert]. Bridgewater, New Jersey: Sanofi-Aventis U.S. LLC; 2016. [Link]

PMID: 25699604

Primaquine

By

Primaquine

Product: Zatebradine (hydrochloride)

Identifier : DBSNPE002833
Drug : DB01087 (Primaquine)
Interacting Gene/Enzyme : Glucose-6-phosphate 1-dehydrogenase
Gene Name : G6PD
UniProt ID : P11413
Defining Change(s) :

  • 637G->T

Allele Name : Minnesota, Marion, Gastonia, LeJeune
Genotype(s) : Not Available
Type(s) : ADR Inferred
Groups : G6PD deficiency
Description : Increased risk of potentially fatal hemolysis.
References :

  1. Burgoine KL, Bancone G, Nosten F: The reality of using primaquine. Malar J. 2010 Dec 27;9:376. doi: 10.1186/1475-2875-9-376. [PubMed:21184691 ]
  2. Primaquine[package insert]. Bridgewater, New Jersey: Sanofi-Aventis U.S. LLC; 2016. [Link]

PMID: 19668186

Primaquine

By

Primaquine

Product: (S)-Willardiine

Identifier : DBSNPE002834
Drug : DB01087 (Primaquine)
Interacting Gene/Enzyme : Glucose-6-phosphate 1-dehydrogenase
Gene Name : G6PD
UniProt ID : P11413
Defining Change(s) :

  • 637G->T, 1037A->T

Allele Name : Cincinnati
Genotype(s) : Not Available
Type(s) : ADR Inferred
Groups : G6PD deficiency
Description : Increased risk of potentially fatal hemolysis.
References :

  1. Burgoine KL, Bancone G, Nosten F: The reality of using primaquine. Malar J. 2010 Dec 27;9:376. doi: 10.1186/1475-2875-9-376. [PubMed:21184691 ]
  2. Primaquine[package insert]. Bridgewater, New Jersey: Sanofi-Aventis U.S. LLC; 2016. [Link]

PMID: 19818706

Primaquine

By

Primaquine

Product: Bay-K-8644 ((S)-(-)-)

Identifier : DBSNPE002835
Drug : DB01087 (Primaquine)
Interacting Gene/Enzyme : Glucose-6-phosphate 1-dehydrogenase
Gene Name : G6PD
UniProt ID : P11413
Defining Change(s) :

  • 648T->G

Allele Name : Harilaou
Genotype(s) : Not Available
Type(s) : ADR Inferred
Groups : G6PD deficiency
Description : Increased risk of potentially fatal hemolysis.
References :

  1. Burgoine KL, Bancone G, Nosten F: The reality of using primaquine. Malar J. 2010 Dec 27;9:376. doi: 10.1186/1475-2875-9-376. [PubMed:21184691 ]
  2. Primaquine[package insert]. Bridgewater, New Jersey: Sanofi-Aventis U.S. LLC; 2016. [Link]

PMID: 19515722

Primaquine

By

Primaquine

Product: Bay-K-8644 ((R)-(+)-)

Identifier : DBSNPE002836
Drug : DB01087 (Primaquine)
Interacting Gene/Enzyme : Glucose-6-phosphate 1-dehydrogenase
Gene Name : G6PD
UniProt ID : P11413
Defining Change(s) :

  • 683_685delACA

Allele Name : North Dallas
Genotype(s) : Not Available
Type(s) : ADR Inferred
Groups : G6PD deficiency
Description : Increased risk of potentially fatal hemolysis.
References :

  1. Burgoine KL, Bancone G, Nosten F: The reality of using primaquine. Malar J. 2010 Dec 27;9:376. doi: 10.1186/1475-2875-9-376. [PubMed:21184691 ]
  2. Primaquine[package insert]. Bridgewater, New Jersey: Sanofi-Aventis U.S. LLC; 2016. [Link]

PMID: 16862141

Primaquine

By

Primaquine

Product: CNX-1351

Identifier : DBSNPE002837
Drug : DB01087 (Primaquine)
Interacting Gene/Enzyme : Glucose-6-phosphate 1-dehydrogenase
Gene Name : G6PD
UniProt ID : P11413
Defining Change(s) :

  • 695G->A

Allele Name : Asahikawa
Genotype(s) : Not Available
Type(s) : ADR Inferred
Groups : G6PD deficiency
Description : Increased risk of potentially fatal hemolysis.
References :

  1. Burgoine KL, Bancone G, Nosten F: The reality of using primaquine. Malar J. 2010 Dec 27;9:376. doi: 10.1186/1475-2875-9-376. [PubMed:21184691 ]
  2. Primaquine[package insert]. Bridgewater, New Jersey: Sanofi-Aventis U.S. LLC; 2016. [Link]

PMID: 25870060

Primaquine

By

Primaquine

Product: Butylphthalide

Identifier : DBSNPE002838
Drug : DB01087 (Primaquine)
Interacting Gene/Enzyme : Glucose-6-phosphate 1-dehydrogenase
Gene Name : G6PD
UniProt ID : P11413
Defining Change(s) :

  • 713A->G

Allele Name : Durham
Genotype(s) : Not Available
Type(s) : ADR Inferred
Groups : G6PD deficiency
Description : Increased risk of potentially fatal hemolysis.
References :

  1. Burgoine KL, Bancone G, Nosten F: The reality of using primaquine. Malar J. 2010 Dec 27;9:376. doi: 10.1186/1475-2875-9-376. [PubMed:21184691 ]
  2. Primaquine[package insert]. Bridgewater, New Jersey: Sanofi-Aventis U.S. LLC; 2016. [Link]

PMID: 20736344

Primaquine

By

Primaquine

Product: CTX-0294885

Identifier : DBSNPE002839
Drug : DB01087 (Primaquine)
Interacting Gene/Enzyme : Glucose-6-phosphate 1-dehydrogenase
Gene Name : G6PD
UniProt ID : P11413
Defining Change(s) :

  • 724_729delGGCACT

Allele Name : Stonybrook
Genotype(s) : Not Available
Type(s) : ADR Inferred
Groups : G6PD deficiency
Description : Increased risk of potentially fatal hemolysis.
References :

  1. Burgoine KL, Bancone G, Nosten F: The reality of using primaquine. Malar J. 2010 Dec 27;9:376. doi: 10.1186/1475-2875-9-376. [PubMed:21184691 ]
  2. Primaquine[package insert]. Bridgewater, New Jersey: Sanofi-Aventis U.S. LLC; 2016. [Link]

PMID: 21526763

Primaquine

By

Primaquine

Product: Exherin (trifluoroacetate)

Identifier : DBSNPE002840
Drug : DB01087 (Primaquine)
Interacting Gene/Enzyme : Glucose-6-phosphate 1-dehydrogenase
Gene Name : G6PD
UniProt ID : P11413
Defining Change(s) :

  • 769C->G

Allele Name : Wayne
Genotype(s) : Not Available
Type(s) : ADR Inferred
Groups : G6PD deficiency
Description : Increased risk of potentially fatal hemolysis.
References :

  1. Burgoine KL, Bancone G, Nosten F: The reality of using primaquine. Malar J. 2010 Dec 27;9:376. doi: 10.1186/1475-2875-9-376. [PubMed:21184691 ]
  2. Primaquine[package insert]. Bridgewater, New Jersey: Sanofi-Aventis U.S. LLC; 2016. [Link]

PMID: 20608738

Primaquine

By

Primaquine

Product: LDC1267

Identifier : DBSNPE002841
Drug : DB01087 (Primaquine)
Interacting Gene/Enzyme : Glucose-6-phosphate 1-dehydrogenase
Gene Name : G6PD
UniProt ID : P11413
Defining Change(s) :

  • 806G->A

Allele Name : Aveiro
Genotype(s) : Not Available
Type(s) : ADR Inferred
Groups : G6PD deficiency
Description : Increased risk of potentially fatal hemolysis.
References :

  1. Burgoine KL, Bancone G, Nosten F: The reality of using primaquine. Malar J. 2010 Dec 27;9:376. doi: 10.1186/1475-2875-9-376. [PubMed:21184691 ]
  2. Primaquine[package insert]. Bridgewater, New Jersey: Sanofi-Aventis U.S. LLC; 2016. [Link]

PMID: 20012863

Primaquine

By

Primaquine

Product: ISRIB (trans-isomer)

Identifier : DBSNPE002842
Drug : DB01087 (Primaquine)
Interacting Gene/Enzyme : Glucose-6-phosphate 1-dehydrogenase
Gene Name : G6PD
UniProt ID : P11413
Defining Change(s) :

  • 820G->A

Allele Name : Cleveland Corum
Genotype(s) : Not Available
Type(s) : ADR Inferred
Groups : G6PD deficiency
Description : Increased risk of potentially fatal hemolysis.
References :

  1. Burgoine KL, Bancone G, Nosten F: The reality of using primaquine. Malar J. 2010 Dec 27;9:376. doi: 10.1186/1475-2875-9-376. [PubMed:21184691 ]
  2. Primaquine[package insert]. Bridgewater, New Jersey: Sanofi-Aventis U.S. LLC; 2016. [Link]

PMID: 19256508

Primaquine

By

Primaquine

Product: Eflornithine (hydrochloride, hydrate)

Identifier : DBSNPE002844
Drug : DB01087 (Primaquine)
Interacting Gene/Enzyme : Glucose-6-phosphate 1-dehydrogenase
Gene Name : G6PD
UniProt ID : P11413
Defining Change(s) :

  • 825G>C

Allele Name : Bangkok
Genotype(s) : Not Available
Type(s) : ADR Inferred
Groups : G6PD deficiency
Description : Increased risk of potentially fatal hemolysis.
References :

  1. Burgoine KL, Bancone G, Nosten F: The reality of using primaquine. Malar J. 2010 Dec 27;9:376. doi: 10.1186/1475-2875-9-376. [PubMed:21184691 ]
  2. Primaquine[package insert]. Bridgewater, New Jersey: Sanofi-Aventis U.S. LLC; 2016. [Link]

PMID: 26587836

Primaquine

By

Primaquine

Product: Foresaconitine

Identifier : DBSNPE002845
Drug : DB01087 (Primaquine)
Interacting Gene/Enzyme : Glucose-6-phosphate 1-dehydrogenase
Gene Name : G6PD
UniProt ID : P11413
Defining Change(s) :

  • 826C->T

Allele Name : Sugao
Genotype(s) : Not Available
Type(s) : ADR Inferred
Groups : G6PD deficiency
Description : Increased risk of potentially fatal hemolysis.
References :

  1. Burgoine KL, Bancone G, Nosten F: The reality of using primaquine. Malar J. 2010 Dec 27;9:376. doi: 10.1186/1475-2875-9-376. [PubMed:21184691 ]
  2. Primaquine[package insert]. Bridgewater, New Jersey: Sanofi-Aventis U.S. LLC; 2016. [Link]

PMID: 25391649

Primaquine

By

Primaquine

Product: Yunaconitine

Identifier : DBSNPE002846
Drug : DB01087 (Primaquine)
Interacting Gene/Enzyme : Glucose-6-phosphate 1-dehydrogenase
Gene Name : G6PD
UniProt ID : P11413
Defining Change(s) :

  • 832T->C

Allele Name : La Jolla
Genotype(s) : Not Available
Type(s) : ADR Inferred
Groups : G6PD deficiency
Description : Increased risk of potentially fatal hemolysis.
References :

  1. Burgoine KL, Bancone G, Nosten F: The reality of using primaquine. Malar J. 2010 Dec 27;9:376. doi: 10.1186/1475-2875-9-376. [PubMed:21184691 ]
  2. Primaquine[package insert]. Bridgewater, New Jersey: Sanofi-Aventis U.S. LLC; 2016. [Link]

