PI3KInhibitorpi3kinhibitor

Nitrofurantoin

By

Nitrofurantoin

Product: Ivabradine metabolite N-Demethyl Ivabradine (hydrochloride)

Identifier : DBSNPE002430
Drug : DB00698 (Nidivofurantoin)
Interacting Gene/Enzyme : Glucose-6-phosphate 1-dehydrogenase
Gene Name : G6PD
UniProt ID : P11413
Defining Change(s) :

  • 1000_1002delACC

Allele Name : Villeurbanne
Genotype(s) : Not Available
Type(s) : ADR Inferred
Groups : G6PD deficiency
Description : Increased risk of hemolytic anemia.
References :

  1. Gait JE: Hemolytic reactions to nidivofurantoin in patients with glucose-6-phosphate dehydrogenase deficiency: theory and practice. DICP. 1990 Dec;24(12):1210-3. [PubMed:2089833 ]
  2. Furadantin® (nidivofurantoin) Oral Suspension[package insert]. Florham Park, New Jersey: Shionogi Inc. 2013. [Link]

PMID: 28303901

Nitrofurantoin

By

Nitrofurantoin

Product: 5-Hydroxy Propafenone (D5 Hydrochloride)

Identifier : DBSNPE002431
Drug : DB00698 (Nidivofurantoin)
Interacting Gene/Enzyme : Glucose-6-phosphate 1-dehydrogenase
Gene Name : G6PD
UniProt ID : P11413
Defining Change(s) :

  • 1006A->G

Allele Name : Torun
Genotype(s) : Not Available
Type(s) : ADR Inferred
Groups : G6PD deficiency
Description : Increased risk of hemolytic anemia.
References :

  1. Gait JE: Hemolytic reactions to nidivofurantoin in patients with glucose-6-phosphate dehydrogenase deficiency: theory and practice. DICP. 1990 Dec;24(12):1210-3. [PubMed:2089833 ]
  2. Furadantin® (nidivofurantoin) Oral Suspension[package insert]. Florham Park, New Jersey: Shionogi Inc. 2013. [Link]

PMID: 27583644

Nitrofurantoin

By

Nitrofurantoin

Product: Itraconazole metabolite Hydroxy Itraconazole

Identifier : DBSNPE002432
Drug : DB00698 (Nidivofurantoin)
Interacting Gene/Enzyme : Glucose-6-phosphate 1-dehydrogenase
Gene Name : G6PD
UniProt ID : P11413
Defining Change(s) :

  • 105_107delCAT

Allele Name : Sunderland
Genotype(s) : Not Available
Type(s) : ADR Inferred
Groups : G6PD deficiency
Description : Increased risk of hemolytic anemia.
References :

  1. Gait JE: Hemolytic reactions to nidivofurantoin in patients with glucose-6-phosphate dehydrogenase deficiency: theory and practice. DICP. 1990 Dec;24(12):1210-3. [PubMed:2089833 ]
  2. Furadantin® (nidivofurantoin) Oral Suspension[package insert]. Florham Park, New Jersey: Shionogi Inc. 2013. [Link]

PMID: 27560173

Nitrofurantoin

By

Nitrofurantoin

Product: Mebeverine metabolite O-desmethyl Mebeverine acid

Identifier : DBSNPE002433
Drug : DB00698 (Nidivofurantoin)
Interacting Gene/Enzyme : Glucose-6-phosphate 1-dehydrogenase
Gene Name : G6PD
UniProt ID : P11413
Defining Change(s) :

  • 1081G->A

Allele Name : Iwatsuki
Genotype(s) : Not Available
Type(s) : ADR Inferred
Groups : G6PD deficiency
Description : Increased risk of hemolytic anemia.
References :

  1. Gait JE: Hemolytic reactions to nidivofurantoin in patients with glucose-6-phosphate dehydrogenase deficiency: theory and practice. DICP. 1990 Dec;24(12):1210-3. [PubMed:2089833 ]
  2. Furadantin® (nidivofurantoin) Oral Suspension[package insert]. Florham Park, New Jersey: Shionogi Inc. 2013. [Link]

PMID: 27545506

Nitrofurantoin

By

Nitrofurantoin

Product: Mebeverine metabolite Mebeverine alcohol

Identifier : DBSNPE002434
Drug : DB00698 (Nidivofurantoin)
Interacting Gene/Enzyme : Glucose-6-phosphate 1-dehydrogenase
Gene Name : G6PD
UniProt ID : P11413
Defining Change(s) :

  • 1082C->T

Allele Name : Serres
Genotype(s) : Not Available
Type(s) : ADR Inferred
Groups : G6PD deficiency
Description : Increased risk of hemolytic anemia.
References :

  1. Gait JE: Hemolytic reactions to nidivofurantoin in patients with glucose-6-phosphate dehydrogenase deficiency: theory and practice. DICP. 1990 Dec;24(12):1210-3. [PubMed:2089833 ]
  2. Furadantin® (nidivofurantoin) Oral Suspension[package insert]. Florham Park, New Jersey: Shionogi Inc. 2013. [Link]

PMID: 26108621

Nitrofurantoin

By

Nitrofurantoin

Product: Mebeverine metabolite Mebeverine acid

Identifier : DBSNPE002435
Drug : DB00698 (Nidivofurantoin)
Interacting Gene/Enzyme : Glucose-6-phosphate 1-dehydrogenase
Gene Name : G6PD
UniProt ID : P11413
Defining Change(s) :

  • 1084_1101delCTGAACGAGCGCAAGGCC

Allele Name : Tondela
Genotype(s) : Not Available
Type(s) : ADR Inferred
Groups : G6PD deficiency
Description : Increased risk of hemolytic anemia.
References :

  1. Gait JE: Hemolytic reactions to nidivofurantoin in patients with glucose-6-phosphate dehydrogenase deficiency: theory and practice. DICP. 1990 Dec;24(12):1210-3. [PubMed:2089833 ]
  2. Furadantin® (nidivofurantoin) Oral Suspension[package insert]. Florham Park, New Jersey: Shionogi Inc. 2013. [Link]

PMID: 25646529

Nitrofurantoin

By

Nitrofurantoin

Product: Carvedilol metabolite 4-Hydroxyphenyl Carvedilol

Identifier : DBSNPE002436
Drug : DB00698 (Nidivofurantoin)
Interacting Gene/Enzyme : Glucose-6-phosphate 1-dehydrogenase
Gene Name : G6PD
UniProt ID : P11413
Defining Change(s) :

  • 1089C->A

Allele Name : Loma Linda
Genotype(s) : Not Available
Type(s) : ADR Inferred
Groups : G6PD deficiency
Description : Increased risk of hemolytic anemia.
References :

  1. Gait JE: Hemolytic reactions to nidivofurantoin in patients with glucose-6-phosphate dehydrogenase deficiency: theory and practice. DICP. 1990 Dec;24(12):1210-3. [PubMed:2089833 ]
  2. Furadantin® (nidivofurantoin) Oral Suspension[package insert]. Florham Park, New Jersey: Shionogi Inc. 2013. [Link]

PMID: 25627813

Nitrofurantoin

By

Nitrofurantoin

Product: N-Desmethyl Clomipramine (D3 hydrochloride)

Identifier : DBSNPE002437
Drug : DB00698 (Nidivofurantoin)
Interacting Gene/Enzyme : Glucose-6-phosphate 1-dehydrogenase
Gene Name : G6PD
UniProt ID : P11413
Defining Change(s) :

  • 1089C->G

Allele Name : Aachen
Genotype(s) : Not Available
Type(s) : ADR Inferred
Groups : G6PD deficiency
Description : Increased risk of hemolytic anemia.
References :

  1. Gait JE: Hemolytic reactions to nidivofurantoin in patients with glucose-6-phosphate dehydrogenase deficiency: theory and practice. DICP. 1990 Dec;24(12):1210-3. [PubMed:2089833 ]
  2. Furadantin® (nidivofurantoin) Oral Suspension[package insert]. Florham Park, New Jersey: Shionogi Inc. 2013. [Link]

PMID: 25333967

Nitrofurantoin

By

Nitrofurantoin

Product: Pinoresinol Diglucoside

Identifier : DBSNPE002438
Drug : DB00698 (Nidivofurantoin)
Interacting Gene/Enzyme : Glucose-6-phosphate 1-dehydrogenase
Gene Name : G6PD
UniProt ID : P11413
Defining Change(s) :

  • 1096A->G

Allele Name : Tenri
Genotype(s) : Not Available
Type(s) : ADR Inferred
Groups : G6PD deficiency
Description : Increased risk of hemolytic anemia.
References :

  1. Gait JE: Hemolytic reactions to nidivofurantoin in patients with glucose-6-phosphate dehydrogenase deficiency: theory and practice. DICP. 1990 Dec;24(12):1210-3. [PubMed:2089833 ]
  2. Furadantin® (nidivofurantoin) Oral Suspension[package insert]. Florham Park, New Jersey: Shionogi Inc. 2013. [Link]

PMID: 26458176

Nitrofurantoin

By

Nitrofurantoin

Product: Solamargine

Identifier : DBSNPE002439
Drug : DB00698 (Nidivofurantoin)
Interacting Gene/Enzyme : Glucose-6-phosphate 1-dehydrogenase
Gene Name : G6PD
UniProt ID : P11413
Defining Change(s) :

  • 1132G>A

Allele Name : Montpellier
Genotype(s) : Not Available
Type(s) : ADR Inferred
Groups : G6PD deficiency
Description : Increased risk of hemolytic anemia.
References :

  1. Gait JE: Hemolytic reactions to nidivofurantoin in patients with glucose-6-phosphate dehydrogenase deficiency: theory and practice. DICP. 1990 Dec;24(12):1210-3. [PubMed:2089833 ]
  2. Furadantin® (nidivofurantoin) Oral Suspension[package insert]. Florham Park, New Jersey: Shionogi Inc. 2013. [Link]

PMID: 26035385

Nitrofurantoin

By

Nitrofurantoin

Product: Theophylline

Identifier : DBSNPE002440
Drug : DB00698 (Nidivofurantoin)
Interacting Gene/Enzyme : Glucose-6-phosphate 1-dehydrogenase
Gene Name : G6PD
UniProt ID : P11413
Defining Change(s) :

  • 1138A->G

Allele Name : Calvo Mackenna
Genotype(s) : Not Available
Type(s) : ADR Inferred
Groups : G6PD deficiency
Description : Increased risk of hemolytic anemia.
References :

  1. Gait JE: Hemolytic reactions to nidivofurantoin in patients with glucose-6-phosphate dehydrogenase deficiency: theory and practice. DICP. 1990 Dec;24(12):1210-3. [PubMed:2089833 ]
  2. Furadantin® (nidivofurantoin) Oral Suspension[package insert]. Florham Park, New Jersey: Shionogi Inc. 2013. [Link]

PMID: 26642061

Nitrofurantoin

By

Nitrofurantoin

Product: Desvenlafaxine (succinate hydrate)

Identifier : DBSNPE002441
Drug : DB00698 (Nidivofurantoin)
Interacting Gene/Enzyme : Glucose-6-phosphate 1-dehydrogenase
Gene Name : G6PD
UniProt ID : P11413
Defining Change(s) :

  • 1139T->C

Allele Name : Riley
Genotype(s) : Not Available
Type(s) : ADR Inferred
Groups : G6PD deficiency
Description : Increased risk of hemolytic anemia.
References :

  1. Gait JE: Hemolytic reactions to nidivofurantoin in patients with glucose-6-phosphate dehydrogenase deficiency: theory and practice. DICP. 1990 Dec;24(12):1210-3. [PubMed:2089833 ]
  2. Furadantin® (nidivofurantoin) Oral Suspension[package insert]. Florham Park, New Jersey: Shionogi Inc. 2013. [Link]

PMID: 26299970

Nitrofurantoin

By

Nitrofurantoin

Product: Pentamidine (isethionate)

Identifier : DBSNPE002442
Drug : DB00698 (Nidivofurantoin)
Interacting Gene/Enzyme : Glucose-6-phosphate 1-dehydrogenase
Gene Name : G6PD
UniProt ID : P11413
Defining Change(s) :

  • 1141T->C

Allele Name : Olomouc
Genotype(s) : Not Available
Type(s) : ADR Inferred
Groups : G6PD deficiency
Description : Increased risk of hemolytic anemia.
References :

  1. Gait JE: Hemolytic reactions to nidivofurantoin in patients with glucose-6-phosphate dehydrogenase deficiency: theory and practice. DICP. 1990 Dec;24(12):1210-3. [PubMed:2089833 ]
  2. Furadantin® (nidivofurantoin) Oral Suspension[package insert]. Florham Park, New Jersey: Shionogi Inc. 2013. [Link]

PMID: 25873861

Nitrofurantoin

By

Nitrofurantoin

Product: Valnemulin (Hydrochloride)

Identifier : DBSNPE002443
Drug : DB00698 (Nidivofurantoin)
Interacting Gene/Enzyme : Glucose-6-phosphate 1-dehydrogenase
Gene Name : G6PD
UniProt ID : P11413
Defining Change(s) :

  • 1153T->C

Allele Name : Tomah
Genotype(s) : Not Available
Type(s) : ADR Inferred
Groups : G6PD deficiency
Description : Increased risk of hemolytic anemia.
References :

  1. Gait JE: Hemolytic reactions to nidivofurantoin in patients with glucose-6-phosphate dehydrogenase deficiency: theory and practice. DICP. 1990 Dec;24(12):1210-3. [PubMed:2089833 ]
  2. Furadantin® (nidivofurantoin) Oral Suspension[package insert]. Florham Park, New Jersey: Shionogi Inc. 2013. [Link]

PMID: 24968096

Nitrofurantoin

By

Nitrofurantoin

Product: Estramustine (phosphate sodium)

Identifier : DBSNPE002444
Drug : DB00698 (Nidivofurantoin)
Interacting Gene/Enzyme : Glucose-6-phosphate 1-dehydrogenase
Gene Name : G6PD
UniProt ID : P11413
Defining Change(s) :

  • 1154G->T

Allele Name : Lynwood
Genotype(s) : Not Available
Type(s) : ADR Inferred
Groups : G6PD deficiency
Description : Increased risk of hemolytic anemia.
References :

  1. Gait JE: Hemolytic reactions to nidivofurantoin in patients with glucose-6-phosphate dehydrogenase deficiency: theory and practice. DICP. 1990 Dec;24(12):1210-3. [PubMed:2089833 ]
  2. Furadantin® (nidivofurantoin) Oral Suspension[package insert]. Florham Park, New Jersey: Shionogi Inc. 2013. [Link]

PMID: 24572354

Nitrofurantoin

By

Nitrofurantoin

Product: LY3009120

Identifier : DBSNPE002445
Drug : DB00698 (Nidivofurantoin)
Interacting Gene/Enzyme : Glucose-6-phosphate 1-dehydrogenase
Gene Name : G6PD
UniProt ID : P11413
Defining Change(s) :

  • 1155C->G

Allele Name : Madrid
Genotype(s) : Not Available
Type(s) : ADR Inferred
Groups : G6PD deficiency
Description : Increased risk of hemolytic anemia.
References :

  1. Gait JE: Hemolytic reactions to nidivofurantoin in patients with glucose-6-phosphate dehydrogenase deficiency: theory and practice. DICP. 1990 Dec;24(12):1210-3. [PubMed:2089833 ]
  2. Furadantin® (nidivofurantoin) Oral Suspension[package insert]. Florham Park, New Jersey: Shionogi Inc. 2013. [Link]

PMID: 12626660

Nitrofurantoin

By

Nitrofurantoin

Product: Fexofenadine D6

Identifier : DBSNPE002446
Drug : DB00698 (Nidivofurantoin)
Interacting Gene/Enzyme : Glucose-6-phosphate 1-dehydrogenase
Gene Name : G6PD
UniProt ID : P11413
Defining Change(s) :

  • 1156A->G

Allele Name : Iowa, Walter Reed, Springfield
Genotype(s) : Not Available
Type(s) : ADR Inferred
Groups : G6PD deficiency
Description : Increased risk of hemolytic anemia.
References :

  1. Gait JE: Hemolytic reactions to nidivofurantoin in patients with glucose-6-phosphate dehydrogenase deficiency: theory and practice. DICP. 1990 Dec;24(12):1210-3. [PubMed:2089833 ]
  2. Furadantin® (nidivofurantoin) Oral Suspension[package insert]. Florham Park, New Jersey: Shionogi Inc. 2013. [Link]

PMID: 12942141

Nitrofurantoin

By

Nitrofurantoin

Product: Amlodipine (maleate)

Identifier : DBSNPE002447
Drug : DB00698 (Nidivofurantoin)
Interacting Gene/Enzyme : Glucose-6-phosphate 1-dehydrogenase
Gene Name : G6PD
UniProt ID : P11413
Defining Change(s) :

  • 1160G->A

Allele Name : Beverly Hills, Genova, Iwate, Niigata, Yamaguchi
Genotype(s) : Not Available
Type(s) : ADR Inferred
Groups : G6PD deficiency
Description : Increased risk of hemolytic anemia.
References :

  1. Gait JE: Hemolytic reactions to nidivofurantoin in patients with glucose-6-phosphate dehydrogenase deficiency: theory and practice. DICP. 1990 Dec;24(12):1210-3. [PubMed:2089833 ]
  2. Furadantin® (nidivofurantoin) Oral Suspension[package insert]. Florham Park, New Jersey: Shionogi Inc. 2013. [Link]

PMID: 10826655

Nitrofurantoin

By

Nitrofurantoin

Product: Irbesartan D4

Identifier : DBSNPE002448
Drug : DB00698 (Nidivofurantoin)
Interacting Gene/Enzyme : Glucose-6-phosphate 1-dehydrogenase
Gene Name : G6PD
UniProt ID : P11413
Defining Change(s) :

  • 1162A->G

Allele Name : Hartford
Genotype(s) : Not Available
Type(s) : ADR Inferred
Groups : G6PD deficiency
Description : Increased risk of hemolytic anemia.
References :

  1. Gait JE: Hemolytic reactions to nidivofurantoin in patients with glucose-6-phosphate dehydrogenase deficiency: theory and practice. DICP. 1990 Dec;24(12):1210-3. [PubMed:2089833 ]
  2. Furadantin® (nidivofurantoin) Oral Suspension[package insert]. Florham Park, New Jersey: Shionogi Inc. 2013. [Link]

PMID: 22745733

Nitrofurantoin

By

Nitrofurantoin

Product: Quetiapine (D4 fumarate)

Identifier : DBSNPE002449
Drug : DB00698 (Nidivofurantoin)
Interacting Gene/Enzyme : Glucose-6-phosphate 1-dehydrogenase
Gene Name : G6PD
UniProt ID : P11413
Defining Change(s) :

  • 1166A->G

Allele Name : Praha
Genotype(s) : Not Available
Type(s) : ADR Inferred
Groups : G6PD deficiency
Description : Increased risk of hemolytic anemia.
References :

  1. Gait JE: Hemolytic reactions to nidivofurantoin in patients with glucose-6-phosphate dehydrogenase deficiency: theory and practice. DICP. 1990 Dec;24(12):1210-3. [PubMed:2089833 ]
  2. Furadantin® (nidivofurantoin) Oral Suspension[package insert]. Florham Park, New Jersey: Shionogi Inc. 2013. [Link]

PMID: 19959748

Nitrofurantoin

By

Nitrofurantoin

Product: 3,3,5-Triiodo-L-thyronine

Identifier : DBSNPE002450
Drug : DB00698 (Nidivofurantoin)
Interacting Gene/Enzyme : Glucose-6-phosphate 1-dehydrogenase
Gene Name : G6PD
UniProt ID : P11413
Defining Change(s) :

