PI3KInhibitorpi3kinhibitor

Methylene blue

By

Methylene blue

Product: Orbifloxacin

Identifier : DBSNPE002088
Drug : DB09241 (Methylene blue)
Interacting Gene/Enzyme : Glucose-6-phosphate 1-dehydrogenase
Gene Name : G6PD
UniProt ID : P11413
Defining Change(s) :

  • 1000_1002delACC

Allele Name : Villeurbanne
Genotype(s) : Not Available
Type(s) : ADR Inferred
Groups : G6PD deficiency
Description : Increased risk of hemolytic anemia or paradoxical methemoglobinemia.
References :

  1. Sikka P, Bindra VK, Kapoor S, Jain V, Saxena KK: Blue cures blue but be cautious. J Pharm Bioallied Sci. 2011 Oct;3(4):543-5. doi: 10.4103/0975-7406.90112. [PubMed:22219589 ]
  2. Provayblue™ (methylene blue) injection[package insert]. Shirley, New York: American Regent; 2016. [Link]

PMID: 19460767

Methylene blue

By

Methylene blue

Product: Piperazine

Identifier : DBSNPE002089
Drug : DB09241 (Methylene blue)
Interacting Gene/Enzyme : Glucose-6-phosphate 1-dehydrogenase
Gene Name : G6PD
UniProt ID : P11413
Defining Change(s) :

  • 1006A->G

Allele Name : Torun
Genotype(s) : Not Available
Type(s) : ADR Inferred
Groups : G6PD deficiency
Description : Increased risk of hemolytic anemia or paradoxical methemoglobinemia.
References :

  1. Sikka P, Bindra VK, Kapoor S, Jain V, Saxena KK: Blue cures blue but be cautious. J Pharm Bioallied Sci. 2011 Oct;3(4):543-5. doi: 10.4103/0975-7406.90112. [PubMed:22219589 ]
  2. Provayblue™ (methylene blue) injection[package insert]. Shirley, New York: American Regent; 2016. [Link]

PMID: 17303702

Methylene blue

By

Methylene blue

Product: Chlorophyllin (sodium copper salt)

Identifier : DBSNPE002090
Drug : DB09241 (Methylene blue)
Interacting Gene/Enzyme : Glucose-6-phosphate 1-dehydrogenase
Gene Name : G6PD
UniProt ID : P11413
Defining Change(s) :

  • 105_107delCAT

Allele Name : Sunderland
Genotype(s) : Not Available
Type(s) : ADR Inferred
Groups : G6PD deficiency
Description : Increased risk of hemolytic anemia or paradoxical methemoglobinemia.
References :

  1. Sikka P, Bindra VK, Kapoor S, Jain V, Saxena KK: Blue cures blue but be cautious. J Pharm Bioallied Sci. 2011 Oct;3(4):543-5. doi: 10.4103/0975-7406.90112. [PubMed:22219589 ]
  2. Provayblue™ (methylene blue) injection[package insert]. Shirley, New York: American Regent; 2016. [Link]

PMID: 15608073

Methylene blue

By

Methylene blue

Product: Pyrithioxin

Identifier : DBSNPE002091
Drug : DB09241 (Methylene blue)
Interacting Gene/Enzyme : Glucose-6-phosphate 1-dehydrogenase
Gene Name : G6PD
UniProt ID : P11413
Defining Change(s) :

  • 1081G->A

Allele Name : Iwatsuki
Genotype(s) : Not Available
Type(s) : ADR Inferred
Groups : G6PD deficiency
Description : Increased risk of hemolytic anemia or paradoxical methemoglobinemia.
References :

  1. Sikka P, Bindra VK, Kapoor S, Jain V, Saxena KK: Blue cures blue but be cautious. J Pharm Bioallied Sci. 2011 Oct;3(4):543-5. doi: 10.4103/0975-7406.90112. [PubMed:22219589 ]
  2. Provayblue™ (methylene blue) injection[package insert]. Shirley, New York: American Regent; 2016. [Link]