PMID: 25753354

Primaquine

By

Primaquine

Product: Zatebradine

Identifier : DBSNPE002847
Drug : DB01087 (Primaquine)
Interacting Gene/Enzyme : Glucose-6-phosphate 1-dehydrogenase
Gene Name : G6PD
UniProt ID : P11413
Defining Change(s) :

  • 833C->T

Allele Name : Wexham
Genotype(s) : Not Available
Type(s) : ADR Inferred
Groups : G6PD deficiency
Description : Increased risk of potentially fatal hemolysis.
References :

  1. Burgoine KL, Bancone G, Nosten F: The reality of using primaquine. Malar J. 2010 Dec 27;9:376. doi: 10.1186/1475-2875-9-376. [PubMed:21184691 ]
  2. Primaquine[package insert]. Bridgewater, New Jersey: Sanofi-Aventis U.S. LLC; 2016. [Link]

PMID: 25940345

Primaquine

By

Primaquine

Product: GV-58

Identifier : DBSNPE002848
Drug : DB01087 (Primaquine)
Interacting Gene/Enzyme : Glucose-6-phosphate 1-dehydrogenase
Gene Name : G6PD
UniProt ID : P11413
Defining Change(s) :

  • 851T>C

Allele Name : Piodivkow
Genotype(s) : Not Available
Type(s) : ADR Inferred
Groups : G6PD deficiency
Description : Increased risk of potentially fatal hemolysis.
References :

  1. Burgoine KL, Bancone G, Nosten F: The reality of using primaquine. Malar J. 2010 Dec 27;9:376. doi: 10.1186/1475-2875-9-376. [PubMed:21184691 ]
  2. Primaquine[package insert]. Bridgewater, New Jersey: Sanofi-Aventis U.S. LLC; 2016. [Link]

PMID: 25018089

Primaquine

By

Primaquine

Product: ANA-12

Identifier : DBSNPE002849
Drug : DB01087 (Primaquine)
Interacting Gene/Enzyme : Glucose-6-phosphate 1-dehydrogenase
Gene Name : G6PD
UniProt ID : P11413
Defining Change(s) :

  • 910G->T

Allele Name : West Virginia
Genotype(s) : Not Available
Type(s) : ADR Inferred
Groups : G6PD deficiency
Description : Increased risk of potentially fatal hemolysis.
References :

  1. Burgoine KL, Bancone G, Nosten F: The reality of using primaquine. Malar J. 2010 Dec 27;9:376. doi: 10.1186/1475-2875-9-376. [PubMed:21184691 ]
  2. Primaquine[package insert]. Bridgewater, New Jersey: Sanofi-Aventis U.S. LLC; 2016. [Link]

PMID: 23572559

Primaquine

By

Primaquine

Product: NS-1619

Identifier : DBSNPE002850
Drug : DB01087 (Primaquine)
Interacting Gene/Enzyme : Glucose-6-phosphate 1-dehydrogenase
Gene Name : G6PD
UniProt ID : P11413
Defining Change(s) :

  • 921G->C

Allele Name : Omiya
Genotype(s) : Not Available
Type(s) : ADR Inferred
Groups : G6PD deficiency
Description : Increased risk of potentially fatal hemolysis.
References :

  1. Burgoine KL, Bancone G, Nosten F: The reality of using primaquine. Malar J. 2010 Dec 27;9:376. doi: 10.1186/1475-2875-9-376. [PubMed:21184691 ]
  2. Primaquine[package insert]. Bridgewater, New Jersey: Sanofi-Aventis U.S. LLC; 2016. [Link]

PMID: 24260102

Primaquine

By

Primaquine

Product: ZK200775 (hydrate)

Identifier : DBSNPE002851
Drug : DB01087 (Primaquine)
Interacting Gene/Enzyme : Glucose-6-phosphate 1-dehydrogenase
Gene Name : G6PD
UniProt ID : P11413
Defining Change(s) :

  • 953_976delCCACCAAAGGGTACCTGGAC GACC

Allele Name : Nara
Genotype(s) : Not Available
Type(s) : ADR Inferred
Groups : G6PD deficiency
Description : Increased risk of potentially fatal hemolysis.
References :

  1. Burgoine KL, Bancone G, Nosten F: The reality of using primaquine. Malar J. 2010 Dec 27;9:376. doi: 10.1186/1475-2875-9-376. [PubMed:21184691 ]
  2. Primaquine[package insert]. Bridgewater, New Jersey: Sanofi-Aventis U.S. LLC; 2016. [Link]

PMID: 21896482

Primaquine

By

Primaquine

Product: ZK200775

Identifier : DBSNPE002852
Drug : DB01087 (Primaquine)
Interacting Gene/Enzyme : Glucose-6-phosphate 1-dehydrogenase
Gene Name : G6PD
UniProt ID : P11413
Defining Change(s) :

  • 962G->A

Allele Name : Manhattan
Genotype(s) : Not Available
Type(s) : ADR Inferred
Groups : G6PD deficiency
Description : Increased risk of potentially fatal hemolysis.
References :

  1. Burgoine KL, Bancone G, Nosten F: The reality of using primaquine. Malar J. 2010 Dec 27;9:376. doi: 10.1186/1475-2875-9-376. [PubMed:21184691 ]
  2. Primaquine[package insert]. Bridgewater, New Jersey: Sanofi-Aventis U.S. LLC; 2016. [Link]

PMID: 22022600

Primaquine

By

Primaquine

Product: UNC0379 (trifluoroacetate)

Identifier : DBSNPE002854
Drug : DB01087 (Primaquine)
Interacting Gene/Enzyme : Glucose-6-phosphate 1-dehydrogenase
Gene Name : G6PD
UniProt ID : P11413
Defining Change(s) :

  • 99A->G
  • 1360C->T

Allele Name : Honiara
Genotype(s) : Not Available
Type(s) : ADR Inferred
Groups : G6PD deficiency
Description : Increased risk of potentially fatal hemolysis.
References :

  1. Burgoine KL, Bancone G, Nosten F: The reality of using primaquine. Malar J. 2010 Dec 27;9:376. doi: 10.1186/1475-2875-9-376. [PubMed:21184691 ]
  2. Primaquine[package insert]. Bridgewater, New Jersey: Sanofi-Aventis U.S. LLC; 2016. [Link]

PMID: 18757512

Primaquine

By

Primaquine

Product: GSK2190915 (sodium salt)

Identifier : DBSNPE002855
Drug : DB01087 (Primaquine)
Interacting Gene/Enzyme : Glucose-6-phosphate 1-dehydrogenase
Gene Name : G6PD
UniProt ID : P11413
Defining Change(s) :

  • 1246G->A

Allele Name : Tokyo, Fukushima
Genotype(s) : Not Available
Type(s) : ADR Inferred
Groups : G6PD deficiency
Description : Increased risk of potentially fatal hemolysis.
References :

  1. Burgoine KL, Bancone G, Nosten F: The reality of using primaquine. Malar J. 2010 Dec 27;9:376. doi: 10.1186/1475-2875-9-376. [PubMed:21184691 ]
  2. Primaquine[package insert]. Bridgewater, New Jersey: Sanofi-Aventis U.S. LLC; 2016. [Link]

PMID: 18049481

Primaquine

By

Primaquine

Product: GSK2190915

Identifier : DBSNPE002856
Drug : DB01087 (Primaquine)
Interacting Gene/Enzyme : Glucose-6-phosphate 1-dehydrogenase
Gene Name : G6PD
UniProt ID : P11413
Defining Change(s) :

  • 1003G->A

Allele Name : Chatham
Genotype(s) : Not Available
Type(s) : ADR Inferred
Groups : G6PD deficiency
Description : Increased risk of potentially fatal hemolysis.
References :

  1. Burgoine KL, Bancone G, Nosten F: The reality of using primaquine. Malar J. 2010 Dec 27;9:376. doi: 10.1186/1475-2875-9-376. [PubMed:21184691 ]
  2. Primaquine[package insert]. Bridgewater, New Jersey: Sanofi-Aventis U.S. LLC; 2016. [Link]

PMID: 18395193

Primaquine

By

Primaquine

Product: Lexibulin (dihydrochloride)

Identifier : DBSNPE002858
Drug : DB01087 (Primaquine)
Interacting Gene/Enzyme : Glucose-6-phosphate 1-dehydrogenase
Gene Name : G6PD
UniProt ID : P11413
Defining Change(s) :

  • 1052G->T

Allele Name : Partenope
Genotype(s) : Not Available
Type(s) : ADR Inferred
Groups : G6PD deficiency
Description : Increased risk of potentially fatal hemolysis.
References :

  1. Burgoine KL, Bancone G, Nosten F: The reality of using primaquine. Malar J. 2010 Dec 27;9:376. doi: 10.1186/1475-2875-9-376. [PubMed:21184691 ]
  2. Primaquine[package insert]. Bridgewater, New Jersey: Sanofi-Aventis U.S. LLC; 2016. [Link]

PMID: 19860737

Primaquine

By

Primaquine

Product: Lexibulin

Identifier : DBSNPE002859
Drug : DB01087 (Primaquine)
Interacting Gene/Enzyme : Glucose-6-phosphate 1-dehydrogenase
Gene Name : G6PD
UniProt ID : P11413
Defining Change(s) :

  • 1057C->T

Allele Name : Ierapediva
Genotype(s) : Not Available
Type(s) : ADR Inferred
Groups : G6PD deficiency
Description : Increased risk of potentially fatal hemolysis.
References :

  1. Burgoine KL, Bancone G, Nosten F: The reality of using primaquine. Malar J. 2010 Dec 27;9:376. doi: 10.1186/1475-2875-9-376. [PubMed:21184691 ]
  2. Primaquine[package insert]. Bridgewater, New Jersey: Sanofi-Aventis U.S. LLC; 2016. [Link]

PMID: 12154051

Primaquine

By

Primaquine

Product: LY-2584702 (hydrochloride)

Identifier : DBSNPE002860
Drug : DB01087 (Primaquine)
Interacting Gene/Enzyme : Glucose-6-phosphate 1-dehydrogenase
Gene Name : G6PD
UniProt ID : P11413
Defining Change(s) :

  • 1193A->G

Allele Name : Anadia
Genotype(s) : Not Available
Type(s) : ADR Inferred
Groups : G6PD deficiency
Description : Increased risk of potentially fatal hemolysis.
References :

  1. Burgoine KL, Bancone G, Nosten F: The reality of using primaquine. Malar J. 2010 Dec 27;9:376. doi: 10.1186/1475-2875-9-376. [PubMed:21184691 ]
  2. Primaquine[package insert]. Bridgewater, New Jersey: Sanofi-Aventis U.S. LLC; 2016. [Link]

PMID: 11156371

Primaquine

By

Primaquine

Product: LY-2584702 (tosylate salt)

Identifier : DBSNPE002861
Drug : DB01087 (Primaquine)
Interacting Gene/Enzyme : Glucose-6-phosphate 1-dehydrogenase
Gene Name : G6PD
UniProt ID : P11413
Defining Change(s) :

  • 1220A->C

Allele Name : Abeno
Genotype(s) : Not Available
Type(s) : ADR Inferred
Groups : G6PD deficiency
Description : Increased risk of potentially fatal hemolysis.
References :

  1. Burgoine KL, Bancone G, Nosten F: The reality of using primaquine. Malar J. 2010 Dec 27;9:376. doi: 10.1186/1475-2875-9-376. [PubMed:21184691 ]
  2. Primaquine[package insert]. Bridgewater, New Jersey: Sanofi-Aventis U.S. LLC; 2016. [Link]

PMID: 10526670

Primaquine

By

Primaquine

Product: LY-2584702 (free base)