  • 1175T>C

Allele Name : Krakow
Genotype(s) : Not Available
Type(s) : ADR Inferred
Groups : G6PD deficiency
Description : Increased risk of hemolytic anemia.
References :

  1. Gait JE: Hemolytic reactions to nidivofurantoin in patients with glucose-6-phosphate dehydrogenase deficiency: theory and practice. DICP. 1990 Dec;24(12):1210-3. [PubMed:2089833 ]
  2. Furadantin® (nidivofurantoin) Oral Suspension[package insert]. Florham Park, New Jersey: Shionogi Inc. 2013. [Link]

PMID: 17148450

Nitrofurantoin

By

Nitrofurantoin

Product: Etravirine D4

Identifier : DBSNPE002451
Drug : DB00698 (Nidivofurantoin)
Interacting Gene/Enzyme : Glucose-6-phosphate 1-dehydrogenase
Gene Name : G6PD
UniProt ID : P11413
Defining Change(s) :

  • 1177C->G

Allele Name : Wisconsin
Genotype(s) : Not Available
Type(s) : ADR Inferred
Groups : G6PD deficiency
Description : Increased risk of hemolytic anemia.
References :

  1. Gait JE: Hemolytic reactions to nidivofurantoin in patients with glucose-6-phosphate dehydrogenase deficiency: theory and practice. DICP. 1990 Dec;24(12):1210-3. [PubMed:2089833 ]
  2. Furadantin® (nidivofurantoin) Oral Suspension[package insert]. Florham Park, New Jersey: Shionogi Inc. 2013. [Link]

PMID: 11279265

Nitrofurantoin

By

Nitrofurantoin

Product: Naltrexone D4

Identifier : DBSNPE002452
Drug : DB00698 (Nidivofurantoin)
Interacting Gene/Enzyme : Glucose-6-phosphate 1-dehydrogenase
Gene Name : G6PD
UniProt ID : P11413
Defining Change(s) :

  • 1178G->A

Allele Name : Nashville, Anaheim, Portici
Genotype(s) : Not Available
Type(s) : ADR Inferred
Groups : G6PD deficiency
Description : Increased risk of hemolytic anemia.
References :

  1. Gait JE: Hemolytic reactions to nidivofurantoin in patients with glucose-6-phosphate dehydrogenase deficiency: theory and practice. DICP. 1990 Dec;24(12):1210-3. [PubMed:2089833 ]
  2. Furadantin® (nidivofurantoin) Oral Suspension[package insert]. Florham Park, New Jersey: Shionogi Inc. 2013. [Link]

PMID: 11033082

Nitrofurantoin

By

Nitrofurantoin

Product: Rosuvastatin (D6 Sodium)

Identifier : DBSNPE002453
Drug : DB00698 (Nidivofurantoin)
Interacting Gene/Enzyme : Glucose-6-phosphate 1-dehydrogenase
Gene Name : G6PD
UniProt ID : P11413
Defining Change(s) :

  • 1180G->C

Allele Name : Alhambra
Genotype(s) : Not Available
Type(s) : ADR Inferred
Groups : G6PD deficiency
Description : Increased risk of hemolytic anemia.
References :

  1. Gait JE: Hemolytic reactions to nidivofurantoin in patients with glucose-6-phosphate dehydrogenase deficiency: theory and practice. DICP. 1990 Dec;24(12):1210-3. [PubMed:2089833 ]
  2. Furadantin® (nidivofurantoin) Oral Suspension[package insert]. Florham Park, New Jersey: Shionogi Inc. 2013. [Link]

PMID: 25355946

Nitrofurantoin

By

Nitrofurantoin

Product: Nepafenac D5

Identifier : DBSNPE002454
Drug : DB00698 (Nidivofurantoin)
Interacting Gene/Enzyme : Glucose-6-phosphate 1-dehydrogenase
Gene Name : G6PD
UniProt ID : P11413
Defining Change(s) :

  • 1187C->T

Allele Name : Bari
Genotype(s) : Not Available
Type(s) : ADR Inferred
Groups : G6PD deficiency
Description : Increased risk of hemolytic anemia.
References :

  1. Gait JE: Hemolytic reactions to nidivofurantoin in patients with glucose-6-phosphate dehydrogenase deficiency: theory and practice. DICP. 1990 Dec;24(12):1210-3. [PubMed:2089833 ]
  2. Furadantin® (nidivofurantoin) Oral Suspension[package insert]. Florham Park, New Jersey: Shionogi Inc. 2013. [Link]

PMID: 25561726

Nitrofurantoin

By

Nitrofurantoin

Product: Folic acid

Identifier : DBSNPE002455
Drug : DB00698 (Nidivofurantoin)
Interacting Gene/Enzyme : Glucose-6-phosphate 1-dehydrogenase
Gene Name : G6PD
UniProt ID : P11413
Defining Change(s) :

  • 1192G->A

Allele Name : Puerto Limon
Genotype(s) : Not Available
Type(s) : ADR Inferred
Groups : G6PD deficiency
Description : Increased risk of hemolytic anemia.
References :

  1. Gait JE: Hemolytic reactions to nidivofurantoin in patients with glucose-6-phosphate dehydrogenase deficiency: theory and practice. DICP. 1990 Dec;24(12):1210-3. [PubMed:2089833 ]
  2. Furadantin® (nidivofurantoin) Oral Suspension[package insert]. Florham Park, New Jersey: Shionogi Inc. 2013. [Link]

PMID: 26413502

Nitrofurantoin

By

Nitrofurantoin

Product: Netupitant D6

Identifier : DBSNPE002456
Drug : DB00698 (Nidivofurantoin)
Interacting Gene/Enzyme : Glucose-6-phosphate 1-dehydrogenase
Gene Name : G6PD
UniProt ID : P11413
Defining Change(s) :

  • 1205C>A

Allele Name : Covao do Lobo
Genotype(s) : Not Available
Type(s) : ADR Inferred
Groups : G6PD deficiency
Description : Increased risk of hemolytic anemia.
References :

  1. Gait JE: Hemolytic reactions to nidivofurantoin in patients with glucose-6-phosphate dehydrogenase deficiency: theory and practice. DICP. 1990 Dec;24(12):1210-3. [PubMed:2089833 ]
  2. Furadantin® (nidivofurantoin) Oral Suspension[package insert]. Florham Park, New Jersey: Shionogi Inc. 2013. [Link]

PMID: 25918399

Nitrofurantoin

By

Nitrofurantoin

Product: E-64

Identifier : DBSNPE002457
Drug : DB00698 (Nidivofurantoin)
Interacting Gene/Enzyme : Glucose-6-phosphate 1-dehydrogenase
Gene Name : G6PD
UniProt ID : P11413
Defining Change(s) :

  • 1215G->A

Allele Name : Clinic
Genotype(s) : Not Available
Type(s) : ADR Inferred
Groups : G6PD deficiency
Description : Increased risk of hemolytic anemia.
References :

  1. Gait JE: Hemolytic reactions to nidivofurantoin in patients with glucose-6-phosphate dehydrogenase deficiency: theory and practice. DICP. 1990 Dec;24(12):1210-3. [PubMed:2089833 ]
  2. Furadantin® (nidivofurantoin) Oral Suspension[package insert]. Florham Park, New Jersey: Shionogi Inc. 2013. [Link]

PMID: 26528352

Nitrofurantoin

By

Nitrofurantoin

Product: Sofosbuvir D6

Identifier : DBSNPE002458
Drug : DB00698 (Nidivofurantoin)
Interacting Gene/Enzyme : Glucose-6-phosphate 1-dehydrogenase
Gene Name : G6PD
UniProt ID : P11413
Defining Change(s) :

  • 1225C->T

Allele Name : Udivecht
Genotype(s) : Not Available
Type(s) : ADR Inferred
Groups : G6PD deficiency
Description : Increased risk of hemolytic anemia.
References :

  1. Gait JE: Hemolytic reactions to nidivofurantoin in patients with glucose-6-phosphate dehydrogenase deficiency: theory and practice. DICP. 1990 Dec;24(12):1210-3. [PubMed:2089833 ]
  2. Furadantin® (nidivofurantoin) Oral Suspension[package insert]. Florham Park, New Jersey: Shionogi Inc. 2013. [Link]

PMID: 24610780

Nitrofurantoin

By

Nitrofurantoin

Product: Azilsartan D5

Identifier : DBSNPE002459
Drug : DB00698 (Nidivofurantoin)
Interacting Gene/Enzyme : Glucose-6-phosphate 1-dehydrogenase
Gene Name : G6PD
UniProt ID : P11413
Defining Change(s) :

  • 1226C->G

Allele Name : Suwalki
Genotype(s) : Not Available
Type(s) : ADR Inferred
Groups : G6PD deficiency
Description : Increased risk of hemolytic anemia.
References :

  1. Gait JE: Hemolytic reactions to nidivofurantoin in patients with glucose-6-phosphate dehydrogenase deficiency: theory and practice. DICP. 1990 Dec;24(12):1210-3. [PubMed:2089833 ]
  2. Furadantin® (nidivofurantoin) Oral Suspension[package insert]. Florham Park, New Jersey: Shionogi Inc. 2013. [Link]

PMID: 24722055

Nitrofurantoin

By

Nitrofurantoin

Product: Avibactam (sodium)

Identifier : DBSNPE002460
Drug : DB00698 (Nidivofurantoin)
Interacting Gene/Enzyme : Glucose-6-phosphate 1-dehydrogenase
Gene Name : G6PD
UniProt ID : P11413
Defining Change(s) :

  • 1228G->T

Allele Name : Riverside
Genotype(s) : Not Available
Type(s) : ADR Inferred
Groups : G6PD deficiency
Description : Increased risk of hemolytic anemia.
References :

  1. Gait JE: Hemolytic reactions to nidivofurantoin in patients with glucose-6-phosphate dehydrogenase deficiency: theory and practice. DICP. 1990 Dec;24(12):1210-3. [PubMed:2089833 ]
  2. Furadantin® (nidivofurantoin) Oral Suspension[package insert]. Florham Park, New Jersey: Shionogi Inc. 2013. [Link]

PMID: 24720754

Nitrofurantoin

By

Nitrofurantoin

Product: Aripiprazole (D8)

Identifier : DBSNPE002461
Drug : DB00698 (Nidivofurantoin)
Interacting Gene/Enzyme : Glucose-6-phosphate 1-dehydrogenase
Gene Name : G6PD
UniProt ID : P11413
Defining Change(s) :

  • 1229G->A

Allele Name : Japan, Shinagawa
Genotype(s) : Not Available
Type(s) : ADR Inferred
Groups : G6PD deficiency
Description : Increased risk of hemolytic anemia.
References :

  1. Gait JE: Hemolytic reactions to nidivofurantoin in patients with glucose-6-phosphate dehydrogenase deficiency: theory and practice. DICP. 1990 Dec;24(12):1210-3. [PubMed:2089833 ]
  2. Furadantin® (nidivofurantoin) Oral Suspension[package insert]. Florham Park, New Jersey: Shionogi Inc. 2013. [Link]

PMID: 24974728

Nitrofurantoin

By

Nitrofurantoin

Product: Vilazodone D8

Identifier : DBSNPE002462
Drug : DB00698 (Nidivofurantoin)
Interacting Gene/Enzyme : Glucose-6-phosphate 1-dehydrogenase
Gene Name : G6PD
UniProt ID : P11413
Defining Change(s) :

  • 1229G->C

Allele Name : Kawasaki
Genotype(s) : Not Available
Type(s) : ADR Inferred
Groups : G6PD deficiency
Description : Increased risk of hemolytic anemia.
References :

  1. Gait JE: Hemolytic reactions to nidivofurantoin in patients with glucose-6-phosphate dehydrogenase deficiency: theory and practice. DICP. 1990 Dec;24(12):1210-3. [PubMed:2089833 ]
  2. Furadantin® (nidivofurantoin) Oral Suspension[package insert]. Florham Park, New Jersey: Shionogi Inc. 2013. [Link]

PMID: 23660596

Nitrofurantoin

By

Nitrofurantoin

Product: ADX-47273

Identifier : DBSNPE002464
Drug : DB00698 (Nidivofurantoin)
Interacting Gene/Enzyme : Glucose-6-phosphate 1-dehydrogenase
Gene Name : G6PD
UniProt ID : P11413
Defining Change(s) :

  • 1284C->A

Allele Name : Georgia
Genotype(s) : Not Available
Type(s) : ADR Inferred
Groups : G6PD deficiency
Description : Increased risk of hemolytic anemia.
References :

  1. Gait JE: Hemolytic reactions to nidivofurantoin in patients with glucose-6-phosphate dehydrogenase deficiency: theory and practice. DICP. 1990 Dec;24(12):1210-3. [PubMed:2089833 ]
  2. Furadantin® (nidivofurantoin) Oral Suspension[package insert]. Florham Park, New Jersey: Shionogi Inc. 2013. [Link]

PMID: 23468959

Nitrofurantoin

By

Nitrofurantoin

Product: BLU9931

Identifier : DBSNPE002465
Drug : DB00698 (Nidivofurantoin)
Interacting Gene/Enzyme : Glucose-6-phosphate 1-dehydrogenase
Gene Name : G6PD
UniProt ID : P11413
Defining Change(s) :

  • 1292T->G

Allele Name : Sumare
Genotype(s) : Not Available
Type(s) : ADR Inferred
Groups : G6PD deficiency
Description : Increased risk of hemolytic anemia.
References :

  1. Gait JE: Hemolytic reactions to nidivofurantoin in patients with glucose-6-phosphate dehydrogenase deficiency: theory and practice. DICP. 1990 Dec;24(12):1210-3. [PubMed:2089833 ]
  2. Furadantin® (nidivofurantoin) Oral Suspension[package insert]. Florham Park, New Jersey: Shionogi Inc. 2013. [Link]

PMID: 22847803

Nitrofurantoin

By

Nitrofurantoin

Product: AEBSF

Identifier : DBSNPE002466
Drug : DB00698 (Nidivofurantoin)
Interacting Gene/Enzyme : Glucose-6-phosphate 1-dehydrogenase
Gene Name : G6PD
UniProt ID : P11413
Defining Change(s) :

  • 1318C->T

Allele Name : Telti/Kobe
Genotype(s) : Not Available
Type(s) : ADR Inferred
Groups : G6PD deficiency
Description : Increased risk of hemolytic anemia.
References :

  1. Gait JE: Hemolytic reactions to nidivofurantoin in patients with glucose-6-phosphate dehydrogenase deficiency: theory and practice. DICP. 1990 Dec;24(12):1210-3. [PubMed:2089833 ]
  2. Furadantin® (nidivofurantoin) Oral Suspension[package insert]. Florham Park, New Jersey: Shionogi Inc. 2013. [Link]

PMID: 22340501

Nitrofurantoin

By

Nitrofurantoin

Product: MCC950

Identifier : DBSNPE002467
Drug : DB00698 (Nidivofurantoin)
Interacting Gene/Enzyme : Glucose-6-phosphate 1-dehydrogenase
Gene Name : G6PD
UniProt ID : P11413
Defining Change(s) :

  • 1339G->A

Allele Name : Santiago de Cuba, Morioka
Genotype(s) : Not Available
Type(s) : ADR Inferred
Groups : G6PD deficiency
Description : Increased risk of hemolytic anemia.
References :

  1. Gait JE: Hemolytic reactions to nidivofurantoin in patients with glucose-6-phosphate dehydrogenase deficiency: theory and practice. DICP. 1990 Dec;24(12):1210-3. [PubMed:2089833 ]
  2. Furadantin® (nidivofurantoin) Oral Suspension[package insert]. Florham Park, New Jersey: Shionogi Inc. 2013. [Link]

PMID: 21738215

Nitrofurantoin

By

Nitrofurantoin

Product: AF38469

Identifier : DBSNPE002468
Drug : DB00698 (Nidivofurantoin)
Interacting Gene/Enzyme : Glucose-6-phosphate 1-dehydrogenase
Gene Name : G6PD
UniProt ID : P11413
Defining Change(s) :

  • 1358T->A

Allele Name : Harima
Genotype(s) : Not Available
Type(s) : ADR Inferred
Groups : G6PD deficiency
Description : Increased risk of hemolytic anemia.
References :

  1. Gait JE: Hemolytic reactions to nidivofurantoin in patients with glucose-6-phosphate dehydrogenase deficiency: theory and practice. DICP. 1990 Dec;24(12):1210-3. [PubMed:2089833 ]
  2. Furadantin® (nidivofurantoin) Oral Suspension[package insert]. Florham Park, New Jersey: Shionogi Inc. 2013. [Link]

PMID: 21421749

Nitrofurantoin

By

Nitrofurantoin

Product: DiZPK

Identifier : DBSNPE002469
Drug : DB00698 (Nidivofurantoin)
Interacting Gene/Enzyme : Glucose-6-phosphate 1-dehydrogenase
Gene Name : G6PD
UniProt ID : P11413
Defining Change(s) :

  • 1366G->C

Allele Name : Figuera da Foz
Genotype(s) : Not Available
Type(s) : ADR Inferred
Groups : G6PD deficiency
Description : Increased risk of hemolytic anemia.
References :

  1. Gait JE: Hemolytic reactions to nidivofurantoin in patients with glucose-6-phosphate dehydrogenase deficiency: theory and practice. DICP. 1990 Dec;24(12):1210-3. [PubMed:2089833 ]
  2. Furadantin® (nidivofurantoin) Oral Suspension[package insert]. Florham Park, New Jersey: Shionogi Inc. 2013. [Link]

PMID: 21935433

Nitrofurantoin

By

Nitrofurantoin

Product: 6-Alpha Naloxol

Identifier : DBSNPE002470
Drug : DB00698 (Nidivofurantoin)
Interacting Gene/Enzyme : Glucose-6-phosphate 1-dehydrogenase
Gene Name : G6PD
UniProt ID : P11413
Defining Change(s) :

  • 1367A>T

Allele Name : Amiens
Genotype(s) : Not Available
Type(s) : ADR Inferred
Groups : G6PD deficiency
Description : Increased risk of hemolytic anemia.
References :

  1. Gait JE: Hemolytic reactions to nidivofurantoin in patients with glucose-6-phosphate dehydrogenase deficiency: theory and practice. DICP. 1990 Dec;24(12):1210-3. [PubMed:2089833 ]
  2. Furadantin® (nidivofurantoin) Oral Suspension[package insert]. Florham Park, New Jersey: Shionogi Inc. 2013. [Link]

PMID: 21640723

Nitrofurantoin

By

Nitrofurantoin

Product: Albendazole sulfoxide D3

Identifier : DBSNPE002471
Drug : DB00698 (Nidivofurantoin)
Interacting Gene/Enzyme : Glucose-6-phosphate 1-dehydrogenase
Gene Name : G6PD
UniProt ID : P11413
Defining Change(s) :

  • 1376G->T, 1502T->G

Allele Name : Bangkok Noi
Genotype(s) : Not Available
Type(s) : ADR Inferred
Groups : G6PD deficiency
Description : Increased risk of hemolytic anemia.
References :

  1. Gait JE: Hemolytic reactions to nidivofurantoin in patients with glucose-6-phosphate dehydrogenase deficiency: theory and practice. DICP. 1990 Dec;24(12):1210-3. [PubMed:2089833 ]
  2. Furadantin® (nidivofurantoin) Oral Suspension[package insert]. Florham Park, New Jersey: Shionogi Inc. 2013. [Link]