PMID: 15537338

Methylene blue

By

Methylene blue

Product: Triflupromazine (hydrochloride)

Identifier : DBSNPE002092
Drug : DB09241 (Methylene blue)
Interacting Gene/Enzyme : Glucose-6-phosphate 1-dehydrogenase
Gene Name : G6PD
UniProt ID : P11413
Defining Change(s) :

  • 1082C->T

Allele Name : Serres
Genotype(s) : Not Available
Type(s) : ADR Inferred
Groups : G6PD deficiency
Description : Increased risk of hemolytic anemia or paradoxical methemoglobinemia.
References :

  1. Sikka P, Bindra VK, Kapoor S, Jain V, Saxena KK: Blue cures blue but be cautious. J Pharm Bioallied Sci. 2011 Oct;3(4):543-5. doi: 10.4103/0975-7406.90112. [PubMed:22219589 ]
  2. Provayblue™ (methylene blue) injection[package insert]. Shirley, New York: American Regent; 2016. [Link]

PMID: 18056795

Methylene blue

By

Methylene blue

Product: Meticrane

Identifier : DBSNPE002093
Drug : DB09241 (Methylene blue)
Interacting Gene/Enzyme : Glucose-6-phosphate 1-dehydrogenase
Gene Name : G6PD
UniProt ID : P11413
Defining Change(s) :

  • 1084_1101delCTGAACGAGCGCAAGGCC

Allele Name : Tondela
Genotype(s) : Not Available
Type(s) : ADR Inferred
Groups : G6PD deficiency
Description : Increased risk of hemolytic anemia or paradoxical methemoglobinemia.
References :

  1. Sikka P, Bindra VK, Kapoor S, Jain V, Saxena KK: Blue cures blue but be cautious. J Pharm Bioallied Sci. 2011 Oct;3(4):543-5. doi: 10.4103/0975-7406.90112. [PubMed:22219589 ]
  2. Provayblue™ (methylene blue) injection[package insert]. Shirley, New York: American Regent; 2016. [Link]

PMID: 14747613

Methylene blue

By

Methylene blue

Product: Resorcinol

Identifier : DBSNPE002094
Drug : DB09241 (Methylene blue)
Interacting Gene/Enzyme : Glucose-6-phosphate 1-dehydrogenase
Gene Name : G6PD
UniProt ID : P11413
Defining Change(s) :

  • 1089C->A

Allele Name : Loma Linda
Genotype(s) : Not Available
Type(s) : ADR Inferred
Groups : G6PD deficiency
Description : Increased risk of hemolytic anemia or paradoxical methemoglobinemia.
References :

  1. Sikka P, Bindra VK, Kapoor S, Jain V, Saxena KK: Blue cures blue but be cautious. J Pharm Bioallied Sci. 2011 Oct;3(4):543-5. doi: 10.4103/0975-7406.90112. [PubMed:22219589 ]
  2. Provayblue™ (methylene blue) injection[package insert]. Shirley, New York: American Regent; 2016. [Link]

PMID: 12920211

Methylene blue

By

Methylene blue

Product: Bucetin

Identifier : DBSNPE002095
Drug : DB09241 (Methylene blue)
Interacting Gene/Enzyme : Glucose-6-phosphate 1-dehydrogenase
Gene Name : G6PD
UniProt ID : P11413
Defining Change(s) :

  • 1089C->G

Allele Name : Aachen
Genotype(s) : Not Available
Type(s) : ADR Inferred
Groups : G6PD deficiency
Description : Increased risk of hemolytic anemia or paradoxical methemoglobinemia.
References :

  1. Sikka P, Bindra VK, Kapoor S, Jain V, Saxena KK: Blue cures blue but be cautious. J Pharm Bioallied Sci. 2011 Oct;3(4):543-5. doi: 10.4103/0975-7406.90112. [PubMed:22219589 ]
  2. Provayblue™ (methylene blue) injection[package insert]. Shirley, New York: American Regent; 2016. [Link]