Identifier : DBSNPE002862
Drug : DB01087 (Primaquine)
Interacting Gene/Enzyme : Glucose-6-phosphate 1-dehydrogenase
Gene Name : G6PD
UniProt ID : P11413
Defining Change(s) :

  • 1291G->A

Allele Name : Surabaya
Genotype(s) : Not Available
Type(s) : ADR Inferred
Groups : G6PD deficiency
Description : Increased risk of potentially fatal hemolysis.
References :

  1. Burgoine KL, Bancone G, Nosten F: The reality of using primaquine. Malar J. 2010 Dec 27;9:376. doi: 10.1186/1475-2875-9-376. [PubMed:21184691 ]
  2. Primaquine[package insert]. Bridgewater, New Jersey: Sanofi-Aventis U.S. LLC; 2016. [Link]

PMID: 21167846

Primaquine

By

Primaquine

Product: Aconitine

Identifier : DBSNPE002863
Drug : DB01087 (Primaquine)
Interacting Gene/Enzyme : Glucose-6-phosphate 1-dehydrogenase
Gene Name : G6PD
UniProt ID : P11413
Defining Change(s) :

  • 1316G->C

Allele Name : Pawnee
Genotype(s) : Not Available
Type(s) : ADR Inferred
Groups : G6PD deficiency
Description : Increased risk of potentially fatal hemolysis.
References :

  1. Burgoine KL, Bancone G, Nosten F: The reality of using primaquine. Malar J. 2010 Dec 27;9:376. doi: 10.1186/1475-2875-9-376. [PubMed:21184691 ]
  2. Primaquine[package insert]. Bridgewater, New Jersey: Sanofi-Aventis U.S. LLC; 2016. [Link]

PMID: 19662650

Primaquine

By

Primaquine

Product: 4-Methylbenzylidene camphor

Identifier : DBSNPE002864
Drug : DB01087 (Primaquine)
Interacting Gene/Enzyme : Glucose-6-phosphate 1-dehydrogenase
Gene Name : G6PD
UniProt ID : P11413
Defining Change(s) :

  • 1342A->G

Allele Name : S. Antioco
Genotype(s) : Not Available
Type(s) : ADR Inferred
Groups : G6PD deficiency
Description : Increased risk of potentially fatal hemolysis.
References :

  1. Burgoine KL, Bancone G, Nosten F: The reality of using primaquine. Malar J. 2010 Dec 27;9:376. doi: 10.1186/1475-2875-9-376. [PubMed:21184691 ]
  2. Primaquine[package insert]. Bridgewater, New Jersey: Sanofi-Aventis U.S. LLC; 2016. [Link]

PMID: 19372565

Primaquine

By

Primaquine

Product: Dalbavancin

Identifier : DBSNPE002865
Drug : DB01087 (Primaquine)
Interacting Gene/Enzyme : Glucose-6-phosphate 1-dehydrogenase
Gene Name : G6PD
UniProt ID : P11413
Defining Change(s) :

  • 1347G->C

Allele Name : Cassano
Genotype(s) : Not Available
Type(s) : ADR Inferred
Groups : G6PD deficiency
Description : Increased risk of potentially fatal hemolysis.
References :

  1. Burgoine KL, Bancone G, Nosten F: The reality of using primaquine. Malar J. 2010 Dec 27;9:376. doi: 10.1186/1475-2875-9-376. [PubMed:21184691 ]
  2. Primaquine[package insert]. Bridgewater, New Jersey: Sanofi-Aventis U.S. LLC; 2016. [Link]

PMID: 17332351

Primaquine

By

Primaquine

Product: Mepenzolate (Bromide)

Identifier : DBSNPE002866
Drug : DB01087 (Primaquine)
Interacting Gene/Enzyme : Glucose-6-phosphate 1-dehydrogenase
Gene Name : G6PD
UniProt ID : P11413
Defining Change(s) :

  • 1347G->C
  • 1360C->T

Allele Name : Hermoupolis
Genotype(s) : Not Available
Type(s) : ADR Inferred
Groups : G6PD deficiency
Description : Increased risk of potentially fatal hemolysis.
References :

  1. Burgoine KL, Bancone G, Nosten F: The reality of using primaquine. Malar J. 2010 Dec 27;9:376. doi: 10.1186/1475-2875-9-376. [PubMed:21184691 ]
  2. Primaquine[package insert]. Bridgewater, New Jersey: Sanofi-Aventis U.S. LLC; 2016. [Link]

PMID: 15955698

Primaquine

By

Primaquine

Product: Linaclotide

Identifier : DBSNPE002867
Drug : DB01087 (Primaquine)
Interacting Gene/Enzyme : Glucose-6-phosphate 1-dehydrogenase
Gene Name : G6PD
UniProt ID : P11413
Defining Change(s) :

  • 1360C->T

Allele Name : Union,Maewo, Chinese-2, Kalo
Genotype(s) : Not Available
Type(s) : ADR Inferred
Groups : G6PD deficiency
Description : Increased risk of potentially fatal hemolysis.
References :

  1. Burgoine KL, Bancone G, Nosten F: The reality of using primaquine. Malar J. 2010 Dec 27;9:376. doi: 10.1186/1475-2875-9-376. [PubMed:21184691 ]
  2. Primaquine[package insert]. Bridgewater, New Jersey: Sanofi-Aventis U.S. LLC; 2016. [Link]

PMID: 15974572

Primaquine

By

Primaquine

Product: TBA-354

Identifier : DBSNPE002868
Drug : DB01087 (Primaquine)
Interacting Gene/Enzyme : Glucose-6-phosphate 1-dehydrogenase
Gene Name : G6PD
UniProt ID : P11413
Defining Change(s) :

  • 1361G->A

Allele Name : Andalus
Genotype(s) : Not Available
Type(s) : ADR Inferred
Groups : G6PD deficiency
Description : Increased risk of potentially fatal hemolysis.
References :

  1. Burgoine KL, Bancone G, Nosten F: The reality of using primaquine. Malar J. 2010 Dec 27;9:376. doi: 10.1186/1475-2875-9-376. [PubMed:21184691 ]
  2. Primaquine[package insert]. Bridgewater, New Jersey: Sanofi-Aventis U.S. LLC; 2016. [Link]

PMID: 22938030

Primaquine

By

Primaquine

Product: EX-527 (R-enantiomer)

Identifier : DBSNPE002869
Drug : DB01087 (Primaquine)
Interacting Gene/Enzyme : Glucose-6-phosphate 1-dehydrogenase
Gene Name : G6PD
UniProt ID : P11413
Defining Change(s) :

  • 1376G->C

Allele Name : Cosenza
Genotype(s) : Not Available
Type(s) : ADR Inferred
Groups : G6PD deficiency
Description : Increased risk of potentially fatal hemolysis.
References :

  1. Burgoine KL, Bancone G, Nosten F: The reality of using primaquine. Malar J. 2010 Dec 27;9:376. doi: 10.1186/1475-2875-9-376. [PubMed:21184691 ]
  2. Primaquine[package insert]. Bridgewater, New Jersey: Sanofi-Aventis U.S. LLC; 2016. [Link]

PMID: 21131419

Primaquine

By

Primaquine

Product: EX-527 (S-enantiomer)

Identifier : DBSNPE002870
Drug : DB01087 (Primaquine)
Interacting Gene/Enzyme : Glucose-6-phosphate 1-dehydrogenase
Gene Name : G6PD
UniProt ID : P11413
Defining Change(s) :

  • 1376G->T

Allele Name : Canton, Taiwan- Hakka, Gifu-like, Agrigento-like
Genotype(s) : Not Available
Type(s) : ADR Inferred
Groups : G6PD deficiency
Description : Increased risk of potentially fatal hemolysis.
References :

  1. Burgoine KL, Bancone G, Nosten F: The reality of using primaquine. Malar J. 2010 Dec 27;9:376. doi: 10.1186/1475-2875-9-376. [PubMed:21184691 ]
  2. Primaquine[package insert]. Bridgewater, New Jersey: Sanofi-Aventis U.S. LLC; 2016. [Link]

PMID: 19955938

Primaquine

By

Primaquine

Product: SAR407899

Identifier : DBSNPE002871
Drug : DB01087 (Primaquine)
Interacting Gene/Enzyme : Glucose-6-phosphate 1-dehydrogenase
Gene Name : G6PD
UniProt ID : P11413
Defining Change(s) :

  • 1387C->A

Allele Name : Flores
Genotype(s) : Not Available
Type(s) : ADR Inferred
Groups : G6PD deficiency
Description : Increased risk of potentially fatal hemolysis.
References :

  1. Burgoine KL, Bancone G, Nosten F: The reality of using primaquine. Malar J. 2010 Dec 27;9:376. doi: 10.1186/1475-2875-9-376. [PubMed:21184691 ]
  2. Primaquine[package insert]. Bridgewater, New Jersey: Sanofi-Aventis U.S. LLC; 2016. [Link]

PMID: 18816111

Primaquine

By

Primaquine

Product: SAR407899 (hydrochloride)

Identifier : DBSNPE002872
Drug : DB01087 (Primaquine)
Interacting Gene/Enzyme : Glucose-6-phosphate 1-dehydrogenase
Gene Name : G6PD
UniProt ID : P11413
Defining Change(s) :

  • 1388G->A

Allele Name : Kaiping, Anant, Dhon, Sapporo-like, Wosera
Genotype(s) : Not Available
Type(s) : ADR Inferred
Groups : G6PD deficiency
Description : Increased risk of potentially fatal hemolysis.
References :

  1. Burgoine KL, Bancone G, Nosten F: The reality of using primaquine. Malar J. 2010 Dec 27;9:376. doi: 10.1186/1475-2875-9-376. [PubMed:21184691 ]
  2. Primaquine[package insert]. Bridgewater, New Jersey: Sanofi-Aventis U.S. LLC; 2016. [Link]

PMID: 17913482

Primaquine

By

Primaquine

Product: Acetazolamide

Identifier : DBSNPE002873
Drug : DB01087 (Primaquine)
Interacting Gene/Enzyme : Glucose-6-phosphate 1-dehydrogenase
Gene Name : G6PD
UniProt ID : P11413
Defining Change(s) :

  • 169C->T

Allele Name : Kamogawa
Genotype(s) : Not Available
Type(s) : ADR Inferred
Groups : G6PD deficiency
Description : Increased risk of potentially fatal hemolysis.
References :

  1. Burgoine KL, Bancone G, Nosten F: The reality of using primaquine. Malar J. 2010 Dec 27;9:376. doi: 10.1186/1475-2875-9-376. [PubMed:21184691 ]
  2. Primaquine[package insert]. Bridgewater, New Jersey: Sanofi-Aventis U.S. LLC; 2016. [Link]

PMID: 17450509

Primaquine

By

Primaquine

Product: UPF-648

Identifier : DBSNPE002874
Drug : DB01087 (Primaquine)
Interacting Gene/Enzyme : Glucose-6-phosphate 1-dehydrogenase
Gene Name : G6PD
UniProt ID : P11413
Defining Change(s) :

  • 179T>C

Allele Name : Costanzo
Genotype(s) : Not Available
Type(s) : ADR Inferred
Groups : G6PD deficiency
Description : Increased risk of potentially fatal hemolysis.
References :

  1. Burgoine KL, Bancone G, Nosten F: The reality of using primaquine. Malar J. 2010 Dec 27;9:376. doi: 10.1186/1475-2875-9-376. [PubMed:21184691 ]
  2. Primaquine[package insert]. Bridgewater, New Jersey: Sanofi-Aventis U.S. LLC; 2016. [Link]

PMID: 25915529

Primaquine

By

Primaquine

Product: UPF-648 (sodium salt)