PMID: 21160051

Nitrofurantoin

By

Nitrofurantoin

Product: Cycloguanil D6

Identifier : DBSNPE002472
Drug : DB00698 (Nidivofurantoin)
Interacting Gene/Enzyme : Glucose-6-phosphate 1-dehydrogenase
Gene Name : G6PD
UniProt ID : P11413
Defining Change(s) :

  • 1462G->A

Allele Name : Fukaya
Genotype(s) : Not Available
Type(s) : ADR Inferred
Groups : G6PD deficiency
Description : Increased risk of hemolytic anemia.
References :

  1. Gait JE: Hemolytic reactions to nidivofurantoin in patients with glucose-6-phosphate dehydrogenase deficiency: theory and practice. DICP. 1990 Dec;24(12):1210-3. [PubMed:2089833 ]
  2. Furadantin® (nidivofurantoin) Oral Suspension[package insert]. Florham Park, New Jersey: Shionogi Inc. 2013. [Link]

PMID: 21422248

Nitrofurantoin

By

Nitrofurantoin

Product: Losartan (D4 Carboxylic Acid)

Identifier : DBSNPE002473
Drug : DB00698 (Nidivofurantoin)
Interacting Gene/Enzyme : Glucose-6-phosphate 1-dehydrogenase
Gene Name : G6PD
UniProt ID : P11413
Defining Change(s) :

  • 1463G->T

Allele Name : Campinas
Genotype(s) : Not Available
Type(s) : ADR Inferred
Groups : G6PD deficiency
Description : Increased risk of hemolytic anemia.
References :

  1. Gait JE: Hemolytic reactions to nidivofurantoin in patients with glucose-6-phosphate dehydrogenase deficiency: theory and practice. DICP. 1990 Dec;24(12):1210-3. [PubMed:2089833 ]
  2. Furadantin® (nidivofurantoin) Oral Suspension[package insert]. Florham Park, New Jersey: Shionogi Inc. 2013. [Link]

PMID: 21398658

Nitrofurantoin

By

Nitrofurantoin

Product: DC_05

Identifier : DBSNPE002474
Drug : DB00698 (Nidivofurantoin)
Interacting Gene/Enzyme : Glucose-6-phosphate 1-dehydrogenase
Gene Name : G6PD
UniProt ID : P11413
Defining Change(s) :

  • 1465C>T

Allele Name : Buenos Aires
Genotype(s) : Not Available
Type(s) : ADR Inferred
Groups : G6PD deficiency
Description : Increased risk of hemolytic anemia.
References :

  1. Gait JE: Hemolytic reactions to nidivofurantoin in patients with glucose-6-phosphate dehydrogenase deficiency: theory and practice. DICP. 1990 Dec;24(12):1210-3. [PubMed:2089833 ]
  2. Furadantin® (nidivofurantoin) Oral Suspension[package insert]. Florham Park, New Jersey: Shionogi Inc. 2013. [Link]

PMID: 21795403

Nitrofurantoin

By

Nitrofurantoin

Product: (R)-Rivastigmine (D6 tartrate)

Identifier : DBSNPE002475
Drug : DB00698 (Nidivofurantoin)
Interacting Gene/Enzyme : Glucose-6-phosphate 1-dehydrogenase
Gene Name : G6PD
UniProt ID : P11413
Defining Change(s) :

  • 1466C->T

Allele Name : Arakawa
Genotype(s) : Not Available
Type(s) : ADR Inferred
Groups : G6PD deficiency
Description : Increased risk of hemolytic anemia.
References :

  1. Gait JE: Hemolytic reactions to nidivofurantoin in patients with glucose-6-phosphate dehydrogenase deficiency: theory and practice. DICP. 1990 Dec;24(12):1210-3. [PubMed:2089833 ]
  2. Furadantin® (nidivofurantoin) Oral Suspension[package insert]. Florham Park, New Jersey: Shionogi Inc. 2013. [Link]

PMID: 20667980

Nitrofurantoin

By

Nitrofurantoin

Product: PI-1840

Identifier : DBSNPE002476
Drug : DB00698 (Nidivofurantoin)
Interacting Gene/Enzyme : Glucose-6-phosphate 1-dehydrogenase
Gene Name : G6PD
UniProt ID : P11413
Defining Change(s) :

  • 1488_1490delGAA

Allele Name : Brighton
Genotype(s) : Not Available
Type(s) : ADR Inferred
Groups : G6PD deficiency
Description : Increased risk of hemolytic anemia.
References :

  1. Gait JE: Hemolytic reactions to nidivofurantoin in patients with glucose-6-phosphate dehydrogenase deficiency: theory and practice. DICP. 1990 Dec;24(12):1210-3. [PubMed:2089833 ]
  2. Furadantin® (nidivofurantoin) Oral Suspension[package insert]. Florham Park, New Jersey: Shionogi Inc. 2013. [Link]

PMID: 19038340

Nitrofurantoin

By

Nitrofurantoin

Product: Lumefantrine D18

Identifier : DBSNPE002477
Drug : DB00698 (Nidivofurantoin)
Interacting Gene/Enzyme : Glucose-6-phosphate 1-dehydrogenase
Gene Name : G6PD
UniProt ID : P11413
Defining Change(s) :

  • 159G->C

Allele Name : Kozukata
Genotype(s) : Not Available
Type(s) : ADR Inferred
Groups : G6PD deficiency
Description : Increased risk of hemolytic anemia.
References :

  1. Gait JE: Hemolytic reactions to nidivofurantoin in patients with glucose-6-phosphate dehydrogenase deficiency: theory and practice. DICP. 1990 Dec;24(12):1210-3. [PubMed:2089833 ]
  2. Furadantin® (nidivofurantoin) Oral Suspension[package insert]. Florham Park, New Jersey: Shionogi Inc. 2013. [Link]

PMID: 19407223

Nitrofurantoin

By

Nitrofurantoin

Product: Gadodiamide

Identifier : DBSNPE002478
Drug : DB00698 (Nidivofurantoin)
Interacting Gene/Enzyme : Glucose-6-phosphate 1-dehydrogenase
Gene Name : G6PD
UniProt ID : P11413
Defining Change(s) :

  • 180_182delTCT

Allele Name : Amsterdam
Genotype(s) : Not Available
Type(s) : ADR Inferred
Groups : G6PD deficiency
Description : Increased risk of hemolytic anemia.
References :

  1. Gait JE: Hemolytic reactions to nidivofurantoin in patients with glucose-6-phosphate dehydrogenase deficiency: theory and practice. DICP. 1990 Dec;24(12):1210-3. [PubMed:2089833 ]
  2. Furadantin® (nidivofurantoin) Oral Suspension[package insert]. Florham Park, New Jersey: Shionogi Inc. 2013. [Link]

PMID: 19109187

Nitrofurantoin

By

Nitrofurantoin

Product: Pamidronate (disodium pentahydrate)

Identifier : DBSNPE002479
Drug : DB00698 (Nidivofurantoin)
Interacting Gene/Enzyme : Glucose-6-phosphate 1-dehydrogenase
Gene Name : G6PD
UniProt ID : P11413
Defining Change(s) :

  • 202G->A, 376A->G, 1264C>G

Allele Name : No name
Genotype(s) : Not Available
Type(s) : ADR Inferred
Groups : G6PD deficiency
Description : Increased risk of hemolytic anemia.
References :

  1. Gait JE: Hemolytic reactions to nidivofurantoin in patients with glucose-6-phosphate dehydrogenase deficiency: theory and practice. DICP. 1990 Dec;24(12):1210-3. [PubMed:2089833 ]
  2. Furadantin® (nidivofurantoin) Oral Suspension[package insert]. Florham Park, New Jersey: Shionogi Inc. 2013. [Link]

PMID: 19638411

Nitrofurantoin

By

Nitrofurantoin

Product: L-Nicotine

Identifier : DBSNPE002480
Drug : DB00698 (Nidivofurantoin)
Interacting Gene/Enzyme : Glucose-6-phosphate 1-dehydrogenase
Gene Name : G6PD
UniProt ID : P11413
Defining Change(s) :

  • 224T->C

Allele Name : Swansea
Genotype(s) : Not Available
Type(s) : ADR Inferred
Groups : G6PD deficiency
Description : Increased risk of hemolytic anemia.
References :

  1. Gait JE: Hemolytic reactions to nidivofurantoin in patients with glucose-6-phosphate dehydrogenase deficiency: theory and practice. DICP. 1990 Dec;24(12):1210-3. [PubMed:2089833 ]
  2. Furadantin® (nidivofurantoin) Oral Suspension[package insert]. Florham Park, New Jersey: Shionogi Inc. 2013. [Link]

PMID: 18701682

Nitrofurantoin

By

Nitrofurantoin

Product: Amlodipine (besylate)

Identifier : DBSNPE002482
Drug : DB00698 (Nidivofurantoin)
Interacting Gene/Enzyme : Glucose-6-phosphate 1-dehydrogenase
Gene Name : G6PD
UniProt ID : P11413
Defining Change(s) :

  • 317C->G544C->T592C->T

Allele Name : Vancouver
Genotype(s) : Not Available
Type(s) : ADR Inferred
Groups : G6PD deficiency
Description : Increased risk of hemolytic anemia.
References :

  1. Gait JE: Hemolytic reactions to nidivofurantoin in patients with glucose-6-phosphate dehydrogenase deficiency: theory and practice. DICP. 1990 Dec;24(12):1210-3. [PubMed:2089833 ]
  2. Furadantin® (nidivofurantoin) Oral Suspension[package insert]. Florham Park, New Jersey: Shionogi Inc. 2013. [Link]

PMID: 18952601

Nitrofurantoin

By

Nitrofurantoin

Product: (S)-Dolaphenine (hydrochloride)

Identifier : DBSNPE002483
Drug : DB00698 (Nidivofurantoin)
Interacting Gene/Enzyme : Glucose-6-phosphate 1-dehydrogenase
Gene Name : G6PD
UniProt ID : P11413
Defining Change(s) :

  • 376A->G, 1159C->T

Allele Name : Mt Sinai
Genotype(s) : Not Available
Type(s) : ADR Inferred
Groups : G6PD deficiency
Description : Increased risk of hemolytic anemia.
References :

  1. Gait JE: Hemolytic reactions to nidivofurantoin in patients with glucose-6-phosphate dehydrogenase deficiency: theory and practice. DICP. 1990 Dec;24(12):1210-3. [PubMed:2089833 ]
  2. Furadantin® (nidivofurantoin) Oral Suspension[package insert]. Florham Park, New Jersey: Shionogi Inc. 2013. [Link]

PMID: 18626679

Nitrofurantoin

By

Nitrofurantoin

Product: (-)-Cevimeline (hydrochloride hemihydrate)

Identifier : DBSNPE002484
Drug : DB00698 (Nidivofurantoin)
Interacting Gene/Enzyme : Glucose-6-phosphate 1-dehydrogenase
Gene Name : G6PD
UniProt ID : P11413
Defining Change(s) :

  • 488G->A

Allele Name : Plymouth
Genotype(s) : Not Available
Type(s) : ADR Inferred
Groups : G6PD deficiency
Description : Increased risk of hemolytic anemia.
References :

  1. Gait JE: Hemolytic reactions to nidivofurantoin in patients with glucose-6-phosphate dehydrogenase deficiency: theory and practice. DICP. 1990 Dec;24(12):1210-3. [PubMed:2089833 ]
  2. Furadantin® (nidivofurantoin) Oral Suspension[package insert]. Florham Park, New Jersey: Shionogi Inc. 2013. [Link]

PMID: 18981097

Nitrofurantoin

By

Nitrofurantoin

Product: (+)-Cevimeline (hydrochloride hemihydrate)

Identifier : DBSNPE002485
Drug : DB00698 (Nidivofurantoin)
Interacting Gene/Enzyme : Glucose-6-phosphate 1-dehydrogenase
Gene Name : G6PD
UniProt ID : P11413
Defining Change(s) :

  • 514C->T

Allele Name : Volendam
Genotype(s) : Not Available
Type(s) : ADR Inferred
Groups : G6PD deficiency
Description : Increased risk of hemolytic anemia.
References :

  1. Gait JE: Hemolytic reactions to nidivofurantoin in patients with glucose-6-phosphate dehydrogenase deficiency: theory and practice. DICP. 1990 Dec;24(12):1210-3. [PubMed:2089833 ]
  2. Furadantin® (nidivofurantoin) Oral Suspension[package insert]. Florham Park, New Jersey: Shionogi Inc. 2013. [Link]

PMID: 17379415

Nitrofurantoin

By

Nitrofurantoin

Product: Cevimeline (hydrochloride)

Identifier : DBSNPE002486
Drug : DB00698 (Nidivofurantoin)
Interacting Gene/Enzyme : Glucose-6-phosphate 1-dehydrogenase
Gene Name : G6PD
UniProt ID : P11413
Defining Change(s) :

  • 527A->G

Allele Name : Shinshu
Genotype(s) : Not Available
Type(s) : ADR Inferred
Groups : G6PD deficiency
Description : Increased risk of hemolytic anemia.
References :

  1. Gait JE: Hemolytic reactions to nidivofurantoin in patients with glucose-6-phosphate dehydrogenase deficiency: theory and practice. DICP. 1990 Dec;24(12):1210-3. [PubMed:2089833 ]
  2. Furadantin® (nidivofurantoin) Oral Suspension[package insert]. Florham Park, New Jersey: Shionogi Inc. 2013. [Link]

PMID: 17517645

Nitrofurantoin

By

Nitrofurantoin

Product: GLPG0492 (R enantiomer)

Identifier : DBSNPE002487
Drug : DB00698 (Nidivofurantoin)
Interacting Gene/Enzyme : Glucose-6-phosphate 1-dehydrogenase
Gene Name : G6PD
UniProt ID : P11413
Defining Change(s) :

  • 535A->T

Allele Name : Chikugo
Genotype(s) : Not Available
Type(s) : ADR Inferred
Groups : G6PD deficiency
Description : Increased risk of hemolytic anemia.
References :

  1. Gait JE: Hemolytic reactions to nidivofurantoin in patients with glucose-6-phosphate dehydrogenase deficiency: theory and practice. DICP. 1990 Dec;24(12):1210-3. [PubMed:2089833 ]
  2. Furadantin® (nidivofurantoin) Oral Suspension[package insert]. Florham Park, New Jersey: Shionogi Inc. 2013. [Link]

PMID: 16954147

Nitrofurantoin

By

Nitrofurantoin

Product: Piperazine (citrate)

Identifier : DBSNPE002488
Drug : DB00698 (Nidivofurantoin)
Interacting Gene/Enzyme : Glucose-6-phosphate 1-dehydrogenase
Gene Name : G6PD
UniProt ID : P11413
Defining Change(s) :

  • 561_563delCTC

Allele Name : Tsukui
Genotype(s) : Not Available
Type(s) : ADR Inferred
Groups : G6PD deficiency
Description : Increased risk of hemolytic anemia.
References :

  1. Gait JE: Hemolytic reactions to nidivofurantoin in patients with glucose-6-phosphate dehydrogenase deficiency: theory and practice. DICP. 1990 Dec;24(12):1210-3. [PubMed:2089833 ]
  2. Furadantin® (nidivofurantoin) Oral Suspension[package insert]. Florham Park, New Jersey: Shionogi Inc. 2013. [Link]

PMID: 17188038

Nitrofurantoin

By

Nitrofurantoin

Product: ICA-121431

Identifier : DBSNPE002489
Drug : DB00698 (Nidivofurantoin)
Interacting Gene/Enzyme : Glucose-6-phosphate 1-dehydrogenase
Gene Name : G6PD
UniProt ID : P11413
Defining Change(s) :

  • 573C>G

Allele Name : Pedoplis-Ckaro
Genotype(s) : Not Available
Type(s) : ADR Inferred
Groups : G6PD deficiency
Description : Increased risk of hemolytic anemia.
References :

  1. Gait JE: Hemolytic reactions to nidivofurantoin in patients with glucose-6-phosphate dehydrogenase deficiency: theory and practice. DICP. 1990 Dec;24(12):1210-3. [PubMed:2089833 ]
  2. Furadantin® (nidivofurantoin) Oral Suspension[package insert]. Florham Park, New Jersey: Shionogi Inc. 2013. [Link]

PMID: 16551655

Nitrofurantoin

By

Nitrofurantoin

Product: Squalamine

Identifier : DBSNPE002490
Drug : DB00698 (Nidivofurantoin)
Interacting Gene/Enzyme : Glucose-6-phosphate 1-dehydrogenase
Gene Name : G6PD
UniProt ID : P11413
Defining Change(s) :

  • 593G->C

Allele Name : Santiago
Genotype(s) : Not Available
Type(s) : ADR Inferred
Groups : G6PD deficiency
Description : Increased risk of hemolytic anemia.
References :

  1. Gait JE: Hemolytic reactions to nidivofurantoin in patients with glucose-6-phosphate dehydrogenase deficiency: theory and practice. DICP. 1990 Dec;24(12):1210-3. [PubMed:2089833 ]
  2. Furadantin® (nidivofurantoin) Oral Suspension[package insert]. Florham Park, New Jersey: Shionogi Inc. 2013. [Link]

PMID: 25248565

Nitrofurantoin

By

Nitrofurantoin

Product: Savolitinib

Identifier : DBSNPE002491
Drug : DB00698 (Nidivofurantoin)
Interacting Gene/Enzyme : Glucose-6-phosphate 1-dehydrogenase
Gene Name : G6PD
UniProt ID : P11413
Defining Change(s) :

  • 637G->T

Allele Name : Minnesota, Marion, Gastonia, LeJeune
Genotype(s) : Not Available
Type(s) : ADR Inferred
Groups : G6PD deficiency
Description : Increased risk of hemolytic anemia.
References :

  1. Gait JE: Hemolytic reactions to nidivofurantoin in patients with glucose-6-phosphate dehydrogenase deficiency: theory and practice. DICP. 1990 Dec;24(12):1210-3. [PubMed:2089833 ]
  2. Furadantin® (nidivofurantoin) Oral Suspension[package insert]. Florham Park, New Jersey: Shionogi Inc. 2013. [Link]

PMID: 25858503

Nitrofurantoin

By

Nitrofurantoin

Product: Macitentan (n-butyl analogue)

Identifier : DBSNPE002492
Drug : DB00698 (Nidivofurantoin)
Interacting Gene/Enzyme : Glucose-6-phosphate 1-dehydrogenase
Gene Name : G6PD
UniProt ID : P11413
Defining Change(s) :

  • 637G->T, 1037A->T

Allele Name : Cincinnati
Genotype(s) : Not Available
Type(s) : ADR Inferred
Groups : G6PD deficiency
Description : Increased risk of hemolytic anemia.
References :

  1. Gait JE: Hemolytic reactions to nidivofurantoin in patients with glucose-6-phosphate dehydrogenase deficiency: theory and practice. DICP. 1990 Dec;24(12):1210-3. [PubMed:2089833 ]
  2. Furadantin® (nidivofurantoin) Oral Suspension[package insert]. Florham Park, New Jersey: Shionogi Inc. 2013. [Link]

PMID: 24391739

Nitrofurantoin

By

Nitrofurantoin

Product: Atovaquone D4

Identifier : DBSNPE002493
Drug : DB00698 (Nidivofurantoin)
Interacting Gene/Enzyme : Glucose-6-phosphate 1-dehydrogenase
Gene Name : G6PD
UniProt ID : P11413
Defining Change(s) :

  • 648T->G

Allele Name : Harilaou
Genotype(s) : Not Available
Type(s) : ADR Inferred
Groups : G6PD deficiency
Description : Increased risk of hemolytic anemia.
References :