PMID: 16135701

Methylene blue

By

Methylene blue

Product: Tilmicosin

Identifier : DBSNPE002096
Drug : DB09241 (Methylene blue)
Interacting Gene/Enzyme : Glucose-6-phosphate 1-dehydrogenase
Gene Name : G6PD
UniProt ID : P11413
Defining Change(s) :

  • 1096A->G

Allele Name : Tenri
Genotype(s) : Not Available
Type(s) : ADR Inferred
Groups : G6PD deficiency
Description : Increased risk of hemolytic anemia or paradoxical methemoglobinemia.
References :

  1. Sikka P, Bindra VK, Kapoor S, Jain V, Saxena KK: Blue cures blue but be cautious. J Pharm Bioallied Sci. 2011 Oct;3(4):543-5. doi: 10.4103/0975-7406.90112. [PubMed:22219589 ]
  2. Provayblue™ (methylene blue) injection[package insert]. Shirley, New York: American Regent; 2016. [Link]

PMID: 18849168

Methylene blue

By

Methylene blue

Product: Hexylene glycol

Identifier : DBSNPE002097
Drug : DB09241 (Methylene blue)
Interacting Gene/Enzyme : Glucose-6-phosphate 1-dehydrogenase
Gene Name : G6PD
UniProt ID : P11413
Defining Change(s) :

  • 1132G>A

Allele Name : Montpellier
Genotype(s) : Not Available
Type(s) : ADR Inferred
Groups : G6PD deficiency
Description : Increased risk of hemolytic anemia or paradoxical methemoglobinemia.
References :

  1. Sikka P, Bindra VK, Kapoor S, Jain V, Saxena KK: Blue cures blue but be cautious. J Pharm Bioallied Sci. 2011 Oct;3(4):543-5. doi: 10.4103/0975-7406.90112. [PubMed:22219589 ]
  2. Provayblue™ (methylene blue) injection[package insert]. Shirley, New York: American Regent; 2016. [Link]

PMID: 17360958

Methylene blue

By

Methylene blue

Product: Rufloxacin (hydrochloride)

Identifier : DBSNPE002098
Drug : DB09241 (Methylene blue)
Interacting Gene/Enzyme : Glucose-6-phosphate 1-dehydrogenase
Gene Name : G6PD
UniProt ID : P11413
Defining Change(s) :

  • 1138A->G

Allele Name : Calvo Mackenna
Genotype(s) : Not Available
Type(s) : ADR Inferred
Groups : G6PD deficiency
Description : Increased risk of hemolytic anemia or paradoxical methemoglobinemia.
References :

  1. Sikka P, Bindra VK, Kapoor S, Jain V, Saxena KK: Blue cures blue but be cautious. J Pharm Bioallied Sci. 2011 Oct;3(4):543-5. doi: 10.4103/0975-7406.90112. [PubMed:22219589 ]
  2. Provayblue™ (methylene blue) injection[package insert]. Shirley, New York: American Regent; 2016. [Link]

PMID: 22884612

Methylene blue

By

Methylene blue

Product: Bromperidol

Identifier : DBSNPE002099
Drug : DB09241 (Methylene blue)
Interacting Gene/Enzyme : Glucose-6-phosphate 1-dehydrogenase
Gene Name : G6PD
UniProt ID : P11413
Defining Change(s) :

  • 1139T->C

Allele Name : Riley
Genotype(s) : Not Available
Type(s) : ADR Inferred
Groups : G6PD deficiency
Description : Increased risk of hemolytic anemia or paradoxical methemoglobinemia.
References :

  1. Sikka P, Bindra VK, Kapoor S, Jain V, Saxena KK: Blue cures blue but be cautious. J Pharm Bioallied Sci. 2011 Oct;3(4):543-5. doi: 10.4103/0975-7406.90112. [PubMed:22219589 ]
  2. Provayblue™ (methylene blue) injection[package insert]. Shirley, New York: American Regent; 2016. [Link]