Identifier : DBSNPE002875
Drug : DB01087 (Primaquine)
Interacting Gene/Enzyme : Glucose-6-phosphate 1-dehydrogenase
Gene Name : G6PD
UniProt ID : P11413
Defining Change(s) :

  • 185C->A

Allele Name : Amazonia
Genotype(s) : Not Available
Type(s) : ADR Inferred
Groups : G6PD deficiency
Description : Increased risk of potentially fatal hemolysis.
References :

  1. Burgoine KL, Bancone G, Nosten F: The reality of using primaquine. Malar J. 2010 Dec 27;9:376. doi: 10.1186/1475-2875-9-376. [PubMed:21184691 ]
  2. Primaquine[package insert]. Bridgewater, New Jersey: Sanofi-Aventis U.S. LLC; 2016. [Link]

PMID: 20798912

Primaquine

By

Primaquine

Product: INCB 3284

Identifier : DBSNPE002876
Drug : DB01087 (Primaquine)
Interacting Gene/Enzyme : Glucose-6-phosphate 1-dehydrogenase
Gene Name : G6PD
UniProt ID : P11413
Defining Change(s) :

  • 196T->A

Allele Name : Songklanagarind
Genotype(s) : Not Available
Type(s) : ADR Inferred
Groups : G6PD deficiency
Description : Increased risk of potentially fatal hemolysis.
References :

  1. Burgoine KL, Bancone G, Nosten F: The reality of using primaquine. Malar J. 2010 Dec 27;9:376. doi: 10.1186/1475-2875-9-376. [PubMed:21184691 ]
  2. Primaquine[package insert]. Bridgewater, New Jersey: Sanofi-Aventis U.S. LLC; 2016. [Link]

PMID: 19416831

Primaquine

By

Primaquine

Product: TIC10

Identifier : DBSNPE002877
Drug : DB01087 (Primaquine)
Interacting Gene/Enzyme : Glucose-6-phosphate 1-dehydrogenase
Gene Name : G6PD
UniProt ID : P11413
Defining Change(s) :

  • 202G->A
  • 871G->A

Allele Name : Hechi
Genotype(s) : Not Available
Type(s) : ADR Inferred
Groups : G6PD deficiency
Description : Increased risk of potentially fatal hemolysis.
References :

  1. Burgoine KL, Bancone G, Nosten F: The reality of using primaquine. Malar J. 2010 Dec 27;9:376. doi: 10.1186/1475-2875-9-376. [PubMed:21184691 ]
  2. Primaquine[package insert]. Bridgewater, New Jersey: Sanofi-Aventis U.S. LLC; 2016. [Link]

PMID: 18172314

Primaquine

By

Primaquine

Product: (+)-Apogossypol

Identifier : DBSNPE002878
Drug : DB01087 (Primaquine)
Interacting Gene/Enzyme : Glucose-6-phosphate 1-dehydrogenase
Gene Name : G6PD
UniProt ID : P11413
Defining Change(s) :

  • 208T->C

Allele Name : Namouru
Genotype(s) : Not Available
Type(s) : ADR Inferred
Groups : G6PD deficiency
Description : Increased risk of potentially fatal hemolysis.
References :

  1. Burgoine KL, Bancone G, Nosten F: The reality of using primaquine. Malar J. 2010 Dec 27;9:376. doi: 10.1186/1475-2875-9-376. [PubMed:21184691 ]
  2. Primaquine[package insert]. Bridgewater, New Jersey: Sanofi-Aventis U.S. LLC; 2016. [Link]

PMID: 16392823

Primaquine

By

Primaquine

Product: C75

Identifier : DBSNPE002879
Drug : DB01087 (Primaquine)
Interacting Gene/Enzyme : Glucose-6-phosphate 1-dehydrogenase
Gene Name : G6PD
UniProt ID : P11413
Defining Change(s) :

  • 352T>C

Allele Name : Bao Loc
Genotype(s) : Not Available
Type(s) : ADR Inferred
Groups : G6PD deficiency
Description : Increased risk of potentially fatal hemolysis.
References :

  1. Burgoine KL, Bancone G, Nosten F: The reality of using primaquine. Malar J. 2010 Dec 27;9:376. doi: 10.1186/1475-2875-9-376. [PubMed:21184691 ]
  2. Primaquine[package insert]. Bridgewater, New Jersey: Sanofi-Aventis U.S. LLC; 2016. [Link]

PMID: 22704236

Primaquine

By

Primaquine

Product: C75 (trans)

Identifier : DBSNPE002880
Drug : DB01087 (Primaquine)
Interacting Gene/Enzyme : Glucose-6-phosphate 1-dehydrogenase
Gene Name : G6PD
UniProt ID : P11413
Defining Change(s) :

  • 375G->T, 379G->T383T->C384C>T

Allele Name : Crispim
Genotype(s) : Not Available
Type(s) : ADR Inferred
Groups : G6PD deficiency
Description : Increased risk of potentially fatal hemolysis.
References :

  1. Burgoine KL, Bancone G, Nosten F: The reality of using primaquine. Malar J. 2010 Dec 27;9:376. doi: 10.1186/1475-2875-9-376. [PubMed:21184691 ]
  2. Primaquine[package insert]. Bridgewater, New Jersey: Sanofi-Aventis U.S. LLC; 2016. [Link]

PMID: 22425997

Primaquine

By

Primaquine

Product: Nepicastat (hydrochloride)

Identifier : DBSNPE002881
Drug : DB01087 (Primaquine)
Interacting Gene/Enzyme : Glucose-6-phosphate 1-dehydrogenase
Gene Name : G6PD
UniProt ID : P11413
Defining Change(s) :

  • 376A->G
  • 463C->G

Allele Name : Acrokorinthos
Genotype(s) : Not Available
Type(s) : ADR Inferred
Groups : G6PD deficiency
Description : Increased risk of potentially fatal hemolysis.
References :

  1. Burgoine KL, Bancone G, Nosten F: The reality of using primaquine. Malar J. 2010 Dec 27;9:376. doi: 10.1186/1475-2875-9-376. [PubMed:21184691 ]
  2. Primaquine[package insert]. Bridgewater, New Jersey: Sanofi-Aventis U.S. LLC; 2016. [Link]

PMID: 19666565

Primaquine

By

Primaquine

Product: Bucladesine (calcium salt)

Identifier : DBSNPE002882
Drug : DB01087 (Primaquine)
Interacting Gene/Enzyme : Glucose-6-phosphate 1-dehydrogenase
Gene Name : G6PD
UniProt ID : P11413
Defining Change(s) :

  • 376A->G
  • 542A->T

Allele Name : Santa Maria
Genotype(s) : Not Available
Type(s) : ADR Inferred
Groups : G6PD deficiency
Description : Increased risk of potentially fatal hemolysis.
References :

  1. Burgoine KL, Bancone G, Nosten F: The reality of using primaquine. Malar J. 2010 Dec 27;9:376. doi: 10.1186/1475-2875-9-376. [PubMed:21184691 ]
  2. Primaquine[package insert]. Bridgewater, New Jersey: Sanofi-Aventis U.S. LLC; 2016. [Link]

PMID: 26157548

Primaquine

By

Primaquine

Product: Ecteinascidin-Analog-1

Identifier : DBSNPE002883
Drug : DB01087 (Primaquine)
Interacting Gene/Enzyme : Glucose-6-phosphate 1-dehydrogenase
Gene Name : G6PD
UniProt ID : P11413
Defining Change(s) :

  • 376A->G
  • 871G->A

Allele Name : Ananindeua
Genotype(s) : Not Available
Type(s) : ADR Inferred
Groups : G6PD deficiency
Description : Increased risk of potentially fatal hemolysis.
References :

  1. Burgoine KL, Bancone G, Nosten F: The reality of using primaquine. Malar J. 2010 Dec 27;9:376. doi: 10.1186/1475-2875-9-376. [PubMed:21184691 ]
  2. Primaquine[package insert]. Bridgewater, New Jersey: Sanofi-Aventis U.S. LLC; 2016. [Link]

PMID: 25818300

Primaquine

By

Primaquine

Product: GSK2110183 (hydrochloride)

Identifier : DBSNPE002884
Drug : DB01087 (Primaquine)
Interacting Gene/Enzyme : Glucose-6-phosphate 1-dehydrogenase
Gene Name : G6PD
UniProt ID : P11413
Defining Change(s) :

  • 383T->C

Allele Name : Vanua Lava
Genotype(s) : Not Available
Type(s) : ADR Inferred
Groups : G6PD deficiency
Description : Increased risk of potentially fatal hemolysis.
References :

  1. Burgoine KL, Bancone G, Nosten F: The reality of using primaquine. Malar J. 2010 Dec 27;9:376. doi: 10.1186/1475-2875-9-376. [PubMed:21184691 ]
  2. Primaquine[package insert]. Bridgewater, New Jersey: Sanofi-Aventis U.S. LLC; 2016. [Link]

PMID: 19189974

Primaquine

By

Primaquine

Product: Mutant IDH1-IN-1

Identifier : DBSNPE002885
Drug : DB01087 (Primaquine)
Interacting Gene/Enzyme : Glucose-6-phosphate 1-dehydrogenase
Gene Name : G6PD
UniProt ID : P11413
Defining Change(s) :

  • 406C->T

Allele Name : Valladolid
Genotype(s) : Not Available
Type(s) : ADR Inferred
Groups : G6PD deficiency
Description : Increased risk of potentially fatal hemolysis.
References :

  1. Burgoine KL, Bancone G, Nosten F: The reality of using primaquine. Malar J. 2010 Dec 27;9:376. doi: 10.1186/1475-2875-9-376. [PubMed:21184691 ]
  2. Primaquine[package insert]. Bridgewater, New Jersey: Sanofi-Aventis U.S. LLC; 2016. [Link]

PMID: 19859563

Primaquine

By

Primaquine

Product: Chidamide

Identifier : DBSNPE002886
Drug : DB01087 (Primaquine)
Interacting Gene/Enzyme : Glucose-6-phosphate 1-dehydrogenase
Gene Name : G6PD
UniProt ID : P11413
Defining Change(s) :

  • 409C->T

Allele Name : Belem
Genotype(s) : Not Available
Type(s) : ADR Inferred
Groups : G6PD deficiency
Description : Increased risk of potentially fatal hemolysis.
References :

  1. Burgoine KL, Bancone G, Nosten F: The reality of using primaquine. Malar J. 2010 Dec 27;9:376. doi: 10.1186/1475-2875-9-376. [PubMed:21184691 ]
  2. Primaquine[package insert]. Bridgewater, New Jersey: Sanofi-Aventis U.S. LLC; 2016. [Link]

PMID: 12679522

Primaquine

By

Primaquine

Product: BMH-21

Identifier : DBSNPE002887
Drug : DB01087 (Primaquine)
Interacting Gene/Enzyme : Glucose-6-phosphate 1-dehydrogenase
Gene Name : G6PD
UniProt ID : P11413
Defining Change(s) :

  • 442G->A

Allele Name : Liuzhou
Genotype(s) : Not Available
Type(s) : ADR Inferred
Groups : G6PD deficiency
Description : Increased risk of potentially fatal hemolysis.
References :

  1. Burgoine KL, Bancone G, Nosten F: The reality of using primaquine. Malar J. 2010 Dec 27;9:376. doi: 10.1186/1475-2875-9-376. [PubMed:21184691 ]
  2. Primaquine[package insert]. Bridgewater, New Jersey: Sanofi-Aventis U.S. LLC; 2016. [Link]

PMID: 11532916

Primaquine

By

Primaquine

Product: Diclazepam

Identifier : DBSNPE002888
Drug : DB01087 (Primaquine)
Interacting Gene/Enzyme : Glucose-6-phosphate 1-dehydrogenase
Gene Name : G6PD
UniProt ID : P11413
Defining Change(s) :