  1. Gait JE: Hemolytic reactions to nidivofurantoin in patients with glucose-6-phosphate dehydrogenase deficiency: theory and practice. DICP. 1990 Dec;24(12):1210-3. [PubMed:2089833 ]
  2. Furadantin® (nidivofurantoin) Oral Suspension[package insert]. Florham Park, New Jersey: Shionogi Inc. 2013. [Link]

PMID: 23166798

Nitrofurantoin

By

Nitrofurantoin

Product: L-779450

Identifier : DBSNPE002494
Drug : DB00698 (Nidivofurantoin)
Interacting Gene/Enzyme : Glucose-6-phosphate 1-dehydrogenase
Gene Name : G6PD
UniProt ID : P11413
Defining Change(s) :

  • 683_685delACA

Allele Name : North Dallas
Genotype(s) : Not Available
Type(s) : ADR Inferred
Groups : G6PD deficiency
Description : Increased risk of hemolytic anemia.
References :

  1. Gait JE: Hemolytic reactions to nidivofurantoin in patients with glucose-6-phosphate dehydrogenase deficiency: theory and practice. DICP. 1990 Dec;24(12):1210-3. [PubMed:2089833 ]
  2. Furadantin® (nidivofurantoin) Oral Suspension[package insert]. Florham Park, New Jersey: Shionogi Inc. 2013. [Link]

PMID: 20561505

Nitrofurantoin

By

Nitrofurantoin

Product: Desbutyl Lumefantrine D9

Identifier : DBSNPE002495
Drug : DB00698 (Nidivofurantoin)
Interacting Gene/Enzyme : Glucose-6-phosphate 1-dehydrogenase
Gene Name : G6PD
UniProt ID : P11413
Defining Change(s) :

  • 695G->A

Allele Name : Asahikawa
Genotype(s) : Not Available
Type(s) : ADR Inferred
Groups : G6PD deficiency
Description : Increased risk of hemolytic anemia.
References :

  1. Gait JE: Hemolytic reactions to nidivofurantoin in patients with glucose-6-phosphate dehydrogenase deficiency: theory and practice. DICP. 1990 Dec;24(12):1210-3. [PubMed:2089833 ]
  2. Furadantin® (nidivofurantoin) Oral Suspension[package insert]. Florham Park, New Jersey: Shionogi Inc. 2013. [Link]

PMID: 20617560

Nitrofurantoin

By

Nitrofurantoin

Product: Cyantraniliprole D3

Identifier : DBSNPE002496
Drug : DB00698 (Nidivofurantoin)
Interacting Gene/Enzyme : Glucose-6-phosphate 1-dehydrogenase
Gene Name : G6PD
UniProt ID : P11413
Defining Change(s) :

  • 713A->G

Allele Name : Durham
Genotype(s) : Not Available
Type(s) : ADR Inferred
Groups : G6PD deficiency
Description : Increased risk of hemolytic anemia.
References :

  1. Gait JE: Hemolytic reactions to nidivofurantoin in patients with glucose-6-phosphate dehydrogenase deficiency: theory and practice. DICP. 1990 Dec;24(12):1210-3. [PubMed:2089833 ]
  2. Furadantin® (nidivofurantoin) Oral Suspension[package insert]. Florham Park, New Jersey: Shionogi Inc. 2013. [Link]

PMID: 20613717

Nitrofurantoin

By

Nitrofurantoin

Product: Cyantraniliprole

Identifier : DBSNPE002497
Drug : DB00698 (Nidivofurantoin)
Interacting Gene/Enzyme : Glucose-6-phosphate 1-dehydrogenase
Gene Name : G6PD
UniProt ID : P11413
Defining Change(s) :

  • 724_729delGGCACT

Allele Name : Stonybrook
Genotype(s) : Not Available
Type(s) : ADR Inferred
Groups : G6PD deficiency
Description : Increased risk of hemolytic anemia.
References :

  1. Gait JE: Hemolytic reactions to nidivofurantoin in patients with glucose-6-phosphate dehydrogenase deficiency: theory and practice. DICP. 1990 Dec;24(12):1210-3. [PubMed:2089833 ]
  2. Furadantin® (nidivofurantoin) Oral Suspension[package insert]. Florham Park, New Jersey: Shionogi Inc. 2013. [Link]

PMID: 18268107

Nitrofurantoin

By

Nitrofurantoin

Product: Hydroxy Itraconazole D8

Identifier : DBSNPE002498
Drug : DB00698 (Nidivofurantoin)
Interacting Gene/Enzyme : Glucose-6-phosphate 1-dehydrogenase
Gene Name : G6PD
UniProt ID : P11413
Defining Change(s) :

  • 769C->G

Allele Name : Wayne
Genotype(s) : Not Available
Type(s) : ADR Inferred
Groups : G6PD deficiency
Description : Increased risk of hemolytic anemia.
References :

  1. Gait JE: Hemolytic reactions to nidivofurantoin in patients with glucose-6-phosphate dehydrogenase deficiency: theory and practice. DICP. 1990 Dec;24(12):1210-3. [PubMed:2089833 ]
  2. Furadantin® (nidivofurantoin) Oral Suspension[package insert]. Florham Park, New Jersey: Shionogi Inc. 2013. [Link]

PMID: 21082766

Nitrofurantoin

By

Nitrofurantoin

Product: O-desmethyl Mebeverine acid D5

Identifier : DBSNPE002499
Drug : DB00698 (Nidivofurantoin)
Interacting Gene/Enzyme : Glucose-6-phosphate 1-dehydrogenase
Gene Name : G6PD
UniProt ID : P11413
Defining Change(s) :

  • 806G->A

Allele Name : Aveiro
Genotype(s) : Not Available
Type(s) : ADR Inferred
Groups : G6PD deficiency
Description : Increased risk of hemolytic anemia.
References :

  1. Gait JE: Hemolytic reactions to nidivofurantoin in patients with glucose-6-phosphate dehydrogenase deficiency: theory and practice. DICP. 1990 Dec;24(12):1210-3. [PubMed:2089833 ]
  2. Furadantin® (nidivofurantoin) Oral Suspension[package insert]. Florham Park, New Jersey: Shionogi Inc. 2013. [Link]

PMID: 19775160

Nitrofurantoin

By

Nitrofurantoin

Product: Mebeverine alcohol D5

Identifier : DBSNPE002500
Drug : DB00698 (Nidivofurantoin)
Interacting Gene/Enzyme : Glucose-6-phosphate 1-dehydrogenase
Gene Name : G6PD
UniProt ID : P11413
Defining Change(s) :

  • 820G->A

Allele Name : Cleveland Corum
Genotype(s) : Not Available
Type(s) : ADR Inferred
Groups : G6PD deficiency
Description : Increased risk of hemolytic anemia.
References :

  1. Gait JE: Hemolytic reactions to nidivofurantoin in patients with glucose-6-phosphate dehydrogenase deficiency: theory and practice. DICP. 1990 Dec;24(12):1210-3. [PubMed:2089833 ]
  2. Furadantin® (nidivofurantoin) Oral Suspension[package insert]. Florham Park, New Jersey: Shionogi Inc. 2013. [Link]

PMID: 26997328

Nitrofurantoin

By

Nitrofurantoin

Product: Mebeverine acid D5

Identifier : DBSNPE002501
Drug : DB00698 (Nidivofurantoin)
Interacting Gene/Enzyme : Glucose-6-phosphate 1-dehydrogenase
Gene Name : G6PD
UniProt ID : P11413
Defining Change(s) :

  • 821A>T

Allele Name : Lille
Genotype(s) : Not Available
Type(s) : ADR Inferred
Groups : G6PD deficiency
Description : Increased risk of hemolytic anemia.
References :

  1. Gait JE: Hemolytic reactions to nidivofurantoin in patients with glucose-6-phosphate dehydrogenase deficiency: theory and practice. DICP. 1990 Dec;24(12):1210-3. [PubMed:2089833 ]
  2. Furadantin® (nidivofurantoin) Oral Suspension[package insert]. Florham Park, New Jersey: Shionogi Inc. 2013. [Link]

PMID: 11881998

Nitrofurantoin

By

Nitrofurantoin

Product: 4-Hydroxyphenyl Carvedilol D5

Identifier : DBSNPE002502
Drug : DB00698 (Nidivofurantoin)
Interacting Gene/Enzyme : Glucose-6-phosphate 1-dehydrogenase
Gene Name : G6PD
UniProt ID : P11413
Defining Change(s) :

  • 825G>C

Allele Name : Bangkok
Genotype(s) : Not Available
Type(s) : ADR Inferred
Groups : G6PD deficiency
Description : Increased risk of hemolytic anemia.
References :

  1. Gait JE: Hemolytic reactions to nidivofurantoin in patients with glucose-6-phosphate dehydrogenase deficiency: theory and practice. DICP. 1990 Dec;24(12):1210-3. [PubMed:2089833 ]
  2. Furadantin® (nidivofurantoin) Oral Suspension[package insert]. Florham Park, New Jersey: Shionogi Inc. 2013. [Link]

PMID: 17329210

Nitrofurantoin

By

Nitrofurantoin

Product: Bupropion morpholinol D6

Identifier : DBSNPE002503
Drug : DB00698 (Nidivofurantoin)
Interacting Gene/Enzyme : Glucose-6-phosphate 1-dehydrogenase
Gene Name : G6PD
UniProt ID : P11413
Defining Change(s) :

  • 826C->T

Allele Name : Sugao
Genotype(s) : Not Available
Type(s) : ADR Inferred
Groups : G6PD deficiency
Description : Increased risk of hemolytic anemia.
References :

  1. Gait JE: Hemolytic reactions to nidivofurantoin in patients with glucose-6-phosphate dehydrogenase deficiency: theory and practice. DICP. 1990 Dec;24(12):1210-3. [PubMed:2089833 ]
  2. Furadantin® (nidivofurantoin) Oral Suspension[package insert]. Florham Park, New Jersey: Shionogi Inc. 2013. [Link]

PMID: 8616851

Nitrofurantoin

By

Nitrofurantoin

Product: Piribedil D8

Identifier : DBSNPE002504
Drug : DB00698 (Nidivofurantoin)
Interacting Gene/Enzyme : Glucose-6-phosphate 1-dehydrogenase
Gene Name : G6PD
UniProt ID : P11413
Defining Change(s) :

  • 832T->C

Allele Name : La Jolla
Genotype(s) : Not Available
Type(s) : ADR Inferred
Groups : G6PD deficiency
Description : Increased risk of hemolytic anemia.
References :

  1. Gait JE: Hemolytic reactions to nidivofurantoin in patients with glucose-6-phosphate dehydrogenase deficiency: theory and practice. DICP. 1990 Dec;24(12):1210-3. [PubMed:2089833 ]
  2. Furadantin® (nidivofurantoin) Oral Suspension[package insert]. Florham Park, New Jersey: Shionogi Inc. 2013. [Link]

PMID: 8033142

Nitrofurantoin

By

Nitrofurantoin

Product: Molidustat

Identifier : DBSNPE002505
Drug : DB00698 (Nidivofurantoin)
Interacting Gene/Enzyme : Glucose-6-phosphate 1-dehydrogenase
Gene Name : G6PD
UniProt ID : P11413
Defining Change(s) :

  • 833C->T

Allele Name : Wexham
Genotype(s) : Not Available
Type(s) : ADR Inferred
Groups : G6PD deficiency
Description : Increased risk of hemolytic anemia.
References :

  1. Gait JE: Hemolytic reactions to nidivofurantoin in patients with glucose-6-phosphate dehydrogenase deficiency: theory and practice. DICP. 1990 Dec;24(12):1210-3. [PubMed:2089833 ]
  2. Furadantin® (nidivofurantoin) Oral Suspension[package insert]. Florham Park, New Jersey: Shionogi Inc. 2013. [Link]

PMID: 17368614

Nitrofurantoin

By

Nitrofurantoin

Product: Vipadenant

Identifier : DBSNPE002506
Drug : DB00698 (Nidivofurantoin)
Interacting Gene/Enzyme : Glucose-6-phosphate 1-dehydrogenase
Gene Name : G6PD
UniProt ID : P11413
Defining Change(s) :

  • 851T>C

Allele Name : Piodivkow
Genotype(s) : Not Available
Type(s) : ADR Inferred
Groups : G6PD deficiency
Description : Increased risk of hemolytic anemia.
References :

  1. Gait JE: Hemolytic reactions to nidivofurantoin in patients with glucose-6-phosphate dehydrogenase deficiency: theory and practice. DICP. 1990 Dec;24(12):1210-3. [PubMed:2089833 ]
  2. Furadantin® (nidivofurantoin) Oral Suspension[package insert]. Florham Park, New Jersey: Shionogi Inc. 2013. [Link]

PMID: 3126294

Nitrofurantoin

By

Nitrofurantoin

Product: Trimetrexate

Identifier : DBSNPE002507
Drug : DB00698 (Nidivofurantoin)
Interacting Gene/Enzyme : Glucose-6-phosphate 1-dehydrogenase
Gene Name : G6PD
UniProt ID : P11413
Defining Change(s) :

  • 910G->T

Allele Name : West Virginia
Genotype(s) : Not Available
Type(s) : ADR Inferred
Groups : G6PD deficiency
Description : Increased risk of hemolytic anemia.
References :

  1. Gait JE: Hemolytic reactions to nidivofurantoin in patients with glucose-6-phosphate dehydrogenase deficiency: theory and practice. DICP. 1990 Dec;24(12):1210-3. [PubMed:2089833 ]
  2. Furadantin® (nidivofurantoin) Oral Suspension[package insert]. Florham Park, New Jersey: Shionogi Inc. 2013. [Link]

PMID: 7599657

Nitrofurantoin

By

Nitrofurantoin

Product: Teprenone

Identifier : DBSNPE002508
Drug : DB00698 (Nidivofurantoin)
Interacting Gene/Enzyme : Glucose-6-phosphate 1-dehydrogenase
Gene Name : G6PD
UniProt ID : P11413
Defining Change(s) :

  • 921G->C

Allele Name : Omiya
Genotype(s) : Not Available
Type(s) : ADR Inferred
Groups : G6PD deficiency
Description : Increased risk of hemolytic anemia.
References :

  1. Gait JE: Hemolytic reactions to nidivofurantoin in patients with glucose-6-phosphate dehydrogenase deficiency: theory and practice. DICP. 1990 Dec;24(12):1210-3. [PubMed:2089833 ]
  2. Furadantin® (nidivofurantoin) Oral Suspension[package insert]. Florham Park, New Jersey: Shionogi Inc. 2013. [Link]

PMID: 2140979

Nitrofurantoin

By

Nitrofurantoin

Product: Guanethidine (sulfate)

Identifier : DBSNPE002509
Drug : DB00698 (Nidivofurantoin)
Interacting Gene/Enzyme : Glucose-6-phosphate 1-dehydrogenase
Gene Name : G6PD
UniProt ID : P11413
Defining Change(s) :

  • 953_976delCCACCAAAGGGTACCTGGAC GACC

Allele Name : Nara
Genotype(s) : Not Available
Type(s) : ADR Inferred
Groups : G6PD deficiency
Description : Increased risk of hemolytic anemia.
References :

  1. Gait JE: Hemolytic reactions to nidivofurantoin in patients with glucose-6-phosphate dehydrogenase deficiency: theory and practice. DICP. 1990 Dec;24(12):1210-3. [PubMed:2089833 ]
  2. Furadantin® (nidivofurantoin) Oral Suspension[package insert]. Florham Park, New Jersey: Shionogi Inc. 2013. [Link]

PMID: 2151003

Nitrofurantoin

By

Nitrofurantoin

Product: Acetazolamide D3

Identifier : DBSNPE002510
Drug : DB00698 (Nidivofurantoin)
Interacting Gene/Enzyme : Glucose-6-phosphate 1-dehydrogenase
Gene Name : G6PD
UniProt ID : P11413
Defining Change(s) :

  • 962G->A

Allele Name : Manhattan
Genotype(s) : Not Available
Type(s) : ADR Inferred
Groups : G6PD deficiency
Description : Increased risk of hemolytic anemia.
References :

  1. Gait JE: Hemolytic reactions to nidivofurantoin in patients with glucose-6-phosphate dehydrogenase deficiency: theory and practice. DICP. 1990 Dec;24(12):1210-3. [PubMed:2089833 ]
  2. Furadantin® (nidivofurantoin) Oral Suspension[package insert]. Florham Park, New Jersey: Shionogi Inc. 2013. [Link]

PMID: 12606616

Nitrofurantoin

By

Nitrofurantoin

Product: Ciprofibrate D6

Identifier : DBSNPE002511
Drug : DB00698 (Nidivofurantoin)
Interacting Gene/Enzyme : Glucose-6-phosphate 1-dehydrogenase
Gene Name : G6PD
UniProt ID : P11413
Defining Change(s) :

  • 964T->C

Allele Name : Rehevot
Genotype(s) : Not Available
Type(s) : ADR Inferred
Groups : G6PD deficiency
Description : Increased risk of hemolytic anemia.
References :

  1. Gait JE: Hemolytic reactions to nidivofurantoin in patients with glucose-6-phosphate dehydrogenase deficiency: theory and practice. DICP. 1990 Dec;24(12):1210-3. [PubMed:2089833 ]
  2. Furadantin® (nidivofurantoin) Oral Suspension[package insert]. Florham Park, New Jersey: Shionogi Inc. 2013. [Link]

PMID: 11883648

Nitrofurantoin

By

Nitrofurantoin

Product: Triamterene D5

Identifier : DBSNPE002512
Drug : DB00698 (Nidivofurantoin)
Interacting Gene/Enzyme : Glucose-6-phosphate 1-dehydrogenase
Gene Name : G6PD
UniProt ID : P11413
Defining Change(s) :

  • 99A->G
  • 1360C->T

Allele Name : Honiara
Genotype(s) : Not Available
Type(s) : ADR Inferred
Groups : G6PD deficiency
Description : Increased risk of hemolytic anemia.
References :

  1. Gait JE: Hemolytic reactions to nidivofurantoin in patients with glucose-6-phosphate dehydrogenase deficiency: theory and practice. DICP. 1990 Dec;24(12):1210-3. [PubMed:2089833 ]
  2. Furadantin® (nidivofurantoin) Oral Suspension[package insert]. Florham Park, New Jersey: Shionogi Inc. 2013. [Link]

PMID: 19375162

Nitrofurantoin

By

Nitrofurantoin

Product: Hydroxyzine (D4 dihydrochloride)

Identifier : DBSNPE002513
Drug : DB00698 (Nidivofurantoin)
Interacting Gene/Enzyme : Glucose-6-phosphate 1-dehydrogenase
Gene Name : G6PD
UniProt ID : P11413
Defining Change(s) :

  • 1246G->A

Allele Name : Tokyo, Fukushima
Genotype(s) : Not Available
Type(s) : ADR Inferred
Groups : G6PD deficiency
Description : Increased risk of hemolytic anemia.
References :

  1. Gait JE: Hemolytic reactions to nidivofurantoin in patients with glucose-6-phosphate dehydrogenase deficiency: theory and practice. DICP. 1990 Dec;24(12):1210-3. [PubMed:2089833 ]
  2. Furadantin® (nidivofurantoin) Oral Suspension[package insert]. Florham Park, New Jersey: Shionogi Inc. 2013. [Link]

PMID: 14594454

Nitrofurantoin

By

Nitrofurantoin

Product: Mycophenolic acid D3

Identifier : DBSNPE002514
Drug : DB00698 (Nidivofurantoin)
Interacting Gene/Enzyme : Glucose-6-phosphate 1-dehydrogenase
Gene Name : G6PD
UniProt ID : P11413
Defining Change(s) :