PMID: 22884720

Methylene blue

By

Methylene blue

Product: Anethole

Identifier : DBSNPE002100
Drug : DB09241 (Methylene blue)
Interacting Gene/Enzyme : Glucose-6-phosphate 1-dehydrogenase
Gene Name : G6PD
UniProt ID : P11413
Defining Change(s) :

  • 1141T->C

Allele Name : Olomouc
Genotype(s) : Not Available
Type(s) : ADR Inferred
Groups : G6PD deficiency
Description : Increased risk of hemolytic anemia or paradoxical methemoglobinemia.
References :

  1. Sikka P, Bindra VK, Kapoor S, Jain V, Saxena KK: Blue cures blue but be cautious. J Pharm Bioallied Sci. 2011 Oct;3(4):543-5. doi: 10.4103/0975-7406.90112. [PubMed:22219589 ]
  2. Provayblue™ (methylene blue) injection[package insert]. Shirley, New York: American Regent; 2016. [Link]

PMID: 22129780

Methylene blue

By

Methylene blue

Product: Ceftiofur (sodium)

Identifier : DBSNPE002102
Drug : DB09241 (Methylene blue)
Interacting Gene/Enzyme : Glucose-6-phosphate 1-dehydrogenase
Gene Name : G6PD
UniProt ID : P11413
Defining Change(s) :

  • 1154G->T

Allele Name : Lynwood
Genotype(s) : Not Available
Type(s) : ADR Inferred
Groups : G6PD deficiency
Description : Increased risk of hemolytic anemia or paradoxical methemoglobinemia.
References :

  1. Sikka P, Bindra VK, Kapoor S, Jain V, Saxena KK: Blue cures blue but be cautious. J Pharm Bioallied Sci. 2011 Oct;3(4):543-5. doi: 10.4103/0975-7406.90112. [PubMed:22219589 ]
  2. Provayblue™ (methylene blue) injection[package insert]. Shirley, New York: American Regent; 2016. [Link]

PMID: 24001208

Methylene blue

By

Methylene blue

Product: Triacetin

Identifier : DBSNPE002103
Drug : DB09241 (Methylene blue)
Interacting Gene/Enzyme : Glucose-6-phosphate 1-dehydrogenase
Gene Name : G6PD
UniProt ID : P11413
Defining Change(s) :

  • 1155C->G

Allele Name : Madrid
Genotype(s) : Not Available
Type(s) : ADR Inferred
Groups : G6PD deficiency
Description : Increased risk of hemolytic anemia or paradoxical methemoglobinemia.
References :

  1. Sikka P, Bindra VK, Kapoor S, Jain V, Saxena KK: Blue cures blue but be cautious. J Pharm Bioallied Sci. 2011 Oct;3(4):543-5. doi: 10.4103/0975-7406.90112. [PubMed:22219589 ]
  2. Provayblue™ (methylene blue) injection[package insert]. Shirley, New York: American Regent; 2016. [Link]

PMID: 22924094

Methylene blue

By

Methylene blue

Product: Hydroxyzine (pamoate)

Identifier : DBSNPE002104
Drug : DB09241 (Methylene blue)
Interacting Gene/Enzyme : Glucose-6-phosphate 1-dehydrogenase
Gene Name : G6PD
UniProt ID : P11413
Defining Change(s) :

  • 1156A->G

Allele Name : Iowa, Walter Reed, Springfield
Genotype(s) : Not Available
Type(s) : ADR Inferred
Groups : G6PD deficiency
Description : Increased risk of hemolytic anemia or paradoxical methemoglobinemia.
References :

  1. Sikka P, Bindra VK, Kapoor S, Jain V, Saxena KK: Blue cures blue but be cautious. J Pharm Bioallied Sci. 2011 Oct;3(4):543-5. doi: 10.4103/0975-7406.90112. [PubMed:22219589 ]
  2. Provayblue™ (methylene blue) injection[package insert]. Shirley, New York: American Regent; 2016. [Link]