  • 473G>A

Allele Name : Shenzen
Genotype(s) : Not Available
Type(s) : ADR Inferred
Groups : G6PD deficiency
Description : Increased risk of potentially fatal hemolysis.
References :

  1. Burgoine KL, Bancone G, Nosten F: The reality of using primaquine. Malar J. 2010 Dec 27;9:376. doi: 10.1186/1475-2875-9-376. [PubMed:21184691 ]
  2. Primaquine[package insert]. Bridgewater, New Jersey: Sanofi-Aventis U.S. LLC; 2016. [Link]

PMID: 23448715

Primaquine

By

Primaquine

Product: FRAX486

Identifier : DBSNPE002889
Drug : DB01087 (Primaquine)
Interacting Gene/Enzyme : Glucose-6-phosphate 1-dehydrogenase
Gene Name : G6PD
UniProt ID : P11413
Defining Change(s) :

  • 493A->G

Allele Name : Taipei “Chinese- 3”
Genotype(s) : Not Available
Type(s) : ADR Inferred
Groups : G6PD deficiency
Description : Increased risk of potentially fatal hemolysis.
References :

  1. Burgoine KL, Bancone G, Nosten F: The reality of using primaquine. Malar J. 2010 Dec 27;9:376. doi: 10.1186/1475-2875-9-376. [PubMed:21184691 ]
  2. Primaquine[package insert]. Bridgewater, New Jersey: Sanofi-Aventis U.S. LLC; 2016. [Link]

PMID: 19540115

Primaquine

By

Primaquine

Product: PF-06447475

Identifier : DBSNPE002890
Drug : DB01087 (Primaquine)
Interacting Gene/Enzyme : Glucose-6-phosphate 1-dehydrogenase
Gene Name : G6PD
UniProt ID : P11413
Defining Change(s) :

  • 496C>T

Allele Name : Toledo
Genotype(s) : Not Available
Type(s) : ADR Inferred
Groups : G6PD deficiency
Description : Increased risk of potentially fatal hemolysis.
References :

  1. Burgoine KL, Bancone G, Nosten F: The reality of using primaquine. Malar J. 2010 Dec 27;9:376. doi: 10.1186/1475-2875-9-376. [PubMed:21184691 ]
  2. Primaquine[package insert]. Bridgewater, New Jersey: Sanofi-Aventis U.S. LLC; 2016. [Link]

PMID: 22268551

Primaquine

By

Primaquine

Product: ELR510444

Identifier : DBSNPE002891
Drug : DB01087 (Primaquine)
Interacting Gene/Enzyme : Glucose-6-phosphate 1-dehydrogenase
Gene Name : G6PD
UniProt ID : P11413
Defining Change(s) :

  • 497G->A

Allele Name : Naone
Genotype(s) : Not Available
Type(s) : ADR Inferred
Groups : G6PD deficiency
Description : Increased risk of potentially fatal hemolysis.
References :

  1. Burgoine KL, Bancone G, Nosten F: The reality of using primaquine. Malar J. 2010 Dec 27;9:376. doi: 10.1186/1475-2875-9-376. [PubMed:21184691 ]
  2. Primaquine[package insert]. Bridgewater, New Jersey: Sanofi-Aventis U.S. LLC; 2016. [Link]

PMID: 20664000

Primaquine

By

Primaquine

Product: TAK-063

Identifier : DBSNPE002892
Drug : DB01087 (Primaquine)
Interacting Gene/Enzyme : Glucose-6-phosphate 1-dehydrogenase
Gene Name : G6PD
UniProt ID : P11413
Defining Change(s) :

  • 517T->C

Allele Name : Nankang
Genotype(s) : Not Available
Type(s) : ADR Inferred
Groups : G6PD deficiency
Description : Increased risk of potentially fatal hemolysis.
References :

  1. Burgoine KL, Bancone G, Nosten F: The reality of using primaquine. Malar J. 2010 Dec 27;9:376. doi: 10.1186/1475-2875-9-376. [PubMed:21184691 ]
  2. Primaquine[package insert]. Bridgewater, New Jersey: Sanofi-Aventis U.S. LLC; 2016. [Link]

PMID: 22084163

Primaquine

By

Primaquine

Product: PD173955

Identifier : DBSNPE002893
Drug : DB01087 (Primaquine)
Interacting Gene/Enzyme : Glucose-6-phosphate 1-dehydrogenase
Gene Name : G6PD
UniProt ID : P11413
Defining Change(s) :

  • 519C->G

Allele Name : Miaoli
Genotype(s) : Not Available
Type(s) : ADR Inferred
Groups : G6PD deficiency
Description : Increased risk of potentially fatal hemolysis.
References :

  1. Burgoine KL, Bancone G, Nosten F: The reality of using primaquine. Malar J. 2010 Dec 27;9:376. doi: 10.1186/1475-2875-9-376. [PubMed:21184691 ]
  2. Primaquine[package insert]. Bridgewater, New Jersey: Sanofi-Aventis U.S. LLC; 2016. [Link]

PMID: 24469057

Primaquine

By

Primaquine

Product: GDC-0152

Identifier : DBSNPE002894
Drug : DB01087 (Primaquine)
Interacting Gene/Enzyme : Glucose-6-phosphate 1-dehydrogenase
Gene Name : G6PD
UniProt ID : P11413
Defining Change(s) :

  • 563C->T

Allele Name : Mediterranean, Dallas, Panama‚ Sassari, Cagliari, Birmingham
Genotype(s) : Not Available
Type(s) : ADR Inferred
Groups : G6PD deficiency
Description : Increased risk of potentially fatal hemolysis.
References :

  1. Burgoine KL, Bancone G, Nosten F: The reality of using primaquine. Malar J. 2010 Dec 27;9:376. doi: 10.1186/1475-2875-9-376. [PubMed:21184691 ]
  2. Primaquine[package insert]. Bridgewater, New Jersey: Sanofi-Aventis U.S. LLC; 2016. [Link]

PMID: 23416332

Primaquine

By

Primaquine

Product: PRT062607

Identifier : DBSNPE002895
Drug : DB01087 (Primaquine)
Interacting Gene/Enzyme : Glucose-6-phosphate 1-dehydrogenase
Gene Name : G6PD
UniProt ID : P11413
Defining Change(s) :

  • 592C->T

Allele Name : Coimbra Shunde
Genotype(s) : Not Available
Type(s) : ADR Inferred
Groups : G6PD deficiency
Description : Increased risk of potentially fatal hemolysis.
References :

  1. Burgoine KL, Bancone G, Nosten F: The reality of using primaquine. Malar J. 2010 Dec 27;9:376. doi: 10.1186/1475-2875-9-376. [PubMed:21184691 ]
  2. Primaquine[package insert]. Bridgewater, New Jersey: Sanofi-Aventis U.S. LLC; 2016. [Link]

PMID: 19304771

Primaquine

By

Primaquine

Product: Stauprimide

Identifier : DBSNPE002896
Drug : DB01087 (Primaquine)
Interacting Gene/Enzyme : Glucose-6-phosphate 1-dehydrogenase
Gene Name : G6PD
UniProt ID : P11413
Defining Change(s) :

  • 593G>A

Allele Name : Nilgiri
Genotype(s) : Not Available
Type(s) : ADR Inferred
Groups : G6PD deficiency
Description : Increased risk of potentially fatal hemolysis.
References :

  1. Burgoine KL, Bancone G, Nosten F: The reality of using primaquine. Malar J. 2010 Dec 27;9:376. doi: 10.1186/1475-2875-9-376. [PubMed:21184691 ]
  2. Primaquine[package insert]. Bridgewater, New Jersey: Sanofi-Aventis U.S. LLC; 2016. [Link]

PMID: 22554036

Primaquine

By

Primaquine

Product: BQ-788

Identifier : DBSNPE002897
Drug : DB01087 (Primaquine)
Interacting Gene/Enzyme : Glucose-6-phosphate 1-dehydrogenase
Gene Name : G6PD
UniProt ID : P11413
Defining Change(s) :

  • 679C->T

Allele Name : Radlowo
Genotype(s) : Not Available
Type(s) : ADR Inferred
Groups : G6PD deficiency
Description : Increased risk of potentially fatal hemolysis.
References :

  1. Burgoine KL, Bancone G, Nosten F: The reality of using primaquine. Malar J. 2010 Dec 27;9:376. doi: 10.1186/1475-2875-9-376. [PubMed:21184691 ]
  2. Primaquine[package insert]. Bridgewater, New Jersey: Sanofi-Aventis U.S. LLC; 2016. [Link]

PMID: 10926779

Primaquine

By

Primaquine

Product: SB225002

Identifier : DBSNPE002898
Drug : DB01087 (Primaquine)
Interacting Gene/Enzyme : Glucose-6-phosphate 1-dehydrogenase
Gene Name : G6PD
UniProt ID : P11413
Defining Change(s) :

  • 811G>C

Allele Name : Roubaix
Genotype(s) : Not Available
Type(s) : ADR Inferred
Groups : G6PD deficiency
Description : Increased risk of potentially fatal hemolysis.
References :

  1. Burgoine KL, Bancone G, Nosten F: The reality of using primaquine. Malar J. 2010 Dec 27;9:376. doi: 10.1186/1475-2875-9-376. [PubMed:21184691 ]
  2. Primaquine[package insert]. Bridgewater, New Jersey: Sanofi-Aventis U.S. LLC; 2016. [Link]

PMID: 2745416

Primaquine

By

Primaquine

Product: LDN-214117

Identifier : DBSNPE002899
Drug : DB01087 (Primaquine)
Interacting Gene/Enzyme : Glucose-6-phosphate 1-dehydrogenase
Gene Name : G6PD
UniProt ID : P11413
Defining Change(s) :

  • 835A->G

Allele Name : Haikou
Genotype(s) : Not Available
Type(s) : ADR Inferred
Groups : G6PD deficiency
Description : Increased risk of potentially fatal hemolysis.
References :

  1. Burgoine KL, Bancone G, Nosten F: The reality of using primaquine. Malar J. 2010 Dec 27;9:376. doi: 10.1186/1475-2875-9-376. [PubMed:21184691 ]
  2. Primaquine[package insert]. Bridgewater, New Jersey: Sanofi-Aventis U.S. LLC; 2016. [Link]

PMID: 6159896

Primaquine

By

Primaquine

Product: Apoptosis Activator 2

Identifier : DBSNPE002900
Drug : DB01087 (Primaquine)
Interacting Gene/Enzyme : Glucose-6-phosphate 1-dehydrogenase
Gene Name : G6PD
UniProt ID : P11413
Defining Change(s) :

  • 835A->T

Allele Name : Chinese-1
Genotype(s) : Not Available
Type(s) : ADR Inferred
Groups : G6PD deficiency
Description : Increased risk of potentially fatal hemolysis.
References :

  1. Burgoine KL, Bancone G, Nosten F: The reality of using primaquine. Malar J. 2010 Dec 27;9:376. doi: 10.1186/1475-2875-9-376. [PubMed:21184691 ]
  2. Primaquine[package insert]. Bridgewater, New Jersey: Sanofi-Aventis U.S. LLC; 2016. [Link]

PMID: 23831757

Primaquine

By

Primaquine

Product: Promethazine (hydrochloride)

Identifier : DBSNPE002901
Drug : DB01087 (Primaquine)
Interacting Gene/Enzyme : Glucose-6-phosphate 1-dehydrogenase
Gene Name : G6PD
UniProt ID : P11413
Defining Change(s) :

  • 848A>G

Allele Name : Mizushima
Genotype(s) : Not Available
Type(s) : ADR Inferred
Groups : G6PD deficiency
Description : Increased risk of potentially fatal hemolysis.
References :