  • 1003G->A

Allele Name : Chatham
Genotype(s) : Not Available
Type(s) : ADR Inferred
Groups : G6PD deficiency
Description : Increased risk of hemolytic anemia.
References :

  1. Gait JE: Hemolytic reactions to nidivofurantoin in patients with glucose-6-phosphate dehydrogenase deficiency: theory and practice. DICP. 1990 Dec;24(12):1210-3. [PubMed:2089833 ]
  2. Furadantin® (nidivofurantoin) Oral Suspension[package insert]. Florham Park, New Jersey: Shionogi Inc. 2013. [Link]

PMID: 9300077

Nitrofurantoin

By

Nitrofurantoin

Product: Enalapril (D5 maleate)

Identifier : DBSNPE002515
Drug : DB00698 (Nidivofurantoin)
Interacting Gene/Enzyme : Glucose-6-phosphate 1-dehydrogenase
Gene Name : G6PD
UniProt ID : P11413
Defining Change(s) :

  • 1004C->A

Allele Name : Fushan
Genotype(s) : Not Available
Type(s) : ADR Inferred
Groups : G6PD deficiency
Description : Increased risk of hemolytic anemia.
References :

  1. Gait JE: Hemolytic reactions to nidivofurantoin in patients with glucose-6-phosphate dehydrogenase deficiency: theory and practice. DICP. 1990 Dec;24(12):1210-3. [PubMed:2089833 ]
  2. Furadantin® (nidivofurantoin) Oral Suspension[package insert]. Florham Park, New Jersey: Shionogi Inc. 2013. [Link]

PMID: 16789738

Nitrofurantoin

By

Nitrofurantoin

Product: Phenindione D5

Identifier : DBSNPE002516
Drug : DB00698 (Nidivofurantoin)
Interacting Gene/Enzyme : Glucose-6-phosphate 1-dehydrogenase
Gene Name : G6PD
UniProt ID : P11413
Defining Change(s) :

  • 1052G->T

Allele Name : Partenope
Genotype(s) : Not Available
Type(s) : ADR Inferred
Groups : G6PD deficiency
Description : Increased risk of hemolytic anemia.
References :

  1. Gait JE: Hemolytic reactions to nidivofurantoin in patients with glucose-6-phosphate dehydrogenase deficiency: theory and practice. DICP. 1990 Dec;24(12):1210-3. [PubMed:2089833 ]
  2. Furadantin® (nidivofurantoin) Oral Suspension[package insert]. Florham Park, New Jersey: Shionogi Inc. 2013. [Link]

PMID: 12502365

Nitrofurantoin

By

Nitrofurantoin

Product: Nifedipine D6

Identifier : DBSNPE002517
Drug : DB00698 (Nidivofurantoin)
Interacting Gene/Enzyme : Glucose-6-phosphate 1-dehydrogenase
Gene Name : G6PD
UniProt ID : P11413
Defining Change(s) :

  • 1057C->T

Allele Name : Ierapediva
Genotype(s) : Not Available
Type(s) : ADR Inferred
Groups : G6PD deficiency
Description : Increased risk of hemolytic anemia.
References :

  1. Gait JE: Hemolytic reactions to nidivofurantoin in patients with glucose-6-phosphate dehydrogenase deficiency: theory and practice. DICP. 1990 Dec;24(12):1210-3. [PubMed:2089833 ]
  2. Furadantin® (nidivofurantoin) Oral Suspension[package insert]. Florham Park, New Jersey: Shionogi Inc. 2013. [Link]

PMID: 9784092

Nitrofurantoin

By

Nitrofurantoin

Product: Pitavastatin D4

Identifier : DBSNPE002519
Drug : DB00698 (Nidivofurantoin)
Interacting Gene/Enzyme : Glucose-6-phosphate 1-dehydrogenase
Gene Name : G6PD
UniProt ID : P11413
Defining Change(s) :

  • 1220A->C

Allele Name : Abeno
Genotype(s) : Not Available
Type(s) : ADR Inferred
Groups : G6PD deficiency
Description : Increased risk of hemolytic anemia.
References :

  1. Gait JE: Hemolytic reactions to nidivofurantoin in patients with glucose-6-phosphate dehydrogenase deficiency: theory and practice. DICP. 1990 Dec;24(12):1210-3. [PubMed:2089833 ]
  2. Furadantin® (nidivofurantoin) Oral Suspension[package insert]. Florham Park, New Jersey: Shionogi Inc. 2013. [Link]

PMID: 19072222

Nitrofurantoin

By

Nitrofurantoin

Product: Omeprazole D3

Identifier : DBSNPE002520
Drug : DB00698 (Nidivofurantoin)
Interacting Gene/Enzyme : Glucose-6-phosphate 1-dehydrogenase
Gene Name : G6PD
UniProt ID : P11413
Defining Change(s) :

  • 1291G->A

Allele Name : Surabaya
Genotype(s) : Not Available
Type(s) : ADR Inferred
Groups : G6PD deficiency
Description : Increased risk of hemolytic anemia.
References :

  1. Gait JE: Hemolytic reactions to nidivofurantoin in patients with glucose-6-phosphate dehydrogenase deficiency: theory and practice. DICP. 1990 Dec;24(12):1210-3. [PubMed:2089833 ]
  2. Furadantin® (nidivofurantoin) Oral Suspension[package insert]. Florham Park, New Jersey: Shionogi Inc. 2013. [Link]

PMID: 21718300

Nitrofurantoin

By

Nitrofurantoin

Product: Azelnidipine D7

Identifier : DBSNPE002521
Drug : DB00698 (Nidivofurantoin)
Interacting Gene/Enzyme : Glucose-6-phosphate 1-dehydrogenase
Gene Name : G6PD
UniProt ID : P11413
Defining Change(s) :

  • 1316G->C

Allele Name : Pawnee
Genotype(s) : Not Available
Type(s) : ADR Inferred
Groups : G6PD deficiency
Description : Increased risk of hemolytic anemia.
References :

  1. Gait JE: Hemolytic reactions to nidivofurantoin in patients with glucose-6-phosphate dehydrogenase deficiency: theory and practice. DICP. 1990 Dec;24(12):1210-3. [PubMed:2089833 ]
  2. Furadantin® (nidivofurantoin) Oral Suspension[package insert]. Florham Park, New Jersey: Shionogi Inc. 2013. [Link]

PMID: 19582812

Nitrofurantoin

By

Nitrofurantoin

Product: Doxylamine (D5 succinate)

Identifier : DBSNPE002522
Drug : DB00698 (Nidivofurantoin)
Interacting Gene/Enzyme : Glucose-6-phosphate 1-dehydrogenase
Gene Name : G6PD
UniProt ID : P11413
Defining Change(s) :

  • 1342A->G

Allele Name : S. Antioco
Genotype(s) : Not Available
Type(s) : ADR Inferred
Groups : G6PD deficiency
Description : Increased risk of hemolytic anemia.
References :

  1. Gait JE: Hemolytic reactions to nidivofurantoin in patients with glucose-6-phosphate dehydrogenase deficiency: theory and practice. DICP. 1990 Dec;24(12):1210-3. [PubMed:2089833 ]
  2. Furadantin® (nidivofurantoin) Oral Suspension[package insert]. Florham Park, New Jersey: Shionogi Inc. 2013. [Link]

PMID: 23148522

Nitrofurantoin

By

Nitrofurantoin

Product: Alosetron (D3 Hydrochloride)

Identifier : DBSNPE002523
Drug : DB00698 (Nidivofurantoin)
Interacting Gene/Enzyme : Glucose-6-phosphate 1-dehydrogenase
Gene Name : G6PD
UniProt ID : P11413
Defining Change(s) :

  • 1347G->C

Allele Name : Cassano
Genotype(s) : Not Available
Type(s) : ADR Inferred
Groups : G6PD deficiency
Description : Increased risk of hemolytic anemia.
References :

  1. Gait JE: Hemolytic reactions to nidivofurantoin in patients with glucose-6-phosphate dehydrogenase deficiency: theory and practice. DICP. 1990 Dec;24(12):1210-3. [PubMed:2089833 ]
  2. Furadantin® (nidivofurantoin) Oral Suspension[package insert]. Florham Park, New Jersey: Shionogi Inc. 2013. [Link]

PMID: 22967846

Nitrofurantoin

By

Nitrofurantoin

Product: Valsartan D9

Identifier : DBSNPE002524
Drug : DB00698 (Nidivofurantoin)
Interacting Gene/Enzyme : Glucose-6-phosphate 1-dehydrogenase
Gene Name : G6PD
UniProt ID : P11413
Defining Change(s) :

  • 1347G->C
  • 1360C->T

Allele Name : Hermoupolis
Genotype(s) : Not Available
Type(s) : ADR Inferred
Groups : G6PD deficiency
Description : Increased risk of hemolytic anemia.
References :

  1. Gait JE: Hemolytic reactions to nidivofurantoin in patients with glucose-6-phosphate dehydrogenase deficiency: theory and practice. DICP. 1990 Dec;24(12):1210-3. [PubMed:2089833 ]
  2. Furadantin® (nidivofurantoin) Oral Suspension[package insert]. Florham Park, New Jersey: Shionogi Inc. 2013. [Link]

PMID: 20826425

Nitrofurantoin

By

Nitrofurantoin

Product: Closantel (sodium)

Identifier : DBSNPE002525
Drug : DB00698 (Nidivofurantoin)
Interacting Gene/Enzyme : Glucose-6-phosphate 1-dehydrogenase
Gene Name : G6PD
UniProt ID : P11413
Defining Change(s) :

  • 1360C->T

Allele Name : Union,Maewo, Chinese-2, Kalo
Genotype(s) : Not Available
Type(s) : ADR Inferred
Groups : G6PD deficiency
Description : Increased risk of hemolytic anemia.
References :

  1. Gait JE: Hemolytic reactions to nidivofurantoin in patients with glucose-6-phosphate dehydrogenase deficiency: theory and practice. DICP. 1990 Dec;24(12):1210-3. [PubMed:2089833 ]
  2. Furadantin® (nidivofurantoin) Oral Suspension[package insert]. Florham Park, New Jersey: Shionogi Inc. 2013. [Link]

PMID: 23262279

Nitrofurantoin

By

Nitrofurantoin

Product: Losartan D4

Identifier : DBSNPE002526
Drug : DB00698 (Nidivofurantoin)
Interacting Gene/Enzyme : Glucose-6-phosphate 1-dehydrogenase
Gene Name : G6PD
UniProt ID : P11413
Defining Change(s) :

  • 1361G->A

Allele Name : Andalus
Genotype(s) : Not Available
Type(s) : ADR Inferred
Groups : G6PD deficiency
Description : Increased risk of hemolytic anemia.
References :

  1. Gait JE: Hemolytic reactions to nidivofurantoin in patients with glucose-6-phosphate dehydrogenase deficiency: theory and practice. DICP. 1990 Dec;24(12):1210-3. [PubMed:2089833 ]
  2. Furadantin® (nidivofurantoin) Oral Suspension[package insert]. Florham Park, New Jersey: Shionogi Inc. 2013. [Link]

PMID: 16102838

Nitrofurantoin

By

Nitrofurantoin

Product: Rosuvastatin (D3 Sodium)

Identifier : DBSNPE002527
Drug : DB00698 (Nidivofurantoin)
Interacting Gene/Enzyme : Glucose-6-phosphate 1-dehydrogenase
Gene Name : G6PD
UniProt ID : P11413
Defining Change(s) :

  • 1376G->C

Allele Name : Cosenza
Genotype(s) : Not Available
Type(s) : ADR Inferred
Groups : G6PD deficiency
Description : Increased risk of hemolytic anemia.
References :

  1. Gait JE: Hemolytic reactions to nidivofurantoin in patients with glucose-6-phosphate dehydrogenase deficiency: theory and practice. DICP. 1990 Dec;24(12):1210-3. [PubMed:2089833 ]
  2. Furadantin® (nidivofurantoin) Oral Suspension[package insert]. Florham Park, New Jersey: Shionogi Inc. 2013. [Link]

PMID: 16934253

Nitrofurantoin

By

Nitrofurantoin

Product: Naloxone D5

Identifier : DBSNPE002528
Drug : DB00698 (Nidivofurantoin)
Interacting Gene/Enzyme : Glucose-6-phosphate 1-dehydrogenase
Gene Name : G6PD
UniProt ID : P11413
Defining Change(s) :

  • 1376G->T

Allele Name : Canton, Taiwan- Hakka, Gifu-like, Agrigento-like
Genotype(s) : Not Available
Type(s) : ADR Inferred
Groups : G6PD deficiency
Description : Increased risk of hemolytic anemia.
References :

  1. Gait JE: Hemolytic reactions to nidivofurantoin in patients with glucose-6-phosphate dehydrogenase deficiency: theory and practice. DICP. 1990 Dec;24(12):1210-3. [PubMed:2089833 ]
  2. Furadantin® (nidivofurantoin) Oral Suspension[package insert]. Florham Park, New Jersey: Shionogi Inc. 2013. [Link]

PMID: 9624145

Nitrofurantoin

By

Nitrofurantoin

Product: Ezetimibe D4

Identifier : DBSNPE002529
Drug : DB00698 (Nidivofurantoin)
Interacting Gene/Enzyme : Glucose-6-phosphate 1-dehydrogenase
Gene Name : G6PD
UniProt ID : P11413
Defining Change(s) :

  • 1387C->A

Allele Name : Flores
Genotype(s) : Not Available
Type(s) : ADR Inferred
Groups : G6PD deficiency
Description : Increased risk of hemolytic anemia.
References :

  1. Gait JE: Hemolytic reactions to nidivofurantoin in patients with glucose-6-phosphate dehydrogenase deficiency: theory and practice. DICP. 1990 Dec;24(12):1210-3. [PubMed:2089833 ]
  2. Furadantin® (nidivofurantoin) Oral Suspension[package insert]. Florham Park, New Jersey: Shionogi Inc. 2013. [Link]

PMID: 22974473

Nitrofurantoin

By

Nitrofurantoin

Product: Cetirizine (D8 dihydrochloride)

Identifier : DBSNPE002530
Drug : DB00698 (Nidivofurantoin)
Interacting Gene/Enzyme : Glucose-6-phosphate 1-dehydrogenase
Gene Name : G6PD
UniProt ID : P11413
Defining Change(s) :

  • 1388G->A

Allele Name : Kaiping, Anant, Dhon, Sapporo-like, Wosera
Genotype(s) : Not Available
Type(s) : ADR Inferred
Groups : G6PD deficiency
Description : Increased risk of hemolytic anemia.
References :

  1. Gait JE: Hemolytic reactions to nidivofurantoin in patients with glucose-6-phosphate dehydrogenase deficiency: theory and practice. DICP. 1990 Dec;24(12):1210-3. [PubMed:2089833 ]
  2. Furadantin® (nidivofurantoin) Oral Suspension[package insert]. Florham Park, New Jersey: Shionogi Inc. 2013. [Link]

PMID: 20958291

Nitrofurantoin

By

Nitrofurantoin

Product: Cetirizine (D4 dihydrochloride)

Identifier : DBSNPE002531
Drug : DB00698 (Nidivofurantoin)
Interacting Gene/Enzyme : Glucose-6-phosphate 1-dehydrogenase
Gene Name : G6PD
UniProt ID : P11413
Defining Change(s) :

  • 169C->T

Allele Name : Kamogawa
Genotype(s) : Not Available
Type(s) : ADR Inferred
Groups : G6PD deficiency
Description : Increased risk of hemolytic anemia.
References :

  1. Gait JE: Hemolytic reactions to nidivofurantoin in patients with glucose-6-phosphate dehydrogenase deficiency: theory and practice. DICP. 1990 Dec;24(12):1210-3. [PubMed:2089833 ]
  2. Furadantin® (nidivofurantoin) Oral Suspension[package insert]. Florham Park, New Jersey: Shionogi Inc. 2013. [Link]

PMID: 21950657

Nitrofurantoin

By

Nitrofurantoin

Product: Olmesartan D4

Identifier : DBSNPE002532
Drug : DB00698 (Nidivofurantoin)
Interacting Gene/Enzyme : Glucose-6-phosphate 1-dehydrogenase
Gene Name : G6PD
UniProt ID : P11413
Defining Change(s) :

  • 179T>C

Allele Name : Costanzo
Genotype(s) : Not Available
Type(s) : ADR Inferred
Groups : G6PD deficiency
Description : Increased risk of hemolytic anemia.
References :

  1. Gait JE: Hemolytic reactions to nidivofurantoin in patients with glucose-6-phosphate dehydrogenase deficiency: theory and practice. DICP. 1990 Dec;24(12):1210-3. [PubMed:2089833 ]
  2. Furadantin® (nidivofurantoin) Oral Suspension[package insert]. Florham Park, New Jersey: Shionogi Inc. 2013. [Link]

PMID: 23798572

Nitrofurantoin

By

Nitrofurantoin

Product: Etoricoxib D4

Identifier : DBSNPE002533
Drug : DB00698 (Nidivofurantoin)
Interacting Gene/Enzyme : Glucose-6-phosphate 1-dehydrogenase
Gene Name : G6PD
UniProt ID : P11413
Defining Change(s) :

  • 185C->A

Allele Name : Amazonia
Genotype(s) : Not Available
Type(s) : ADR Inferred
Groups : G6PD deficiency
Description : Increased risk of hemolytic anemia.
References :

  1. Gait JE: Hemolytic reactions to nidivofurantoin in patients with glucose-6-phosphate dehydrogenase deficiency: theory and practice. DICP. 1990 Dec;24(12):1210-3. [PubMed:2089833 ]
  2. Furadantin® (nidivofurantoin) Oral Suspension[package insert]. Florham Park, New Jersey: Shionogi Inc. 2013. [Link]

PMID: 20804735

Nitrofurantoin

By

Nitrofurantoin

Product: GDC-0068 (dihydrochloride)

Identifier : DBSNPE002534
Drug : DB00698 (Nidivofurantoin)
Interacting Gene/Enzyme : Glucose-6-phosphate 1-dehydrogenase
Gene Name : G6PD
UniProt ID : P11413
Defining Change(s) :

  • 196T->A

Allele Name : Songklanagarind
Genotype(s) : Not Available
Type(s) : ADR Inferred
Groups : G6PD deficiency
Description : Increased risk of hemolytic anemia.
References :

  1. Gait JE: Hemolytic reactions to nidivofurantoin in patients with glucose-6-phosphate dehydrogenase deficiency: theory and practice. DICP. 1990 Dec;24(12):1210-3. [PubMed:2089833 ]
  2. Furadantin® (nidivofurantoin) Oral Suspension[package insert]. Florham Park, New Jersey: Shionogi Inc. 2013. [Link]

PMID: 18724386

Nitrofurantoin

By

Nitrofurantoin

Product: Fluvastatin (D6 sodium)

Identifier : DBSNPE002536
Drug : DB00698 (Nidivofurantoin)
Interacting Gene/Enzyme : Glucose-6-phosphate 1-dehydrogenase
Gene Name : G6PD
UniProt ID : P11413
Defining Change(s) :

  • 208T->C

Allele Name : Namouru
Genotype(s) : Not Available
Type(s) : ADR Inferred
Groups : G6PD deficiency
Description : Increased risk of hemolytic anemia.
References :

  1. Gait JE: Hemolytic reactions to nidivofurantoin in patients with glucose-6-phosphate dehydrogenase deficiency: theory and practice. DICP. 1990 Dec;24(12):1210-3. [PubMed:2089833 ]
  2. Furadantin® (nidivofurantoin) Oral Suspension[package insert]. Florham Park, New Jersey: Shionogi Inc. 2013. [Link]