PMID: 21546249

Methylene blue

By

Methylene blue

Product: Resorcinol (monoacetate)

Identifier : DBSNPE002105
Drug : DB09241 (Methylene blue)
Interacting Gene/Enzyme : Glucose-6-phosphate 1-dehydrogenase
Gene Name : G6PD
UniProt ID : P11413
Defining Change(s) :

  • 1160G->A

Allele Name : Beverly Hills, Genova, Iwate, Niigata, Yamaguchi
Genotype(s) : Not Available
Type(s) : ADR Inferred
Groups : G6PD deficiency
Description : Increased risk of hemolytic anemia or paradoxical methemoglobinemia.
References :

  1. Sikka P, Bindra VK, Kapoor S, Jain V, Saxena KK: Blue cures blue but be cautious. J Pharm Bioallied Sci. 2011 Oct;3(4):543-5. doi: 10.4103/0975-7406.90112. [PubMed:22219589 ]
  2. Provayblue™ (methylene blue) injection[package insert]. Shirley, New York: American Regent; 2016. [Link]

PMID: 17855348

Methylene blue

By

Methylene blue

Product: 3-Pyridinemethanol

Identifier : DBSNPE002106
Drug : DB09241 (Methylene blue)
Interacting Gene/Enzyme : Glucose-6-phosphate 1-dehydrogenase
Gene Name : G6PD
UniProt ID : P11413
Defining Change(s) :

  • 1162A->G

Allele Name : Hartford
Genotype(s) : Not Available
Type(s) : ADR Inferred
Groups : G6PD deficiency
Description : Increased risk of hemolytic anemia or paradoxical methemoglobinemia.
References :

  1. Sikka P, Bindra VK, Kapoor S, Jain V, Saxena KK: Blue cures blue but be cautious. J Pharm Bioallied Sci. 2011 Oct;3(4):543-5. doi: 10.4103/0975-7406.90112. [PubMed:22219589 ]
  2. Provayblue™ (methylene blue) injection[package insert]. Shirley, New York: American Regent; 2016. [Link]

PMID: 16645124

Methylene blue

By

Methylene blue

Product: Benzyl alcohol

Identifier : DBSNPE002107
Drug : DB09241 (Methylene blue)
Interacting Gene/Enzyme : Glucose-6-phosphate 1-dehydrogenase
Gene Name : G6PD
UniProt ID : P11413
Defining Change(s) :

  • 1166A->G

Allele Name : Praha
Genotype(s) : Not Available
Type(s) : ADR Inferred
Groups : G6PD deficiency
Description : Increased risk of hemolytic anemia or paradoxical methemoglobinemia.
References :

  1. Sikka P, Bindra VK, Kapoor S, Jain V, Saxena KK: Blue cures blue but be cautious. J Pharm Bioallied Sci. 2011 Oct;3(4):543-5. doi: 10.4103/0975-7406.90112. [PubMed:22219589 ]
  2. Provayblue™ (methylene blue) injection[package insert]. Shirley, New York: American Regent; 2016. [Link]

PMID: 11606768

Methylene blue

By

Methylene blue

Product: 17-Hydroxyprogesterone

Identifier : DBSNPE002108
Drug : DB09241 (Methylene blue)
Interacting Gene/Enzyme : Glucose-6-phosphate 1-dehydrogenase
Gene Name : G6PD
UniProt ID : P11413
Defining Change(s) :

  • 1175T>C

Allele Name : Krakow
Genotype(s) : Not Available
Type(s) : ADR Inferred
Groups : G6PD deficiency
Description : Increased risk of hemolytic anemia or paradoxical methemoglobinemia.
References :

  1. Sikka P, Bindra VK, Kapoor S, Jain V, Saxena KK: Blue cures blue but be cautious. J Pharm Bioallied Sci. 2011 Oct;3(4):543-5. doi: 10.4103/0975-7406.90112. [PubMed:22219589 ]
  2. Provayblue™ (methylene blue) injection[package insert]. Shirley, New York: American Regent; 2016. [Link]