  1. Burgoine KL, Bancone G, Nosten F: The reality of using primaquine. Malar J. 2010 Dec 27;9:376. doi: 10.1186/1475-2875-9-376. [PubMed:21184691 ]
  2. Primaquine[package insert]. Bridgewater, New Jersey: Sanofi-Aventis U.S. LLC; 2016. [Link]

PMID: 22231273

Primaquine

By

Primaquine

Product: NSC319726

Identifier : DBSNPE002902
Drug : DB01087 (Primaquine)
Interacting Gene/Enzyme : Glucose-6-phosphate 1-dehydrogenase
Gene Name : G6PD
UniProt ID : P11413
Defining Change(s) :

  • 853C->T

Allele Name : Osaka
Genotype(s) : Not Available
Type(s) : ADR Inferred
Groups : G6PD deficiency
Description : Increased risk of potentially fatal hemolysis.
References :

  1. Burgoine KL, Bancone G, Nosten F: The reality of using primaquine. Malar J. 2010 Dec 27;9:376. doi: 10.1186/1475-2875-9-376. [PubMed:21184691 ]
  2. Primaquine[package insert]. Bridgewater, New Jersey: Sanofi-Aventis U.S. LLC; 2016. [Link]

PMID: 17200122

Primaquine

By

Primaquine

Product: Lucigenin

Identifier : DBSNPE002903
Drug : DB01087 (Primaquine)
Interacting Gene/Enzyme : Glucose-6-phosphate 1-dehydrogenase
Gene Name : G6PD
UniProt ID : P11413
Defining Change(s) :

  • 871G->A

Allele Name : Viangchan, Jammu
Genotype(s) : Not Available
Type(s) : ADR Inferred
Groups : G6PD deficiency
Description : Increased risk of potentially fatal hemolysis.
References :

  1. Burgoine KL, Bancone G, Nosten F: The reality of using primaquine. Malar J. 2010 Dec 27;9:376. doi: 10.1186/1475-2875-9-376. [PubMed:21184691 ]
  2. Primaquine[package insert]. Bridgewater, New Jersey: Sanofi-Aventis U.S. LLC; 2016. [Link]

PMID: 19500978

Primaquine

By

Primaquine

Product: Fluorescein Diacetate

Identifier : DBSNPE002904
Drug : DB01087 (Primaquine)
Interacting Gene/Enzyme : Glucose-6-phosphate 1-dehydrogenase
Gene Name : G6PD
UniProt ID : P11413
Defining Change(s) :

  • 916G->A

Allele Name : Seoul
Genotype(s) : Not Available
Type(s) : ADR Inferred
Groups : G6PD deficiency
Description : Increased risk of potentially fatal hemolysis.
References :

  1. Burgoine KL, Bancone G, Nosten F: The reality of using primaquine. Malar J. 2010 Dec 27;9:376. doi: 10.1186/1475-2875-9-376. [PubMed:21184691 ]
  2. Primaquine[package insert]. Bridgewater, New Jersey: Sanofi-Aventis U.S. LLC; 2016. [Link]

PMID: 6947237

Primaquine

By

Primaquine

Product: CWHM-12

Identifier : DBSNPE002905
Drug : DB01087 (Primaquine)
Interacting Gene/Enzyme : Glucose-6-phosphate 1-dehydrogenase
Gene Name : G6PD
UniProt ID : P11413
Defining Change(s) :

  • 929G->A

Allele Name : Ludhiana
Genotype(s) : Not Available
Type(s) : ADR Inferred
Groups : G6PD deficiency
Description : Increased risk of potentially fatal hemolysis.
References :

  1. Burgoine KL, Bancone G, Nosten F: The reality of using primaquine. Malar J. 2010 Dec 27;9:376. doi: 10.1186/1475-2875-9-376. [PubMed:21184691 ]
  2. Primaquine[package insert]. Bridgewater, New Jersey: Sanofi-Aventis U.S. LLC; 2016. [Link]

PMID: 23272707

Primaquine

By

Primaquine

Product: TZ9

Identifier : DBSNPE002906
Drug : DB01087 (Primaquine)
Interacting Gene/Enzyme : Glucose-6-phosphate 1-dehydrogenase
Gene Name : G6PD
UniProt ID : P11413
Defining Change(s) :

  • 977C->A

Allele Name : Farroupilha
Genotype(s) : Not Available
Type(s) : ADR Inferred
Groups : G6PD deficiency
Description : Increased risk of potentially fatal hemolysis.
References :

  1. Burgoine KL, Bancone G, Nosten F: The reality of using primaquine. Malar J. 2010 Dec 27;9:376. doi: 10.1186/1475-2875-9-376. [PubMed:21184691 ]
  2. Primaquine[package insert]. Bridgewater, New Jersey: Sanofi-Aventis U.S. LLC; 2016. [Link]

PMID: 22686625

Primaquine

By

Primaquine

Product: K-Ras G12C-IN-3

Identifier : DBSNPE002907
Drug : DB01087 (Primaquine)
Interacting Gene/Enzyme : Glucose-6-phosphate 1-dehydrogenase
Gene Name : G6PD
UniProt ID : P11413
Defining Change(s) :

  • 1024C->T

Allele Name : Chinese-5
Genotype(s) : Not Available
Type(s) : ADR Inferred
Groups : G6PD deficiency
Description : Increased risk of potentially fatal hemolysis.
References :

  1. Burgoine KL, Bancone G, Nosten F: The reality of using primaquine. Malar J. 2010 Dec 27;9:376. doi: 10.1186/1475-2875-9-376. [PubMed:21184691 ]
  2. Primaquine[package insert]. Bridgewater, New Jersey: Sanofi-Aventis U.S. LLC; 2016. [Link]

PMID: 26087697

Primaquine

By

Primaquine

Product: K-Ras G12C-IN-2

Identifier : DBSNPE002908
Drug : DB01087 (Primaquine)
Interacting Gene/Enzyme : Glucose-6-phosphate 1-dehydrogenase
Gene Name : G6PD
UniProt ID : P11413
Defining Change(s) :

  • 130G>A

Allele Name : Rignano
Genotype(s) : Not Available
Type(s) : ADR Inferred
Groups : G6PD deficiency
Description : Increased risk of potentially fatal hemolysis.
References :

  1. Burgoine KL, Bancone G, Nosten F: The reality of using primaquine. Malar J. 2010 Dec 27;9:376. doi: 10.1186/1475-2875-9-376. [PubMed:21184691 ]
  2. Primaquine[package insert]. Bridgewater, New Jersey: Sanofi-Aventis U.S. LLC; 2016. [Link]

PMID: 24900334

Primaquine

By

Primaquine

Product: K-Ras G12C-IN-1

Identifier : DBSNPE002909
Drug : DB01087 (Primaquine)
Interacting Gene/Enzyme : Glucose-6-phosphate 1-dehydrogenase
Gene Name : G6PD
UniProt ID : P11413
Defining Change(s) :

  • 131C->G

Allele Name : Orissa
Genotype(s) : Not Available
Type(s) : ADR Inferred
Groups : G6PD deficiency
Description : Increased risk of potentially fatal hemolysis.
References :

  1. Burgoine KL, Bancone G, Nosten F: The reality of using primaquine. Malar J. 2010 Dec 27;9:376. doi: 10.1186/1475-2875-9-376. [PubMed:21184691 ]
  2. Primaquine[package insert]. Bridgewater, New Jersey: Sanofi-Aventis U.S. LLC; 2016. [Link]

PMID: 24944189

Primaquine

By

Primaquine

Product: Nile Red

Identifier : DBSNPE002910
Drug : DB01087 (Primaquine)
Interacting Gene/Enzyme : Glucose-6-phosphate 1-dehydrogenase
Gene Name : G6PD
UniProt ID : P11413
Defining Change(s) :

  • 1380G>C

Allele Name : G6PDNice
Genotype(s) : Not Available
Type(s) : ADR Inferred
Groups : G6PD deficiency
Description : Increased risk of potentially fatal hemolysis.
References :

  1. Burgoine KL, Bancone G, Nosten F: The reality of using primaquine. Malar J. 2010 Dec 27;9:376. doi: 10.1186/1475-2875-9-376. [PubMed:21184691 ]
  2. Primaquine[package insert]. Bridgewater, New Jersey: Sanofi-Aventis U.S. LLC; 2016. [Link]

PMID: 23176257

Primaquine

By

Primaquine

Product: DAF-FM DA

Identifier : DBSNPE002911
Drug : DB01087 (Primaquine)
Interacting Gene/Enzyme : Glucose-6-phosphate 1-dehydrogenase
Gene Name : G6PD
UniProt ID : P11413
Defining Change(s) :

  • 1387C->T

Allele Name : Kamiube, Keelung
Genotype(s) : Not Available
Type(s) : ADR Inferred
Groups : G6PD deficiency
Description : Increased risk of potentially fatal hemolysis.
References :

  1. Burgoine KL, Bancone G, Nosten F: The reality of using primaquine. Malar J. 2010 Dec 27;9:376. doi: 10.1186/1475-2875-9-376. [PubMed:21184691 ]
  2. Primaquine[package insert]. Bridgewater, New Jersey: Sanofi-Aventis U.S. LLC; 2016. [Link]

PMID: 22251082

Primaquine

By

Primaquine

Product: 5-CFDA

Identifier : DBSNPE002912
Drug : DB01087 (Primaquine)
Interacting Gene/Enzyme : Glucose-6-phosphate 1-dehydrogenase
Gene Name : G6PD
UniProt ID : P11413
Defining Change(s) :

  • 1400C->G

Allele Name : Neapolis
Genotype(s) : Not Available
Type(s) : ADR Inferred
Groups : G6PD deficiency
Description : Increased risk of potentially fatal hemolysis.
References :

  1. Burgoine KL, Bancone G, Nosten F: The reality of using primaquine. Malar J. 2010 Dec 27;9:376. doi: 10.1186/1475-2875-9-376. [PubMed:21184691 ]
  2. Primaquine[package insert]. Bridgewater, New Jersey: Sanofi-Aventis U.S. LLC; 2016. [Link]

PMID: 16945016

Primaquine

By

Primaquine

Product: Fluo-3AM

Identifier : DBSNPE002913
Drug : DB01087 (Primaquine)
Interacting Gene/Enzyme : Glucose-6-phosphate 1-dehydrogenase
Gene Name : G6PD
UniProt ID : P11413
Defining Change(s) :

  • 143T->C

Allele Name : Aures
Genotype(s) : Not Available
Type(s) : ADR Inferred
Groups : G6PD deficiency
Description : Increased risk of potentially fatal hemolysis.
References :

  1. Burgoine KL, Bancone G, Nosten F: The reality of using primaquine. Malar J. 2010 Dec 27;9:376. doi: 10.1186/1475-2875-9-376. [PubMed:21184691 ]
  2. Primaquine[package insert]. Bridgewater, New Jersey: Sanofi-Aventis U.S. LLC; 2016. [Link]

PMID: 14576198

Primaquine

By

Primaquine

Product: Dihydroethidium

Identifier : DBSNPE002914
Drug : DB01087 (Primaquine)
Interacting Gene/Enzyme : Glucose-6-phosphate 1-dehydrogenase
Gene Name : G6PD
UniProt ID : P11413
Defining Change(s) :

  • 1442C->G

Allele Name : Split
Genotype(s) : Not Available
Type(s) : ADR Inferred
Groups : G6PD deficiency
Description : Increased risk of potentially fatal hemolysis.
References :

  1. Burgoine KL, Bancone G, Nosten F: The reality of using primaquine. Malar J. 2010 Dec 27;9:376. doi: 10.1186/1475-2875-9-376. [PubMed:21184691 ]
  2. Primaquine[package insert]. Bridgewater, New Jersey: Sanofi-Aventis U.S. LLC; 2016. [Link]