PMID: 16517404

Nitrofurantoin

By

Nitrofurantoin

Product: Ziprasidone D8

Identifier : DBSNPE002537
Drug : DB00698 (Nidivofurantoin)
Interacting Gene/Enzyme : Glucose-6-phosphate 1-dehydrogenase
Gene Name : G6PD
UniProt ID : P11413
Defining Change(s) :

  • 352T>C

Allele Name : Bao Loc
Genotype(s) : Not Available
Type(s) : ADR Inferred
Groups : G6PD deficiency
Description : Increased risk of hemolytic anemia.
References :

  1. Gait JE: Hemolytic reactions to nidivofurantoin in patients with glucose-6-phosphate dehydrogenase deficiency: theory and practice. DICP. 1990 Dec;24(12):1210-3. [PubMed:2089833 ]
  2. Furadantin® (nidivofurantoin) Oral Suspension[package insert]. Florham Park, New Jersey: Shionogi Inc. 2013. [Link]

PMID: 22560076

Nitrofurantoin

By

Nitrofurantoin

Product: Haloperidol D4

Identifier : DBSNPE002538
Drug : DB00698 (Nidivofurantoin)
Interacting Gene/Enzyme : Glucose-6-phosphate 1-dehydrogenase
Gene Name : G6PD
UniProt ID : P11413
Defining Change(s) :

  • 375G->T, 379G->T383T->C384C>T

Allele Name : Crispim
Genotype(s) : Not Available
Type(s) : ADR Inferred
Groups : G6PD deficiency
Description : Increased risk of hemolytic anemia.
References :

  1. Gait JE: Hemolytic reactions to nidivofurantoin in patients with glucose-6-phosphate dehydrogenase deficiency: theory and practice. DICP. 1990 Dec;24(12):1210-3. [PubMed:2089833 ]
  2. Furadantin® (nidivofurantoin) Oral Suspension[package insert]. Florham Park, New Jersey: Shionogi Inc. 2013. [Link]

PMID: 16632257

Nitrofurantoin

By

Nitrofurantoin

Product: Febuxostat D9

Identifier : DBSNPE002539
Drug : DB00698 (Nidivofurantoin)
Interacting Gene/Enzyme : Glucose-6-phosphate 1-dehydrogenase
Gene Name : G6PD
UniProt ID : P11413
Defining Change(s) :

  • 376A->G
  • 463C->G

Allele Name : Acrokorinthos
Genotype(s) : Not Available
Type(s) : ADR Inferred
Groups : G6PD deficiency
Description : Increased risk of hemolytic anemia.
References :

  1. Gait JE: Hemolytic reactions to nidivofurantoin in patients with glucose-6-phosphate dehydrogenase deficiency: theory and practice. DICP. 1990 Dec;24(12):1210-3. [PubMed:2089833 ]
  2. Furadantin® (nidivofurantoin) Oral Suspension[package insert]. Florham Park, New Jersey: Shionogi Inc. 2013. [Link]

PMID: 17493865

Nitrofurantoin

By

Nitrofurantoin

Product: CNV1014802 (hydrochloride)

Identifier : DBSNPE002540
Drug : DB00698 (Nidivofurantoin)
Interacting Gene/Enzyme : Glucose-6-phosphate 1-dehydrogenase
Gene Name : G6PD
UniProt ID : P11413
Defining Change(s) :

  • 376A->G
  • 542A->T

Allele Name : Santa Maria
Genotype(s) : Not Available
Type(s) : ADR Inferred
Groups : G6PD deficiency
Description : Increased risk of hemolytic anemia.
References :

  1. Gait JE: Hemolytic reactions to nidivofurantoin in patients with glucose-6-phosphate dehydrogenase deficiency: theory and practice. DICP. 1990 Dec;24(12):1210-3. [PubMed:2089833 ]
  2. Furadantin® (nidivofurantoin) Oral Suspension[package insert]. Florham Park, New Jersey: Shionogi Inc. 2013. [Link]

PMID: 17460038

Nitrofurantoin

By

Nitrofurantoin

Product: CNV1014802

Identifier : DBSNPE002541
Drug : DB00698 (Nidivofurantoin)
Interacting Gene/Enzyme : Glucose-6-phosphate 1-dehydrogenase
Gene Name : G6PD
UniProt ID : P11413
Defining Change(s) :

  • 376A->G
  • 871G->A

Allele Name : Ananindeua
Genotype(s) : Not Available
Type(s) : ADR Inferred
Groups : G6PD deficiency
Description : Increased risk of hemolytic anemia.
References :

  1. Gait JE: Hemolytic reactions to nidivofurantoin in patients with glucose-6-phosphate dehydrogenase deficiency: theory and practice. DICP. 1990 Dec;24(12):1210-3. [PubMed:2089833 ]
  2. Furadantin® (nidivofurantoin) Oral Suspension[package insert]. Florham Park, New Jersey: Shionogi Inc. 2013. [Link]

PMID: 27435629

Nitrofurantoin

By

Nitrofurantoin

Product: Indoramin D5

Identifier : DBSNPE002542
Drug : DB00698 (Nidivofurantoin)
Interacting Gene/Enzyme : Glucose-6-phosphate 1-dehydrogenase
Gene Name : G6PD
UniProt ID : P11413
Defining Change(s) :

  • 383T->C

Allele Name : Vanua Lava
Genotype(s) : Not Available
Type(s) : ADR Inferred
Groups : G6PD deficiency
Description : Increased risk of hemolytic anemia.
References :

  1. Gait JE: Hemolytic reactions to nidivofurantoin in patients with glucose-6-phosphate dehydrogenase deficiency: theory and practice. DICP. 1990 Dec;24(12):1210-3. [PubMed:2089833 ]
  2. Furadantin® (nidivofurantoin) Oral Suspension[package insert]. Florham Park, New Jersey: Shionogi Inc. 2013. [Link]

PMID: 15611092

Nitrofurantoin

By

Nitrofurantoin

Product: Debutyldronedarone D7

Identifier : DBSNPE002543
Drug : DB00698 (Nidivofurantoin)
Interacting Gene/Enzyme : Glucose-6-phosphate 1-dehydrogenase
Gene Name : G6PD
UniProt ID : P11413
Defining Change(s) :

  • 406C->T

Allele Name : Valladolid
Genotype(s) : Not Available
Type(s) : ADR Inferred
Groups : G6PD deficiency
Description : Increased risk of hemolytic anemia.
References :

  1. Gait JE: Hemolytic reactions to nidivofurantoin in patients with glucose-6-phosphate dehydrogenase deficiency: theory and practice. DICP. 1990 Dec;24(12):1210-3. [PubMed:2089833 ]
  2. Furadantin® (nidivofurantoin) Oral Suspension[package insert]. Florham Park, New Jersey: Shionogi Inc. 2013. [Link]

PMID: 9863642

Nitrofurantoin

By

Nitrofurantoin

Product: Alimemazine D6

Identifier : DBSNPE002544
Drug : DB00698 (Nidivofurantoin)
Interacting Gene/Enzyme : Glucose-6-phosphate 1-dehydrogenase
Gene Name : G6PD
UniProt ID : P11413
Defining Change(s) :

  • 409C->T

Allele Name : Belem
Genotype(s) : Not Available
Type(s) : ADR Inferred
Groups : G6PD deficiency
Description : Increased risk of hemolytic anemia.
References :

  1. Gait JE: Hemolytic reactions to nidivofurantoin in patients with glucose-6-phosphate dehydrogenase deficiency: theory and practice. DICP. 1990 Dec;24(12):1210-3. [PubMed:2089833 ]
  2. Furadantin® (nidivofurantoin) Oral Suspension[package insert]. Florham Park, New Jersey: Shionogi Inc. 2013. [Link]

PMID: 20032260

Nitrofurantoin

By

Nitrofurantoin

Product: Trimethobenzamide D6

Identifier : DBSNPE002545
Drug : DB00698 (Nidivofurantoin)
Interacting Gene/Enzyme : Glucose-6-phosphate 1-dehydrogenase
Gene Name : G6PD
UniProt ID : P11413
Defining Change(s) :

  • 442G->A

Allele Name : Liuzhou
Genotype(s) : Not Available
Type(s) : ADR Inferred
Groups : G6PD deficiency
Description : Increased risk of hemolytic anemia.
References :

  1. Gait JE: Hemolytic reactions to nidivofurantoin in patients with glucose-6-phosphate dehydrogenase deficiency: theory and practice. DICP. 1990 Dec;24(12):1210-3. [PubMed:2089833 ]
  2. Furadantin® (nidivofurantoin) Oral Suspension[package insert]. Florham Park, New Jersey: Shionogi Inc. 2013. [Link]

PMID: 20036129

Nitrofurantoin

By

Nitrofurantoin

Product: Midodrine (D6 hydrochloride)

Identifier : DBSNPE002546
Drug : DB00698 (Nidivofurantoin)
Interacting Gene/Enzyme : Glucose-6-phosphate 1-dehydrogenase
Gene Name : G6PD
UniProt ID : P11413
Defining Change(s) :

  • 473G>A

Allele Name : Shenzen
Genotype(s) : Not Available
Type(s) : ADR Inferred
Groups : G6PD deficiency
Description : Increased risk of hemolytic anemia.
References :

  1. Gait JE: Hemolytic reactions to nidivofurantoin in patients with glucose-6-phosphate dehydrogenase deficiency: theory and practice. DICP. 1990 Dec;24(12):1210-3. [PubMed:2089833 ]
  2. Furadantin® (nidivofurantoin) Oral Suspension[package insert]. Florham Park, New Jersey: Shionogi Inc. 2013. [Link]

PMID: 9489619

Nitrofurantoin

By

Nitrofurantoin

Product: Aliskiren (D6 Hydrochloride)

Identifier : DBSNPE002547
Drug : DB00698 (Nidivofurantoin)
Interacting Gene/Enzyme : Glucose-6-phosphate 1-dehydrogenase
Gene Name : G6PD
UniProt ID : P11413
Defining Change(s) :

  • 493A->G

Allele Name : Taipei “Chinese- 3”
Genotype(s) : Not Available
Type(s) : ADR Inferred
Groups : G6PD deficiency
Description : Increased risk of hemolytic anemia.
References :

  1. Gait JE: Hemolytic reactions to nidivofurantoin in patients with glucose-6-phosphate dehydrogenase deficiency: theory and practice. DICP. 1990 Dec;24(12):1210-3. [PubMed:2089833 ]
  2. Furadantin® (nidivofurantoin) Oral Suspension[package insert]. Florham Park, New Jersey: Shionogi Inc. 2013. [Link]

PMID: 8894183

Nitrofurantoin

By

Nitrofurantoin

Product: Dabigatran (D4 hydrochloride)

Identifier : DBSNPE002548
Drug : DB00698 (Nidivofurantoin)
Interacting Gene/Enzyme : Glucose-6-phosphate 1-dehydrogenase
Gene Name : G6PD
UniProt ID : P11413
Defining Change(s) :

  • 496C>T

Allele Name : Toledo
Genotype(s) : Not Available
Type(s) : ADR Inferred
Groups : G6PD deficiency
Description : Increased risk of hemolytic anemia.
References :

  1. Gait JE: Hemolytic reactions to nidivofurantoin in patients with glucose-6-phosphate dehydrogenase deficiency: theory and practice. DICP. 1990 Dec;24(12):1210-3. [PubMed:2089833 ]
  2. Furadantin® (nidivofurantoin) Oral Suspension[package insert]. Florham Park, New Jersey: Shionogi Inc. 2013. [Link]

PMID: 8596640

Nitrofurantoin

By

Nitrofurantoin

Product: Isosteviol

Identifier : DBSNPE002549
Drug : DB00698 (Nidivofurantoin)
Interacting Gene/Enzyme : Glucose-6-phosphate 1-dehydrogenase
Gene Name : G6PD
UniProt ID : P11413
Defining Change(s) :

  • 497G->A

Allele Name : Naone
Genotype(s) : Not Available
Type(s) : ADR Inferred
Groups : G6PD deficiency
Description : Increased risk of hemolytic anemia.
References :

  1. Gait JE: Hemolytic reactions to nidivofurantoin in patients with glucose-6-phosphate dehydrogenase deficiency: theory and practice. DICP. 1990 Dec;24(12):1210-3. [PubMed:2089833 ]
  2. Furadantin® (nidivofurantoin) Oral Suspension[package insert]. Florham Park, New Jersey: Shionogi Inc. 2013. [Link]

PMID: 7544433

Nitrofurantoin

By

Nitrofurantoin

Product: Schisandrol B

Identifier : DBSNPE002550
Drug : DB00698 (Nidivofurantoin)
Interacting Gene/Enzyme : Glucose-6-phosphate 1-dehydrogenase
Gene Name : G6PD
UniProt ID : P11413
Defining Change(s) :

  • 517T->C

Allele Name : Nankang
Genotype(s) : Not Available
Type(s) : ADR Inferred
Groups : G6PD deficiency
Description : Increased risk of hemolytic anemia.
References :

  1. Gait JE: Hemolytic reactions to nidivofurantoin in patients with glucose-6-phosphate dehydrogenase deficiency: theory and practice. DICP. 1990 Dec;24(12):1210-3. [PubMed:2089833 ]
  2. Furadantin® (nidivofurantoin) Oral Suspension[package insert]. Florham Park, New Jersey: Shionogi Inc. 2013. [Link]

PMID: 25517916

Nitrofurantoin

By

Nitrofurantoin

Product: Schisandrin

Identifier : DBSNPE002551
Drug : DB00698 (Nidivofurantoin)
Interacting Gene/Enzyme : Glucose-6-phosphate 1-dehydrogenase
Gene Name : G6PD
UniProt ID : P11413
Defining Change(s) :

  • 519C->G

Allele Name : Miaoli
Genotype(s) : Not Available
Type(s) : ADR Inferred
Groups : G6PD deficiency
Description : Increased risk of hemolytic anemia.
References :

  1. Gait JE: Hemolytic reactions to nidivofurantoin in patients with glucose-6-phosphate dehydrogenase deficiency: theory and practice. DICP. 1990 Dec;24(12):1210-3. [PubMed:2089833 ]
  2. Furadantin® (nidivofurantoin) Oral Suspension[package insert]. Florham Park, New Jersey: Shionogi Inc. 2013. [Link]

PMID: 25855188

Nitrofurantoin

By

Nitrofurantoin

Product: Schisandrin C

Identifier : DBSNPE002552
Drug : DB00698 (Nidivofurantoin)
Interacting Gene/Enzyme : Glucose-6-phosphate 1-dehydrogenase
Gene Name : G6PD
UniProt ID : P11413
Defining Change(s) :

  • 563C->T

Allele Name : Mediterranean, Dallas, Panama‚ Sassari, Cagliari, Birmingham
Genotype(s) : Not Available
Type(s) : ADR Inferred
Groups : G6PD deficiency
Description : Increased risk of hemolytic anemia.
References :

  1. Gait JE: Hemolytic reactions to nidivofurantoin in patients with glucose-6-phosphate dehydrogenase deficiency: theory and practice. DICP. 1990 Dec;24(12):1210-3. [PubMed:2089833 ]
  2. Furadantin® (nidivofurantoin) Oral Suspension[package insert]. Florham Park, New Jersey: Shionogi Inc. 2013. [Link]

PMID: 26359240

Nitrofurantoin

By

Nitrofurantoin

Product: Icaritin

Identifier : DBSNPE002553
Drug : DB00698 (Nidivofurantoin)
Interacting Gene/Enzyme : Glucose-6-phosphate 1-dehydrogenase
Gene Name : G6PD
UniProt ID : P11413
Defining Change(s) :

  • 592C->T

Allele Name : Coimbra Shunde
Genotype(s) : Not Available
Type(s) : ADR Inferred
Groups : G6PD deficiency
Description : Increased risk of hemolytic anemia.
References :

  1. Gait JE: Hemolytic reactions to nidivofurantoin in patients with glucose-6-phosphate dehydrogenase deficiency: theory and practice. DICP. 1990 Dec;24(12):1210-3. [PubMed:2089833 ]
  2. Furadantin® (nidivofurantoin) Oral Suspension[package insert]. Florham Park, New Jersey: Shionogi Inc. 2013. [Link]

PMID: 24259501

Nitrofurantoin

By

Nitrofurantoin

Product: Cimifugin

Identifier : DBSNPE002554
Drug : DB00698 (Nidivofurantoin)
Interacting Gene/Enzyme : Glucose-6-phosphate 1-dehydrogenase
Gene Name : G6PD
UniProt ID : P11413
Defining Change(s) :

  • 593G>A

Allele Name : Nilgiri
Genotype(s) : Not Available
Type(s) : ADR Inferred
Groups : G6PD deficiency
Description : Increased risk of hemolytic anemia.
References :

  1. Gait JE: Hemolytic reactions to nidivofurantoin in patients with glucose-6-phosphate dehydrogenase deficiency: theory and practice. DICP. 1990 Dec;24(12):1210-3. [PubMed:2089833 ]
  2. Furadantin® (nidivofurantoin) Oral Suspension[package insert]. Florham Park, New Jersey: Shionogi Inc. 2013. [Link]

PMID: 23829275

Nitrofurantoin

By

Nitrofurantoin

Product: Maslinic acid

Identifier : DBSNPE002555
Drug : DB00698 (Nidivofurantoin)
Interacting Gene/Enzyme : Glucose-6-phosphate 1-dehydrogenase
Gene Name : G6PD
UniProt ID : P11413
Defining Change(s) :

  • 679C->T

Allele Name : Radlowo
Genotype(s) : Not Available
Type(s) : ADR Inferred
Groups : G6PD deficiency
Description : Increased risk of hemolytic anemia.
References :

  1. Gait JE: Hemolytic reactions to nidivofurantoin in patients with glucose-6-phosphate dehydrogenase deficiency: theory and practice. DICP. 1990 Dec;24(12):1210-3. [PubMed:2089833 ]
  2. Furadantin® (nidivofurantoin) Oral Suspension[package insert]. Florham Park, New Jersey: Shionogi Inc. 2013. [Link]

PMID: 21856817

Nitrofurantoin

By

Nitrofurantoin

Product: Corynoxeine

Identifier : DBSNPE002556
Drug : DB00698 (Nidivofurantoin)
Interacting Gene/Enzyme : Glucose-6-phosphate 1-dehydrogenase
Gene Name : G6PD
UniProt ID : P11413
Defining Change(s) :

  • 811G>C

Allele Name : Roubaix
Genotype(s) : Not Available
Type(s) : ADR Inferred
Groups : G6PD deficiency
Description : Increased risk of hemolytic anemia.
References :

  1. Gait JE: Hemolytic reactions to nidivofurantoin in patients with glucose-6-phosphate dehydrogenase deficiency: theory and practice. DICP. 1990 Dec;24(12):1210-3. [PubMed:2089833 ]
  2. Furadantin® (nidivofurantoin) Oral Suspension[package insert]. Florham Park, New Jersey: Shionogi Inc. 2013. [Link]

PMID: 21663688

Nitrofurantoin

By

Nitrofurantoin

Product: Ginsenoside Rb1

Identifier : DBSNPE002557
Drug : DB00698 (Nidivofurantoin)
Interacting Gene/Enzyme : Glucose-6-phosphate 1-dehydrogenase
Gene Name : G6PD
UniProt ID : P11413
Defining Change(s) :

  • 835A->G

Allele Name : Haikou
Genotype(s) : Not Available
Type(s) : ADR Inferred
Groups : G6PD deficiency
Description : Increased risk of hemolytic anemia.
References :