PMID: 22125664

Primaquine

By

Primaquine

Product: Fluorescamine

Identifier : DBSNPE002915
Drug : DB01087 (Primaquine)
Interacting Gene/Enzyme : Glucose-6-phosphate 1-dehydrogenase
Gene Name : G6PD
UniProt ID : P11413
Defining Change(s) :

  • 148C->T

Allele Name : Kambos
Genotype(s) : Not Available
Type(s) : ADR Inferred
Groups : G6PD deficiency
Description : Increased risk of potentially fatal hemolysis.
References :

  1. Burgoine KL, Bancone G, Nosten F: The reality of using primaquine. Malar J. 2010 Dec 27;9:376. doi: 10.1186/1475-2875-9-376. [PubMed:21184691 ]
  2. Primaquine[package insert]. Bridgewater, New Jersey: Sanofi-Aventis U.S. LLC; 2016. [Link]

PMID: 23650380

Primaquine

By

Primaquine

Product: Tetrazolium Red

Identifier : DBSNPE002916
Drug : DB01087 (Primaquine)
Interacting Gene/Enzyme : Glucose-6-phosphate 1-dehydrogenase
Gene Name : G6PD
UniProt ID : P11413
Defining Change(s) :

  • 170G>A

Allele Name : Palesdivina
Genotype(s) : Not Available
Type(s) : ADR Inferred
Groups : G6PD deficiency
Description : Increased risk of potentially fatal hemolysis.
References :

  1. Burgoine KL, Bancone G, Nosten F: The reality of using primaquine. Malar J. 2010 Dec 27;9:376. doi: 10.1186/1475-2875-9-376. [PubMed:21184691 ]
  2. Primaquine[package insert]. Bridgewater, New Jersey: Sanofi-Aventis U.S. LLC; 2016. [Link]

PMID: 22910039

Primaquine

By

Primaquine

Product: GPDA

Identifier : DBSNPE002918
Drug : DB01087 (Primaquine)
Interacting Gene/Enzyme : Glucose-6-phosphate 1-dehydrogenase
Gene Name : G6PD
UniProt ID : P11413
Defining Change(s) :

  • 185C->T

Allele Name : Musashino
Genotype(s) : Not Available
Type(s) : ADR Inferred
Groups : G6PD deficiency
Description : Increased risk of potentially fatal hemolysis.
References :

  1. Burgoine KL, Bancone G, Nosten F: The reality of using primaquine. Malar J. 2010 Dec 27;9:376. doi: 10.1186/1475-2875-9-376. [PubMed:21184691 ]
  2. Primaquine[package insert]. Bridgewater, New Jersey: Sanofi-Aventis U.S. LLC; 2016. [Link]

PMID: 17610913

Primaquine

By

Primaquine

Product: TBPB

Identifier : DBSNPE002919
Drug : DB01087 (Primaquine)
Interacting Gene/Enzyme : Glucose-6-phosphate 1-dehydrogenase
Gene Name : G6PD
UniProt ID : P11413
Defining Change(s) :

  • 202G->A

Allele Name : Asahi
Genotype(s) : Not Available
Type(s) : ADR Inferred
Groups : G6PD deficiency
Description : Increased risk of potentially fatal hemolysis.
References :

  1. Burgoine KL, Bancone G, Nosten F: The reality of using primaquine. Malar J. 2010 Dec 27;9:376. doi: 10.1186/1475-2875-9-376. [PubMed:21184691 ]
  2. Primaquine[package insert]. Bridgewater, New Jersey: Sanofi-Aventis U.S. LLC; 2016. [Link]

PMID: 16284303

Primaquine

By

Primaquine

Product: USP7-IN-1

Identifier : DBSNPE002920
Drug : DB01087 (Primaquine)
Interacting Gene/Enzyme : Glucose-6-phosphate 1-dehydrogenase
Gene Name : G6PD
UniProt ID : P11413
Defining Change(s) :

  • 202G->A
  • 376A->G

Allele Name : A- (202), Ferrara I
Genotype(s) : Not Available
Type(s) : ADR Inferred
Groups : G6PD deficiency
Description : Increased risk of potentially fatal hemolysis.
References :

  1. Burgoine KL, Bancone G, Nosten F: The reality of using primaquine. Malar J. 2010 Dec 27;9:376. doi: 10.1186/1475-2875-9-376. [PubMed:21184691 ]
  2. Primaquine[package insert]. Bridgewater, New Jersey: Sanofi-Aventis U.S. LLC; 2016. [Link]

PMID: 16219910

Primaquine

By

Primaquine

Product: DPN

Identifier : DBSNPE002921
Drug : DB01087 (Primaquine)
Interacting Gene/Enzyme : Glucose-6-phosphate 1-dehydrogenase
Gene Name : G6PD
UniProt ID : P11413
Defining Change(s) :

  • 209A->G

Allele Name : Murcia Oristano
Genotype(s) : Not Available
Type(s) : ADR Inferred
Groups : G6PD deficiency
Description : Increased risk of potentially fatal hemolysis.
References :

  1. Burgoine KL, Bancone G, Nosten F: The reality of using primaquine. Malar J. 2010 Dec 27;9:376. doi: 10.1186/1475-2875-9-376. [PubMed:21184691 ]
  2. Primaquine[package insert]. Bridgewater, New Jersey: Sanofi-Aventis U.S. LLC; 2016. [Link]

PMID: 27002181

Primaquine

By

Primaquine

Product: FICZ

Identifier : DBSNPE002922
Drug : DB01087 (Primaquine)
Interacting Gene/Enzyme : Glucose-6-phosphate 1-dehydrogenase
Gene Name : G6PD
UniProt ID : P11413
Defining Change(s) :

  • 241C->T

Allele Name : Ube Konan
Genotype(s) : Not Available
Type(s) : ADR Inferred
Groups : G6PD deficiency
Description : Increased risk of potentially fatal hemolysis.
References :

  1. Burgoine KL, Bancone G, Nosten F: The reality of using primaquine. Malar J. 2010 Dec 27;9:376. doi: 10.1186/1475-2875-9-376. [PubMed:21184691 ]
  2. Primaquine[package insert]. Bridgewater, New Jersey: Sanofi-Aventis U.S. LLC; 2016. [Link]

PMID: 19121809

Primaquine

By

Primaquine

Product: BI 224436

Identifier : DBSNPE002923
Drug : DB01087 (Primaquine)
Interacting Gene/Enzyme : Glucose-6-phosphate 1-dehydrogenase
Gene Name : G6PD
UniProt ID : P11413
Defining Change(s) :

  • 242G->A

Allele Name : Lagosanto
Genotype(s) : Not Available
Type(s) : ADR Inferred
Groups : G6PD deficiency
Description : Increased risk of potentially fatal hemolysis.
References :

  1. Burgoine KL, Bancone G, Nosten F: The reality of using primaquine. Malar J. 2010 Dec 27;9:376. doi: 10.1186/1475-2875-9-376. [PubMed:21184691 ]
  2. Primaquine[package insert]. Bridgewater, New Jersey: Sanofi-Aventis U.S. LLC; 2016. [Link]

PMID: 17325228

Primaquine

By

Primaquine

Product: SGC0946

Identifier : DBSNPE002924
Drug : DB01087 (Primaquine)
Interacting Gene/Enzyme : Glucose-6-phosphate 1-dehydrogenase
Gene Name : G6PD
UniProt ID : P11413
Defining Change(s) :

  • 274C->T

Allele Name : Guangzhou
Genotype(s) : Not Available
Type(s) : ADR Inferred
Groups : G6PD deficiency
Description : Increased risk of potentially fatal hemolysis.
References :

  1. Burgoine KL, Bancone G, Nosten F: The reality of using primaquine. Malar J. 2010 Dec 27;9:376. doi: 10.1186/1475-2875-9-376. [PubMed:21184691 ]
  2. Primaquine[package insert]. Bridgewater, New Jersey: Sanofi-Aventis U.S. LLC; 2016. [Link]

PMID: 16825484

Primaquine

By

Primaquine

Product: C646

Identifier : DBSNPE002925
Drug : DB01087 (Primaquine)
Interacting Gene/Enzyme : Glucose-6-phosphate 1-dehydrogenase
Gene Name : G6PD
UniProt ID : P11413
Defining Change(s) :

  • 323T->A

Allele Name : Hammersmith
Genotype(s) : Not Available
Type(s) : ADR Inferred
Groups : G6PD deficiency
Description : Increased risk of potentially fatal hemolysis.
References :

  1. Burgoine KL, Bancone G, Nosten F: The reality of using primaquine. Malar J. 2010 Dec 27;9:376. doi: 10.1186/1475-2875-9-376. [PubMed:21184691 ]
  2. Primaquine[package insert]. Bridgewater, New Jersey: Sanofi-Aventis U.S. LLC; 2016. [Link]

PMID: 19632239

Primaquine

By

Primaquine

Product: PIK-294

Identifier : DBSNPE002926
Drug : DB01087 (Primaquine)
Interacting Gene/Enzyme : Glucose-6-phosphate 1-dehydrogenase
Gene Name : G6PD
UniProt ID : P11413
Defining Change(s) :

  • 34G->T

Allele Name : Sinnai
Genotype(s) : Not Available
Type(s) : ADR Inferred
Groups : G6PD deficiency
Description : Increased risk of potentially fatal hemolysis.
References :

  1. Burgoine KL, Bancone G, Nosten F: The reality of using primaquine. Malar J. 2010 Dec 27;9:376. doi: 10.1186/1475-2875-9-376. [PubMed:21184691 ]
  2. Primaquine[package insert]. Bridgewater, New Jersey: Sanofi-Aventis U.S. LLC; 2016. [Link]

PMID: 20649599

Primaquine

By

Primaquine

Product: Ro 48-8071 (fumarate)

Identifier : DBSNPE002927
Drug : DB01087 (Primaquine)
Interacting Gene/Enzyme : Glucose-6-phosphate 1-dehydrogenase
Gene Name : G6PD
UniProt ID : P11413
Defining Change(s) :

  • 376A->G
  • 680G->T

Allele Name : A- (680)
Genotype(s) : Not Available
Type(s) : ADR Inferred
Groups : G6PD deficiency
Description : Increased risk of potentially fatal hemolysis.
References :

  1. Burgoine KL, Bancone G, Nosten F: The reality of using primaquine. Malar J. 2010 Dec 27;9:376. doi: 10.1186/1475-2875-9-376. [PubMed:21184691 ]
  2. Primaquine[package insert]. Bridgewater, New Jersey: Sanofi-Aventis U.S. LLC; 2016. [Link]

PMID: 19073629

Primaquine

By

Primaquine

Product: Ro 48-8071

Identifier : DBSNPE002929
Drug : DB01087 (Primaquine)
Interacting Gene/Enzyme : Glucose-6-phosphate 1-dehydrogenase
Gene Name : G6PD
UniProt ID : P11413
Defining Change(s) :

  • 383T>G

Allele Name : Salerno Pyrgos
Genotype(s) : Not Available
Type(s) : ADR Inferred
Groups : G6PD deficiency
Description : Increased risk of potentially fatal hemolysis.
References :

  1. Burgoine KL, Bancone G, Nosten F: The reality of using primaquine. Malar J. 2010 Dec 27;9:376. doi: 10.1186/1475-2875-9-376. [PubMed:21184691 ]
  2. Primaquine[package insert]. Bridgewater, New Jersey: Sanofi-Aventis U.S. LLC; 2016. [Link]