  1. Gait JE: Hemolytic reactions to nidivofurantoin in patients with glucose-6-phosphate dehydrogenase deficiency: theory and practice. DICP. 1990 Dec;24(12):1210-3. [PubMed:2089833 ]
  2. Furadantin® (nidivofurantoin) Oral Suspension[package insert]. Florham Park, New Jersey: Shionogi Inc. 2013. [Link]

PMID: 22073284

Nitrofurantoin

By

Nitrofurantoin

Product: Cefpiramide (sodium)

Identifier : DBSNPE002558
Drug : DB00698 (Nidivofurantoin)
Interacting Gene/Enzyme : Glucose-6-phosphate 1-dehydrogenase
Gene Name : G6PD
UniProt ID : P11413
Defining Change(s) :

  • 835A->T

Allele Name : Chinese-1
Genotype(s) : Not Available
Type(s) : ADR Inferred
Groups : G6PD deficiency
Description : Increased risk of hemolytic anemia.
References :

  1. Gait JE: Hemolytic reactions to nidivofurantoin in patients with glucose-6-phosphate dehydrogenase deficiency: theory and practice. DICP. 1990 Dec;24(12):1210-3. [PubMed:2089833 ]
  2. Furadantin® (nidivofurantoin) Oral Suspension[package insert]. Florham Park, New Jersey: Shionogi Inc. 2013. [Link]

PMID: 20890419

Nitrofurantoin

By

Nitrofurantoin

Product: Chitinase-IN-2 (hydrochloride)

Identifier : DBSNPE002559
Drug : DB00698 (Nidivofurantoin)
Interacting Gene/Enzyme : Glucose-6-phosphate 1-dehydrogenase
Gene Name : G6PD
UniProt ID : P11413
Defining Change(s) :

  • 848A>G

Allele Name : Mizushima
Genotype(s) : Not Available
Type(s) : ADR Inferred
Groups : G6PD deficiency
Description : Increased risk of hemolytic anemia.
References :

  1. Gait JE: Hemolytic reactions to nidivofurantoin in patients with glucose-6-phosphate dehydrogenase deficiency: theory and practice. DICP. 1990 Dec;24(12):1210-3. [PubMed:2089833 ]
  2. Furadantin® (nidivofurantoin) Oral Suspension[package insert]. Florham Park, New Jersey: Shionogi Inc. 2013. [Link]

PMID: 19465519

Nitrofurantoin

By

Nitrofurantoin

Product: Purvalanol A

Identifier : DBSNPE002560
Drug : DB00698 (Nidivofurantoin)
Interacting Gene/Enzyme : Glucose-6-phosphate 1-dehydrogenase
Gene Name : G6PD
UniProt ID : P11413
Defining Change(s) :

  • 853C->T

Allele Name : Osaka
Genotype(s) : Not Available
Type(s) : ADR Inferred
Groups : G6PD deficiency
Description : Increased risk of hemolytic anemia.
References :

  1. Gait JE: Hemolytic reactions to nidivofurantoin in patients with glucose-6-phosphate dehydrogenase deficiency: theory and practice. DICP. 1990 Dec;24(12):1210-3. [PubMed:2089833 ]
  2. Furadantin® (nidivofurantoin) Oral Suspension[package insert]. Florham Park, New Jersey: Shionogi Inc. 2013. [Link]

PMID: 19466990

Nitrofurantoin

By

Nitrofurantoin

Product: Rafoxanide

Identifier : DBSNPE002561
Drug : DB00698 (Nidivofurantoin)
Interacting Gene/Enzyme : Glucose-6-phosphate 1-dehydrogenase
Gene Name : G6PD
UniProt ID : P11413
Defining Change(s) :

  • 871G->A

Allele Name : Viangchan, Jammu
Genotype(s) : Not Available
Type(s) : ADR Inferred
Groups : G6PD deficiency
Description : Increased risk of hemolytic anemia.
References :

  1. Gait JE: Hemolytic reactions to nidivofurantoin in patients with glucose-6-phosphate dehydrogenase deficiency: theory and practice. DICP. 1990 Dec;24(12):1210-3. [PubMed:2089833 ]
  2. Furadantin® (nidivofurantoin) Oral Suspension[package insert]. Florham Park, New Jersey: Shionogi Inc. 2013. [Link]

PMID: 16962569

Nitrofurantoin

By

Nitrofurantoin

Product: Febantel

Identifier : DBSNPE002562
Drug : DB00698 (Nidivofurantoin)
Interacting Gene/Enzyme : Glucose-6-phosphate 1-dehydrogenase
Gene Name : G6PD
UniProt ID : P11413
Defining Change(s) :

  • 916G->A

Allele Name : Seoul
Genotype(s) : Not Available
Type(s) : ADR Inferred
Groups : G6PD deficiency
Description : Increased risk of hemolytic anemia.
References :

  1. Gait JE: Hemolytic reactions to nidivofurantoin in patients with glucose-6-phosphate dehydrogenase deficiency: theory and practice. DICP. 1990 Dec;24(12):1210-3. [PubMed:2089833 ]
  2. Furadantin® (nidivofurantoin) Oral Suspension[package insert]. Florham Park, New Jersey: Shionogi Inc. 2013. [Link]

PMID: 17307993

Nitrofurantoin

By

Nitrofurantoin

Product: Closantel

Identifier : DBSNPE002563
Drug : DB00698 (Nidivofurantoin)
Interacting Gene/Enzyme : Glucose-6-phosphate 1-dehydrogenase
Gene Name : G6PD
UniProt ID : P11413
Defining Change(s) :

  • 929G->A

Allele Name : Ludhiana
Genotype(s) : Not Available
Type(s) : ADR Inferred
Groups : G6PD deficiency
Description : Increased risk of hemolytic anemia.
References :

  1. Gait JE: Hemolytic reactions to nidivofurantoin in patients with glucose-6-phosphate dehydrogenase deficiency: theory and practice. DICP. 1990 Dec;24(12):1210-3. [PubMed:2089833 ]
  2. Furadantin® (nidivofurantoin) Oral Suspension[package insert]. Florham Park, New Jersey: Shionogi Inc. 2013. [Link]

PMID: 16556879

Nitrofurantoin

By

Nitrofurantoin

Product: Bithionol (sulfoxide)

Identifier : DBSNPE002564
Drug : DB00698 (Nidivofurantoin)
Interacting Gene/Enzyme : Glucose-6-phosphate 1-dehydrogenase
Gene Name : G6PD
UniProt ID : P11413
Defining Change(s) :

  • 977C->A

Allele Name : Farroupilha
Genotype(s) : Not Available
Type(s) : ADR Inferred
Groups : G6PD deficiency
Description : Increased risk of hemolytic anemia.
References :

  1. Gait JE: Hemolytic reactions to nidivofurantoin in patients with glucose-6-phosphate dehydrogenase deficiency: theory and practice. DICP. 1990 Dec;24(12):1210-3. [PubMed:2089833 ]
  2. Furadantin® (nidivofurantoin) Oral Suspension[package insert]. Florham Park, New Jersey: Shionogi Inc. 2013. [Link]

PMID: 16391520

Nitrofurantoin

By

Nitrofurantoin

Product: AI-10-49

Identifier : DBSNPE002565
Drug : DB00698 (Nidivofurantoin)
Interacting Gene/Enzyme : Glucose-6-phosphate 1-dehydrogenase
Gene Name : G6PD
UniProt ID : P11413
Defining Change(s) :

  • 1024C->T

Allele Name : Chinese-5
Genotype(s) : Not Available
Type(s) : ADR Inferred
Groups : G6PD deficiency
Description : Increased risk of hemolytic anemia.
References :

  1. Gait JE: Hemolytic reactions to nidivofurantoin in patients with glucose-6-phosphate dehydrogenase deficiency: theory and practice. DICP. 1990 Dec;24(12):1210-3. [PubMed:2089833 ]
  2. Furadantin® (nidivofurantoin) Oral Suspension[package insert]. Florham Park, New Jersey: Shionogi Inc. 2013. [Link]

PMID: 10683200

Nitrofurantoin

By

Nitrofurantoin

Product: Lazabemide

Identifier : DBSNPE002566
Drug : DB00698 (Nidivofurantoin)
Interacting Gene/Enzyme : Glucose-6-phosphate 1-dehydrogenase
Gene Name : G6PD
UniProt ID : P11413
Defining Change(s) :

  • 130G>A

Allele Name : Rignano
Genotype(s) : Not Available
Type(s) : ADR Inferred
Groups : G6PD deficiency
Description : Increased risk of hemolytic anemia.
References :

  1. Gait JE: Hemolytic reactions to nidivofurantoin in patients with glucose-6-phosphate dehydrogenase deficiency: theory and practice. DICP. 1990 Dec;24(12):1210-3. [PubMed:2089833 ]
  2. Furadantin® (nidivofurantoin) Oral Suspension[package insert]. Florham Park, New Jersey: Shionogi Inc. 2013. [Link]

PMID: 10688876

Nitrofurantoin

By

Nitrofurantoin

Product: AZD3965

Identifier : DBSNPE002568
Drug : DB00698 (Nidivofurantoin)
Interacting Gene/Enzyme : Glucose-6-phosphate 1-dehydrogenase
Gene Name : G6PD
UniProt ID : P11413
Defining Change(s) :

  • 1380G>C

Allele Name : G6PDNice
Genotype(s) : Not Available
Type(s) : ADR Inferred
Groups : G6PD deficiency
Description : Increased risk of hemolytic anemia.
References :

  1. Gait JE: Hemolytic reactions to nidivofurantoin in patients with glucose-6-phosphate dehydrogenase deficiency: theory and practice. DICP. 1990 Dec;24(12):1210-3. [PubMed:2089833 ]
  2. Furadantin® (nidivofurantoin) Oral Suspension[package insert]. Florham Park, New Jersey: Shionogi Inc. 2013. [Link]

PMID: 9878048

Nitrofurantoin

By

Nitrofurantoin

Product: Epoxomicin

Identifier : DBSNPE002569
Drug : DB00698 (Nidivofurantoin)
Interacting Gene/Enzyme : Glucose-6-phosphate 1-dehydrogenase
Gene Name : G6PD
UniProt ID : P11413
Defining Change(s) :

  • 1387C->T

Allele Name : Kamiube, Keelung
Genotype(s) : Not Available
Type(s) : ADR Inferred
Groups : G6PD deficiency
Description : Increased risk of hemolytic anemia.
References :

  1. Gait JE: Hemolytic reactions to nidivofurantoin in patients with glucose-6-phosphate dehydrogenase deficiency: theory and practice. DICP. 1990 Dec;24(12):1210-3. [PubMed:2089833 ]
  2. Furadantin® (nidivofurantoin) Oral Suspension[package insert]. Florham Park, New Jersey: Shionogi Inc. 2013. [Link]

PMID: 10193784

Nitrofurantoin

By

Nitrofurantoin

Product: GSK2879552

Identifier : DBSNPE002570
Drug : DB00698 (Nidivofurantoin)
Interacting Gene/Enzyme : Glucose-6-phosphate 1-dehydrogenase
Gene Name : G6PD
UniProt ID : P11413
Defining Change(s) :

  • 1400C->G

Allele Name : Neapolis
Genotype(s) : Not Available
Type(s) : ADR Inferred
Groups : G6PD deficiency
Description : Increased risk of hemolytic anemia.
References :

  1. Gait JE: Hemolytic reactions to nidivofurantoin in patients with glucose-6-phosphate dehydrogenase deficiency: theory and practice. DICP. 1990 Dec;24(12):1210-3. [PubMed:2089833 ]
  2. Furadantin® (nidivofurantoin) Oral Suspension[package insert]. Florham Park, New Jersey: Shionogi Inc. 2013. [Link]

PMID: 10602320

Nitrofurantoin

By

Nitrofurantoin

Product: ORY-1001

Identifier : DBSNPE002571
Drug : DB00698 (Nidivofurantoin)
Interacting Gene/Enzyme : Glucose-6-phosphate 1-dehydrogenase
Gene Name : G6PD
UniProt ID : P11413
Defining Change(s) :

  • 143T->C

Allele Name : Aures
Genotype(s) : Not Available
Type(s) : ADR Inferred
Groups : G6PD deficiency
Description : Increased risk of hemolytic anemia.
References :

  1. Gait JE: Hemolytic reactions to nidivofurantoin in patients with glucose-6-phosphate dehydrogenase deficiency: theory and practice. DICP. 1990 Dec;24(12):1210-3. [PubMed:2089833 ]
  2. Furadantin® (nidivofurantoin) Oral Suspension[package insert]. Florham Park, New Jersey: Shionogi Inc. 2013. [Link]

PMID: 10588927

Nitrofurantoin

By

Nitrofurantoin

Product: EPZ015666

Identifier : DBSNPE002572
Drug : DB00698 (Nidivofurantoin)
Interacting Gene/Enzyme : Glucose-6-phosphate 1-dehydrogenase
Gene Name : G6PD
UniProt ID : P11413
Defining Change(s) :

  • 1442C->G

Allele Name : Split
Genotype(s) : Not Available
Type(s) : ADR Inferred
Groups : G6PD deficiency
Description : Increased risk of hemolytic anemia.
References :

  1. Gait JE: Hemolytic reactions to nidivofurantoin in patients with glucose-6-phosphate dehydrogenase deficiency: theory and practice. DICP. 1990 Dec;24(12):1210-3. [PubMed:2089833 ]
  2. Furadantin® (nidivofurantoin) Oral Suspension[package insert]. Florham Park, New Jersey: Shionogi Inc. 2013. [Link]

PMID: 9605568

Nitrofurantoin

By

Nitrofurantoin

Product: Liproxstatin-1

Identifier : DBSNPE002573
Drug : DB00698 (Nidivofurantoin)
Interacting Gene/Enzyme : Glucose-6-phosphate 1-dehydrogenase
Gene Name : G6PD
UniProt ID : P11413
Defining Change(s) :

  • 148C->T

Allele Name : Kambos
Genotype(s) : Not Available
Type(s) : ADR Inferred
Groups : G6PD deficiency
Description : Increased risk of hemolytic anemia.
References :

  1. Gait JE: Hemolytic reactions to nidivofurantoin in patients with glucose-6-phosphate dehydrogenase deficiency: theory and practice. DICP. 1990 Dec;24(12):1210-3. [PubMed:2089833 ]
  2. Furadantin® (nidivofurantoin) Oral Suspension[package insert]. Florham Park, New Jersey: Shionogi Inc. 2013. [Link]

PMID: 9776359

Nitrofurantoin

By

Nitrofurantoin

Product: ML324

Identifier : DBSNPE002574
Drug : DB00698 (Nidivofurantoin)
Interacting Gene/Enzyme : Glucose-6-phosphate 1-dehydrogenase
Gene Name : G6PD
UniProt ID : P11413
Defining Change(s) :

  • 170G>A

Allele Name : Palesdivina
Genotype(s) : Not Available
Type(s) : ADR Inferred
Groups : G6PD deficiency
Description : Increased risk of hemolytic anemia.
References :

  1. Gait JE: Hemolytic reactions to nidivofurantoin in patients with glucose-6-phosphate dehydrogenase deficiency: theory and practice. DICP. 1990 Dec;24(12):1210-3. [PubMed:2089833 ]
  2. Furadantin® (nidivofurantoin) Oral Suspension[package insert]. Florham Park, New Jersey: Shionogi Inc. 2013. [Link]

PMID: 9226997

Nitrofurantoin

By

Nitrofurantoin

Product: CBB1007 (trihydrochloride)

Identifier : DBSNPE002575
Drug : DB00698 (Nidivofurantoin)
Interacting Gene/Enzyme : Glucose-6-phosphate 1-dehydrogenase
Gene Name : G6PD
UniProt ID : P11413
Defining Change(s) :

  • 172G->A

Allele Name : Metaponto
Genotype(s) : Not Available
Type(s) : ADR Inferred
Groups : G6PD deficiency
Description : Increased risk of hemolytic anemia.
References :

  1. Gait JE: Hemolytic reactions to nidivofurantoin in patients with glucose-6-phosphate dehydrogenase deficiency: theory and practice. DICP. 1990 Dec;24(12):1210-3. [PubMed:2089833 ]
  2. Furadantin® (nidivofurantoin) Oral Suspension[package insert]. Florham Park, New Jersey: Shionogi Inc. 2013. [Link]

PMID: 7522180

Nitrofurantoin

By

Nitrofurantoin

Product: Decernotinib

Identifier : DBSNPE002577
Drug : DB00698 (Nidivofurantoin)
Interacting Gene/Enzyme : Glucose-6-phosphate 1-dehydrogenase
Gene Name : G6PD
UniProt ID : P11413
Defining Change(s) :

  • 202G->A

Allele Name : Asahi
Genotype(s) : Not Available
Type(s) : ADR Inferred
Groups : G6PD deficiency
Description : Increased risk of hemolytic anemia.
References :

  1. Gait JE: Hemolytic reactions to nidivofurantoin in patients with glucose-6-phosphate dehydrogenase deficiency: theory and practice. DICP. 1990 Dec;24(12):1210-3. [PubMed:2089833 ]
  2. Furadantin® (nidivofurantoin) Oral Suspension[package insert]. Florham Park, New Jersey: Shionogi Inc. 2013. [Link]

PMID: 7678352

Nitrofurantoin

By

Nitrofurantoin

Product: STF-083010

Identifier : DBSNPE002578
Drug : DB00698 (Nidivofurantoin)
Interacting Gene/Enzyme : Glucose-6-phosphate 1-dehydrogenase
Gene Name : G6PD
UniProt ID : P11413
Defining Change(s) :

  • 202G->A
  • 376A->G

Allele Name : A- (202), Ferrara I
Genotype(s) : Not Available
Type(s) : ADR Inferred
Groups : G6PD deficiency
Description : Increased risk of hemolytic anemia.
References :

  1. Gait JE: Hemolytic reactions to nidivofurantoin in patients with glucose-6-phosphate dehydrogenase deficiency: theory and practice. DICP. 1990 Dec;24(12):1210-3. [PubMed:2089833 ]
  2. Furadantin® (nidivofurantoin) Oral Suspension[package insert]. Florham Park, New Jersey: Shionogi Inc. 2013. [Link]

PMID: 2890093

Nitrofurantoin

By

Nitrofurantoin

Product: GSK-J4

Identifier : DBSNPE002579
Drug : DB00698 (Nidivofurantoin)
Interacting Gene/Enzyme : Glucose-6-phosphate 1-dehydrogenase
Gene Name : G6PD
UniProt ID : P11413
Defining Change(s) :

  • 209A->G

Allele Name : Murcia Oristano
Genotype(s) : Not Available
Type(s) : ADR Inferred
Groups : G6PD deficiency
Description : Increased risk of hemolytic anemia.
References :

  1. Gait JE: Hemolytic reactions to nidivofurantoin in patients with glucose-6-phosphate dehydrogenase deficiency: theory and practice. DICP. 1990 Dec;24(12):1210-3. [PubMed:2089833 ]
  2. Furadantin® (nidivofurantoin) Oral Suspension[package insert]. Florham Park, New Jersey: Shionogi Inc. 2013. [Link]

PMID: 23838678

Nitrofurantoin

By

Nitrofurantoin

Product: PNRI-299

Identifier : DBSNPE002580
Drug : DB00698 (Nidivofurantoin)
Interacting Gene/Enzyme : Glucose-6-phosphate 1-dehydrogenase
Gene Name : G6PD
UniProt ID : P11413
Defining Change(s) :

  • 241C->T

Allele Name : Ube Konan
Genotype(s) : Not Available
Type(s) : ADR Inferred
Groups : G6PD deficiency
Description : Increased risk of hemolytic anemia.
References :