PMID: 25228688

Primaquine

By

Primaquine

Product: GSK2578215A

Identifier : DBSNPE002930
Drug : DB01087 (Primaquine)
Interacting Gene/Enzyme : Glucose-6-phosphate 1-dehydrogenase
Gene Name : G6PD
UniProt ID : P11413
Defining Change(s) :

  • 392G->T

Allele Name : Quing Yan
Genotype(s) : Not Available
Type(s) : ADR Inferred
Groups : G6PD deficiency
Description : Increased risk of potentially fatal hemolysis.
References :

  1. Burgoine KL, Bancone G, Nosten F: The reality of using primaquine. Malar J. 2010 Dec 27;9:376. doi: 10.1186/1475-2875-9-376. [PubMed:21184691 ]
  2. Primaquine[package insert]. Bridgewater, New Jersey: Sanofi-Aventis U.S. LLC; 2016. [Link]

PMID: 18362028

Primaquine

By

Primaquine

Product: NLG919

Identifier : DBSNPE002931
Drug : DB01087 (Primaquine)
Interacting Gene/Enzyme : Glucose-6-phosphate 1-dehydrogenase
Gene Name : G6PD
UniProt ID : P11413
Defining Change(s) :

  • 40G->A

Allele Name : Lages
Genotype(s) : Not Available
Type(s) : ADR Inferred
Groups : G6PD deficiency
Description : Increased risk of potentially fatal hemolysis.
References :

  1. Burgoine KL, Bancone G, Nosten F: The reality of using primaquine. Malar J. 2010 Dec 27;9:376. doi: 10.1186/1475-2875-9-376. [PubMed:21184691 ]
  2. Primaquine[package insert]. Bridgewater, New Jersey: Sanofi-Aventis U.S. LLC; 2016. [Link]

PMID: 16870833

Primaquine

By

Primaquine

Product: (±)-BI-D

Identifier : DBSNPE002932
Drug : DB01087 (Primaquine)
Interacting Gene/Enzyme : Glucose-6-phosphate 1-dehydrogenase
Gene Name : G6PD
UniProt ID : P11413
Defining Change(s) :

  • 466G->A

Allele Name : Ilesha
Genotype(s) : Not Available
Type(s) : ADR Inferred
Groups : G6PD deficiency
Description : Increased risk of potentially fatal hemolysis.
References :

  1. Burgoine KL, Bancone G, Nosten F: The reality of using primaquine. Malar J. 2010 Dec 27;9:376. doi: 10.1186/1475-2875-9-376. [PubMed:21184691 ]
  2. Primaquine[package insert]. Bridgewater, New Jersey: Sanofi-Aventis U.S. LLC; 2016. [Link]

PMID: 15976038

Primaquine

By

Primaquine

Product: DZ2002

Identifier : DBSNPE002933
Drug : DB01087 (Primaquine)
Interacting Gene/Enzyme : Glucose-6-phosphate 1-dehydrogenase
Gene Name : G6PD
UniProt ID : P11413
Defining Change(s) :

  • 487G->A

Allele Name : Mahidol
Genotype(s) : Not Available
Type(s) : ADR Inferred
Groups : G6PD deficiency
Description : Increased risk of potentially fatal hemolysis.
References :

  1. Burgoine KL, Bancone G, Nosten F: The reality of using primaquine. Malar J. 2010 Dec 27;9:376. doi: 10.1186/1475-2875-9-376. [PubMed:21184691 ]
  2. Primaquine[package insert]. Bridgewater, New Jersey: Sanofi-Aventis U.S. LLC; 2016. [Link]

PMID: 23013484

Primaquine

By

Primaquine

Product: Fimasartan

Identifier : DBSNPE002934
Drug : DB01087 (Primaquine)
Interacting Gene/Enzyme : Glucose-6-phosphate 1-dehydrogenase
Gene Name : G6PD
UniProt ID : P11413
Defining Change(s) :

  • 542A->T

Allele Name : Malaga
Genotype(s) : Not Available
Type(s) : ADR Inferred
Groups : G6PD deficiency
Description : Increased risk of potentially fatal hemolysis.
References :

  1. Burgoine KL, Bancone G, Nosten F: The reality of using primaquine. Malar J. 2010 Dec 27;9:376. doi: 10.1186/1475-2875-9-376. [PubMed:21184691 ]
  2. Primaquine[package insert]. Bridgewater, New Jersey: Sanofi-Aventis U.S. LLC; 2016. [Link]

PMID: 21296466

Primaquine

By

Primaquine

Product: SU9516

Identifier : DBSNPE002935
Drug : DB01087 (Primaquine)
Interacting Gene/Enzyme : Glucose-6-phosphate 1-dehydrogenase
Gene Name : G6PD
UniProt ID : P11413
Defining Change(s) :

  • 634A->G

Allele Name : Sibari
Genotype(s) : Not Available
Type(s) : ADR Inferred
Groups : G6PD deficiency
Description : Increased risk of potentially fatal hemolysis.
References :

  1. Burgoine KL, Bancone G, Nosten F: The reality of using primaquine. Malar J. 2010 Dec 27;9:376. doi: 10.1186/1475-2875-9-376. [PubMed:21184691 ]
  2. Primaquine[package insert]. Bridgewater, New Jersey: Sanofi-Aventis U.S. LLC; 2016. [Link]

PMID: 15867950

Primaquine

By

Primaquine

Product: LY2606368 (dihydrochloride)

Identifier : DBSNPE002936
Drug : DB01087 (Primaquine)
Interacting Gene/Enzyme : Glucose-6-phosphate 1-dehydrogenase
Gene Name : G6PD
UniProt ID : P11413
Defining Change(s) :

  • 680G->A

Allele Name : Mexico City
Genotype(s) : Not Available
Type(s) : ADR Inferred
Groups : G6PD deficiency
Description : Increased risk of potentially fatal hemolysis.
References :

  1. Burgoine KL, Bancone G, Nosten F: The reality of using primaquine. Malar J. 2010 Dec 27;9:376. doi: 10.1186/1475-2875-9-376. [PubMed:21184691 ]
  2. Primaquine[package insert]. Bridgewater, New Jersey: Sanofi-Aventis U.S. LLC; 2016. [Link]

PMID: 22761436

Primaquine

By

Primaquine

Product: BET-BAY 002

Identifier : DBSNPE002937
Drug : DB01087 (Primaquine)
Interacting Gene/Enzyme : Glucose-6-phosphate 1-dehydrogenase
Gene Name : G6PD
UniProt ID : P11413
Defining Change(s) :

  • 703C->T

Allele Name : Nanning
Genotype(s) : Not Available
Type(s) : ADR Inferred
Groups : G6PD deficiency
Description : Increased risk of potentially fatal hemolysis.
References :

  1. Burgoine KL, Bancone G, Nosten F: The reality of using primaquine. Malar J. 2010 Dec 27;9:376. doi: 10.1186/1475-2875-9-376. [PubMed:21184691 ]
  2. Primaquine[package insert]. Bridgewater, New Jersey: Sanofi-Aventis U.S. LLC; 2016. [Link]

PMID: 18480054

Primaquine

By

Primaquine

Product: BMS-983970

Identifier : DBSNPE002938
Drug : DB01087 (Primaquine)
Interacting Gene/Enzyme : Glucose-6-phosphate 1-dehydrogenase
Gene Name : G6PD
UniProt ID : P11413
Defining Change(s) :

  • 844G->C

Allele Name : Seattle, Lodi, Modena, Ferrara II, Athens-like
Genotype(s) : Not Available
Type(s) : ADR Inferred
Groups : G6PD deficiency
Description : Increased risk of potentially fatal hemolysis.
References :

  1. Burgoine KL, Bancone G, Nosten F: The reality of using primaquine. Malar J. 2010 Dec 27;9:376. doi: 10.1186/1475-2875-9-376. [PubMed:21184691 ]
  2. Primaquine[package insert]. Bridgewater, New Jersey: Sanofi-Aventis U.S. LLC; 2016. [Link]

PMID: 23300835

Primaquine

By

Primaquine

Product: Cefozopran (hydrochloride)

Identifier : DBSNPE002939
Drug : DB01087 (Primaquine)
Interacting Gene/Enzyme : Glucose-6-phosphate 1-dehydrogenase
Gene Name : G6PD
UniProt ID : P11413
Defining Change(s) :

  • 844G->T

Allele Name : Bajo Maumere
Genotype(s) : Not Available
Type(s) : ADR Inferred
Groups : G6PD deficiency
Description : Increased risk of potentially fatal hemolysis.
References :

  1. Burgoine KL, Bancone G, Nosten F: The reality of using primaquine. Malar J. 2010 Dec 27;9:376. doi: 10.1186/1475-2875-9-376. [PubMed:21184691 ]
  2. Primaquine[package insert]. Bridgewater, New Jersey: Sanofi-Aventis U.S. LLC; 2016. [Link]

PMID: 8789954

Primaquine

By

Primaquine

Product: YL-109

Identifier : DBSNPE002940
Drug : DB01087 (Primaquine)
Interacting Gene/Enzyme : Glucose-6-phosphate 1-dehydrogenase
Gene Name : G6PD
UniProt ID : P11413
Defining Change(s) :

  • 854G->A

Allele Name : Montalbano
Genotype(s) : Not Available
Type(s) : ADR Inferred
Groups : G6PD deficiency
Description : Increased risk of potentially fatal hemolysis.
References :

  1. Burgoine KL, Bancone G, Nosten F: The reality of using primaquine. Malar J. 2010 Dec 27;9:376. doi: 10.1186/1475-2875-9-376. [PubMed:21184691 ]
  2. Primaquine[package insert]. Bridgewater, New Jersey: Sanofi-Aventis U.S. LLC; 2016. [Link]

PMID: 8204618

Primaquine

By

Primaquine

Product: Chitinase-IN-2

Identifier : DBSNPE002941
Drug : DB01087 (Primaquine)
Interacting Gene/Enzyme : Glucose-6-phosphate 1-dehydrogenase
Gene Name : G6PD
UniProt ID : P11413
Defining Change(s) :

  • 949G->A

Allele Name : Kalyan-Kerala, Jamnaga, Rohini
Genotype(s) : Not Available
Type(s) : ADR Inferred
Groups : G6PD deficiency
Description : Increased risk of potentially fatal hemolysis.
References :

  1. Burgoine KL, Bancone G, Nosten F: The reality of using primaquine. Malar J. 2010 Dec 27;9:376. doi: 10.1186/1475-2875-9-376. [PubMed:21184691 ]
  2. Primaquine[package insert]. Bridgewater, New Jersey: Sanofi-Aventis U.S. LLC; 2016. [Link]

PMID: 15967421

Primaquine

By

Primaquine

Product: Chitinase-IN-1

Identifier : DBSNPE002942
Drug : DB01087 (Primaquine)
Interacting Gene/Enzyme : Glucose-6-phosphate 1-dehydrogenase
Gene Name : G6PD
UniProt ID : P11413
Defining Change(s) :

  • 95A->G

Allele Name : Gaohe
Genotype(s) : Not Available
Type(s) : ADR Inferred
Groups : G6PD deficiency
Description : Increased risk of potentially fatal hemolysis.
References :

  1. Burgoine KL, Bancone G, Nosten F: The reality of using primaquine. Malar J. 2010 Dec 27;9:376. doi: 10.1186/1475-2875-9-376. [PubMed:21184691 ]
  2. Primaquine[package insert]. Bridgewater, New Jersey: Sanofi-Aventis U.S. LLC; 2016. [Link]

PMID: 9550297

By

Related Post

You Missed

Uncategorized

Recombinant Mouse CD40 Ligand/TNFSF5 Protein (hFc Tag)

Uncategorized

Recombinant Mouse ART4/CD297 Protein (His Tag)

Uncategorized

B3GALTL Protein

Uncategorized

ASPH Protein