  1. Gait JE: Hemolytic reactions to nidivofurantoin in patients with glucose-6-phosphate dehydrogenase deficiency: theory and practice. DICP. 1990 Dec;24(12):1210-3. [PubMed:2089833 ]
  2. Furadantin® (nidivofurantoin) Oral Suspension[package insert]. Florham Park, New Jersey: Shionogi Inc. 2013. [Link]

PMID: 12495780

Nitrofurantoin

By

Nitrofurantoin

Product: PLX647

Identifier : DBSNPE002581
Drug : DB00698 (Nidivofurantoin)
Interacting Gene/Enzyme : Glucose-6-phosphate 1-dehydrogenase
Gene Name : G6PD
UniProt ID : P11413
Defining Change(s) :

  • 242G->A

Allele Name : Lagosanto
Genotype(s) : Not Available
Type(s) : ADR Inferred
Groups : G6PD deficiency
Description : Increased risk of hemolytic anemia.
References :

  1. Gait JE: Hemolytic reactions to nidivofurantoin in patients with glucose-6-phosphate dehydrogenase deficiency: theory and practice. DICP. 1990 Dec;24(12):1210-3. [PubMed:2089833 ]
  2. Furadantin® (nidivofurantoin) Oral Suspension[package insert]. Florham Park, New Jersey: Shionogi Inc. 2013. [Link]

PMID: 11596856

Nitrofurantoin

By

Nitrofurantoin

Product: PF-06463922

Identifier : DBSNPE002582
Drug : DB00698 (Nidivofurantoin)
Interacting Gene/Enzyme : Glucose-6-phosphate 1-dehydrogenase
Gene Name : G6PD
UniProt ID : P11413
Defining Change(s) :

  • 274C->T

Allele Name : Guangzhou
Genotype(s) : Not Available
Type(s) : ADR Inferred
Groups : G6PD deficiency
Description : Increased risk of hemolytic anemia.
References :

  1. Gait JE: Hemolytic reactions to nidivofurantoin in patients with glucose-6-phosphate dehydrogenase deficiency: theory and practice. DICP. 1990 Dec;24(12):1210-3. [PubMed:2089833 ]
  2. Furadantin® (nidivofurantoin) Oral Suspension[package insert]. Florham Park, New Jersey: Shionogi Inc. 2013. [Link]

PMID: 9272623

Nitrofurantoin

By

Nitrofurantoin

Product: BMS-794833

Identifier : DBSNPE002583
Drug : DB00698 (Nidivofurantoin)
Interacting Gene/Enzyme : Glucose-6-phosphate 1-dehydrogenase
Gene Name : G6PD
UniProt ID : P11413
Defining Change(s) :

  • 323T->A

Allele Name : Hammersmith
Genotype(s) : Not Available
Type(s) : ADR Inferred
Groups : G6PD deficiency
Description : Increased risk of hemolytic anemia.
References :

  1. Gait JE: Hemolytic reactions to nidivofurantoin in patients with glucose-6-phosphate dehydrogenase deficiency: theory and practice. DICP. 1990 Dec;24(12):1210-3. [PubMed:2089833 ]
  2. Furadantin® (nidivofurantoin) Oral Suspension[package insert]. Florham Park, New Jersey: Shionogi Inc. 2013. [Link]

PMID: 1346555

Nitrofurantoin

By

Nitrofurantoin

Product: Quercetin

Identifier : DBSNPE002584
Drug : DB00698 (Nidivofurantoin)
Interacting Gene/Enzyme : Glucose-6-phosphate 1-dehydrogenase
Gene Name : G6PD
UniProt ID : P11413
Defining Change(s) :

  • 34G->T

Allele Name : Sinnai
Genotype(s) : Not Available
Type(s) : ADR Inferred
Groups : G6PD deficiency
Description : Increased risk of hemolytic anemia.
References :

  1. Gait JE: Hemolytic reactions to nidivofurantoin in patients with glucose-6-phosphate dehydrogenase deficiency: theory and practice. DICP. 1990 Dec;24(12):1210-3. [PubMed:2089833 ]
  2. Furadantin® (nidivofurantoin) Oral Suspension[package insert]. Florham Park, New Jersey: Shionogi Inc. 2013. [Link]

PMID: 11693467

Nitrofurantoin

By

Nitrofurantoin

Product: Mebendazole

Identifier : DBSNPE002585
Drug : DB00698 (Nidivofurantoin)
Interacting Gene/Enzyme : Glucose-6-phosphate 1-dehydrogenase
Gene Name : G6PD
UniProt ID : P11413
Defining Change(s) :

  • 376A->G
  • 680G->T

Allele Name : A- (680)
Genotype(s) : Not Available
Type(s) : ADR Inferred
Groups : G6PD deficiency
Description : Increased risk of hemolytic anemia.
References :

  1. Gait JE: Hemolytic reactions to nidivofurantoin in patients with glucose-6-phosphate dehydrogenase deficiency: theory and practice. DICP. 1990 Dec;24(12):1210-3. [PubMed:2089833 ]
  2. Furadantin® (nidivofurantoin) Oral Suspension[package insert]. Florham Park, New Jersey: Shionogi Inc. 2013. [Link]

PMID: 18981288

Nitrofurantoin

By

Nitrofurantoin

Product: Wogonin

Identifier : DBSNPE002586
Drug : DB00698 (Nidivofurantoin)
Interacting Gene/Enzyme : Glucose-6-phosphate 1-dehydrogenase
Gene Name : G6PD
UniProt ID : P11413
Defining Change(s) :

  • 376A->G
  • 968T->C

Allele Name : A- (968), Betica,Selma, Guantanamo
Genotype(s) : Not Available
Type(s) : ADR Inferred
Groups : G6PD deficiency
Description : Increased risk of hemolytic anemia.
References :

  1. Gait JE: Hemolytic reactions to nidivofurantoin in patients with glucose-6-phosphate dehydrogenase deficiency: theory and practice. DICP. 1990 Dec;24(12):1210-3. [PubMed:2089833 ]
  2. Furadantin® (nidivofurantoin) Oral Suspension[package insert]. Florham Park, New Jersey: Shionogi Inc. 2013. [Link]

PMID: 12379118

Nitrofurantoin

By

Nitrofurantoin

Product: Etretinate

Identifier : DBSNPE002587
Drug : DB00698 (Nidivofurantoin)
Interacting Gene/Enzyme : Glucose-6-phosphate 1-dehydrogenase
Gene Name : G6PD
UniProt ID : P11413
Defining Change(s) :

  • 383T>G

Allele Name : Salerno Pyrgos
Genotype(s) : Not Available
Type(s) : ADR Inferred
Groups : G6PD deficiency
Description : Increased risk of hemolytic anemia.
References :

  1. Gait JE: Hemolytic reactions to nidivofurantoin in patients with glucose-6-phosphate dehydrogenase deficiency: theory and practice. DICP. 1990 Dec;24(12):1210-3. [PubMed:2089833 ]
  2. Furadantin® (nidivofurantoin) Oral Suspension[package insert]. Florham Park, New Jersey: Shionogi Inc. 2013. [Link]

PMID: 3026407

Nitrofurantoin

By

Nitrofurantoin

Product: Gastrodenol

Identifier : DBSNPE002588
Drug : DB00698 (Nidivofurantoin)
Interacting Gene/Enzyme : Glucose-6-phosphate 1-dehydrogenase
Gene Name : G6PD
UniProt ID : P11413
Defining Change(s) :

  • 392G->T

Allele Name : Quing Yan
Genotype(s) : Not Available
Type(s) : ADR Inferred
Groups : G6PD deficiency
Description : Increased risk of hemolytic anemia.
References :

  1. Gait JE: Hemolytic reactions to nidivofurantoin in patients with glucose-6-phosphate dehydrogenase deficiency: theory and practice. DICP. 1990 Dec;24(12):1210-3. [PubMed:2089833 ]
  2. Furadantin® (nidivofurantoin) Oral Suspension[package insert]. Florham Park, New Jersey: Shionogi Inc. 2013. [Link]

PMID: 6864535

Nitrofurantoin

By

Nitrofurantoin

Product: MHY1485

Identifier : DBSNPE002589
Drug : DB00698 (Nidivofurantoin)
Interacting Gene/Enzyme : Glucose-6-phosphate 1-dehydrogenase
Gene Name : G6PD
UniProt ID : P11413
Defining Change(s) :

  • 40G->A

Allele Name : Lages
Genotype(s) : Not Available
Type(s) : ADR Inferred
Groups : G6PD deficiency
Description : Increased risk of hemolytic anemia.
References :

  1. Gait JE: Hemolytic reactions to nidivofurantoin in patients with glucose-6-phosphate dehydrogenase deficiency: theory and practice. DICP. 1990 Dec;24(12):1210-3. [PubMed:2089833 ]
  2. Furadantin® (nidivofurantoin) Oral Suspension[package insert]. Florham Park, New Jersey: Shionogi Inc. 2013. [Link]

PMID: 18172439

Nitrofurantoin

By

Nitrofurantoin

Product: CZC-54252

Identifier : DBSNPE002590
Drug : DB00698 (Nidivofurantoin)
Interacting Gene/Enzyme : Glucose-6-phosphate 1-dehydrogenase
Gene Name : G6PD
UniProt ID : P11413
Defining Change(s) :

  • 466G->A

Allele Name : Ilesha
Genotype(s) : Not Available
Type(s) : ADR Inferred
Groups : G6PD deficiency
Description : Increased risk of hemolytic anemia.
References :

  1. Gait JE: Hemolytic reactions to nidivofurantoin in patients with glucose-6-phosphate dehydrogenase deficiency: theory and practice. DICP. 1990 Dec;24(12):1210-3. [PubMed:2089833 ]
  2. Furadantin® (nidivofurantoin) Oral Suspension[package insert]. Florham Park, New Jersey: Shionogi Inc. 2013. [Link]

PMID: 17490952

Nitrofurantoin

By

Nitrofurantoin

Product: Altiratinib

Identifier : DBSNPE002591
Drug : DB00698 (Nidivofurantoin)
Interacting Gene/Enzyme : Glucose-6-phosphate 1-dehydrogenase
Gene Name : G6PD
UniProt ID : P11413
Defining Change(s) :

  • 487G->A

Allele Name : Mahidol
Genotype(s) : Not Available
Type(s) : ADR Inferred
Groups : G6PD deficiency
Description : Increased risk of hemolytic anemia.
References :

  1. Gait JE: Hemolytic reactions to nidivofurantoin in patients with glucose-6-phosphate dehydrogenase deficiency: theory and practice. DICP. 1990 Dec;24(12):1210-3. [PubMed:2089833 ]
  2. Furadantin® (nidivofurantoin) Oral Suspension[package insert]. Florham Park, New Jersey: Shionogi Inc. 2013. [Link]

PMID: 9311023

Nitrofurantoin

By

Nitrofurantoin

Product: SU6656

Identifier : DBSNPE002592
Drug : DB00698 (Nidivofurantoin)
Interacting Gene/Enzyme : Glucose-6-phosphate 1-dehydrogenase
Gene Name : G6PD
UniProt ID : P11413
Defining Change(s) :

  • 542A->T

Allele Name : Malaga
Genotype(s) : Not Available
Type(s) : ADR Inferred
Groups : G6PD deficiency
Description : Increased risk of hemolytic anemia.
References :

  1. Gait JE: Hemolytic reactions to nidivofurantoin in patients with glucose-6-phosphate dehydrogenase deficiency: theory and practice. DICP. 1990 Dec;24(12):1210-3. [PubMed:2089833 ]
  2. Furadantin® (nidivofurantoin) Oral Suspension[package insert]. Florham Park, New Jersey: Shionogi Inc. 2013. [Link]

PMID: 25762718

Nitrofurantoin

By

Nitrofurantoin

Product: LY2409881 (trihydrochloride)

Identifier : DBSNPE002593
Drug : DB00698 (Nidivofurantoin)
Interacting Gene/Enzyme : Glucose-6-phosphate 1-dehydrogenase
Gene Name : G6PD
UniProt ID : P11413
Defining Change(s) :

  • 634A->G

Allele Name : Sibari
Genotype(s) : Not Available
Type(s) : ADR Inferred
Groups : G6PD deficiency
Description : Increased risk of hemolytic anemia.
References :

  1. Gait JE: Hemolytic reactions to nidivofurantoin in patients with glucose-6-phosphate dehydrogenase deficiency: theory and practice. DICP. 1990 Dec;24(12):1210-3. [PubMed:2089833 ]
  2. Furadantin® (nidivofurantoin) Oral Suspension[package insert]. Florham Park, New Jersey: Shionogi Inc. 2013. [Link]

PMID: 22700794

Nitrofurantoin

By

Nitrofurantoin

Product: LY2409881

Identifier : DBSNPE002594
Drug : DB00698 (Nidivofurantoin)
Interacting Gene/Enzyme : Glucose-6-phosphate 1-dehydrogenase
Gene Name : G6PD
UniProt ID : P11413
Defining Change(s) :

  • 680G->A

Allele Name : Mexico City
Genotype(s) : Not Available
Type(s) : ADR Inferred
Groups : G6PD deficiency
Description : Increased risk of hemolytic anemia.
References :

  1. Gait JE: Hemolytic reactions to nidivofurantoin in patients with glucose-6-phosphate dehydrogenase deficiency: theory and practice. DICP. 1990 Dec;24(12):1210-3. [PubMed:2089833 ]
  2. Furadantin® (nidivofurantoin) Oral Suspension[package insert]. Florham Park, New Jersey: Shionogi Inc. 2013. [Link]

PMID: 2959777

Nitrofurantoin

By

Nitrofurantoin

Product: Sodium Butyrate

Identifier : DBSNPE002595
Drug : DB00698 (Nidivofurantoin)
Interacting Gene/Enzyme : Glucose-6-phosphate 1-dehydrogenase
Gene Name : G6PD
UniProt ID : P11413
Defining Change(s) :

  • 703C->T

Allele Name : Nanning
Genotype(s) : Not Available
Type(s) : ADR Inferred
Groups : G6PD deficiency
Description : Increased risk of hemolytic anemia.
References :

  1. Gait JE: Hemolytic reactions to nidivofurantoin in patients with glucose-6-phosphate dehydrogenase deficiency: theory and practice. DICP. 1990 Dec;24(12):1210-3. [PubMed:2089833 ]
  2. Furadantin® (nidivofurantoin) Oral Suspension[package insert]. Florham Park, New Jersey: Shionogi Inc. 2013. [Link]

PMID: 3011908

Nitrofurantoin

By

Nitrofurantoin

Product: Lidocaine (hydrochloride)

Identifier : DBSNPE002596
Drug : DB00698 (Nidivofurantoin)
Interacting Gene/Enzyme : Glucose-6-phosphate 1-dehydrogenase
Gene Name : G6PD
UniProt ID : P11413
Defining Change(s) :

  • 844G->C

Allele Name : Seattle, Lodi, Modena, Ferrara II, Athens-like
Genotype(s) : Not Available
Type(s) : ADR Inferred
Groups : G6PD deficiency
Description : Increased risk of hemolytic anemia.
References :

  1. Gait JE: Hemolytic reactions to nidivofurantoin in patients with glucose-6-phosphate dehydrogenase deficiency: theory and practice. DICP. 1990 Dec;24(12):1210-3. [PubMed:2089833 ]
  2. Furadantin® (nidivofurantoin) Oral Suspension[package insert]. Florham Park, New Jersey: Shionogi Inc. 2013. [Link]

PMID: 21139565

Nitrofurantoin

By

Nitrofurantoin

Product: FAAH-IN-2

Identifier : DBSNPE002597
Drug : DB00698 (Nidivofurantoin)
Interacting Gene/Enzyme : Glucose-6-phosphate 1-dehydrogenase
Gene Name : G6PD
UniProt ID : P11413
Defining Change(s) :

  • 844G->T

Allele Name : Bajo Maumere
Genotype(s) : Not Available
Type(s) : ADR Inferred
Groups : G6PD deficiency
Description : Increased risk of hemolytic anemia.
References :

  1. Gait JE: Hemolytic reactions to nidivofurantoin in patients with glucose-6-phosphate dehydrogenase deficiency: theory and practice. DICP. 1990 Dec;24(12):1210-3. [PubMed:2089833 ]
  2. Furadantin® (nidivofurantoin) Oral Suspension[package insert]. Florham Park, New Jersey: Shionogi Inc. 2013. [Link]

PMID: 23961154

Nitrofurantoin

By

Nitrofurantoin

Product: CRAC intermediate 2

Identifier : DBSNPE002598
Drug : DB00698 (Nidivofurantoin)
Interacting Gene/Enzyme : Glucose-6-phosphate 1-dehydrogenase
Gene Name : G6PD
UniProt ID : P11413
Defining Change(s) :

  • 854G->A

Allele Name : Montalbano
Genotype(s) : Not Available
Type(s) : ADR Inferred
Groups : G6PD deficiency
Description : Increased risk of hemolytic anemia.
References :

  1. Gait JE: Hemolytic reactions to nidivofurantoin in patients with glucose-6-phosphate dehydrogenase deficiency: theory and practice. DICP. 1990 Dec;24(12):1210-3. [PubMed:2089833 ]
  2. Furadantin® (nidivofurantoin) Oral Suspension[package insert]. Florham Park, New Jersey: Shionogi Inc. 2013. [Link]

PMID: 10759332

Nitrofurantoin

By

Nitrofurantoin

Product: CRAC intermediate 1

Identifier : DBSNPE002599
Drug : DB00698 (Nidivofurantoin)
Interacting Gene/Enzyme : Glucose-6-phosphate 1-dehydrogenase
Gene Name : G6PD
UniProt ID : P11413
Defining Change(s) :

  • 949G->A

Allele Name : Kalyan-Kerala, Jamnaga, Rohini
Genotype(s) : Not Available
Type(s) : ADR Inferred
Groups : G6PD deficiency
Description : Increased risk of hemolytic anemia.
References :

  1. Gait JE: Hemolytic reactions to nidivofurantoin in patients with glucose-6-phosphate dehydrogenase deficiency: theory and practice. DICP. 1990 Dec;24(12):1210-3. [PubMed:2089833 ]
  2. Furadantin® (nidivofurantoin) Oral Suspension[package insert]. Florham Park, New Jersey: Shionogi Inc. 2013. [Link]

PMID: 1358393

Nitrofurantoin

By

Nitrofurantoin

Product: Omarigliptin

Identifier : DBSNPE002600
Drug : DB00698 (Nidivofurantoin)
Interacting Gene/Enzyme : Glucose-6-phosphate 1-dehydrogenase
Gene Name : G6PD
UniProt ID : P11413
Defining Change(s) :

  • 95A->G

Allele Name : Gaohe
Genotype(s) : Not Available
Type(s) : ADR Inferred
Groups : G6PD deficiency
Description : Increased risk of hemolytic anemia.
References :

  1. Gait JE: Hemolytic reactions to nidivofurantoin in patients with glucose-6-phosphate dehydrogenase deficiency: theory and practice. DICP. 1990 Dec;24(12):1210-3. [PubMed:2089833 ]
  2. Furadantin® (nidivofurantoin) Oral Suspension[package insert]. Florham Park, New Jersey: Shionogi Inc. 2013. [Link]

PMID: 26158531

By

Related Post

You Missed

Uncategorized

Recombinant Human SLC27A1, N-His

Uncategorized

Recombinant Human NAD-dependent protein deacetylase sirtuin-6(SIRT6)

Uncategorized

Recombinant Human SPARCL1, N-GST

Uncategorized

Recombinant rat Insulin-like growth factor I