PMID: 20923853

Methylene blue

By

Methylene blue

Product: Zomepirac (sodium salt)

Identifier : DBSNPE002109
Drug : DB09241 (Methylene blue)
Interacting Gene/Enzyme : Glucose-6-phosphate 1-dehydrogenase
Gene Name : G6PD
UniProt ID : P11413
Defining Change(s) :

  • 1177C->G

Allele Name : Wisconsin
Genotype(s) : Not Available
Type(s) : ADR Inferred
Groups : G6PD deficiency
Description : Increased risk of hemolytic anemia or paradoxical methemoglobinemia.
References :

  1. Sikka P, Bindra VK, Kapoor S, Jain V, Saxena KK: Blue cures blue but be cautious. J Pharm Bioallied Sci. 2011 Oct;3(4):543-5. doi: 10.4103/0975-7406.90112. [PubMed:22219589 ]
  2. Provayblue™ (methylene blue) injection[package insert]. Shirley, New York: American Regent; 2016. [Link]

PMID: 22705340

Methylene blue

By

Methylene blue

Product: Ethacridine (lactate monohydrate)

Identifier : DBSNPE002110
Drug : DB09241 (Methylene blue)
Interacting Gene/Enzyme : Glucose-6-phosphate 1-dehydrogenase
Gene Name : G6PD
UniProt ID : P11413
Defining Change(s) :

  • 1178G->A

Allele Name : Nashville, Anaheim, Portici
Genotype(s) : Not Available
Type(s) : ADR Inferred
Groups : G6PD deficiency
Description : Increased risk of hemolytic anemia or paradoxical methemoglobinemia.
References :

  1. Sikka P, Bindra VK, Kapoor S, Jain V, Saxena KK: Blue cures blue but be cautious. J Pharm Bioallied Sci. 2011 Oct;3(4):543-5. doi: 10.4103/0975-7406.90112. [PubMed:22219589 ]
  2. Provayblue™ (methylene blue) injection[package insert]. Shirley, New York: American Regent; 2016. [Link]

PMID: 21927650

Methylene blue

By

Methylene blue

Product: Sulfacetamide (sodium monohydrate)

Identifier : DBSNPE002111
Drug : DB09241 (Methylene blue)
Interacting Gene/Enzyme : Glucose-6-phosphate 1-dehydrogenase
Gene Name : G6PD
UniProt ID : P11413
Defining Change(s) :

  • 1180G->C

Allele Name : Alhambra
Genotype(s) : Not Available
Type(s) : ADR Inferred
Groups : G6PD deficiency
Description : Increased risk of hemolytic anemia or paradoxical methemoglobinemia.
References :

  1. Sikka P, Bindra VK, Kapoor S, Jain V, Saxena KK: Blue cures blue but be cautious. J Pharm Bioallied Sci. 2011 Oct;3(4):543-5. doi: 10.4103/0975-7406.90112. [PubMed:22219589 ]
  2. Provayblue™ (methylene blue) injection[package insert]. Shirley, New York: American Regent; 2016. [Link]

PMID: 24074843

Methylene blue

By

Methylene blue

Product: Iproniazid (phosphate)

Identifier : DBSNPE002112
Drug : DB09241 (Methylene blue)
Interacting Gene/Enzyme : Glucose-6-phosphate 1-dehydrogenase
Gene Name : G6PD
UniProt ID : P11413
Defining Change(s) :

  • 1187C->T

Allele Name : Bari
Genotype(s) : Not Available
Type(s) : ADR Inferred
Groups : G6PD deficiency
Description : Increased risk of hemolytic anemia or paradoxical methemoglobinemia.
References :

  1. Sikka P, Bindra VK, Kapoor S, Jain V, Saxena KK: Blue cures blue but be cautious. J Pharm Bioallied Sci. 2011 Oct;3(4):543-5. doi: 10.4103/0975-7406.90112. [PubMed:22219589 ]
  2. Provayblue™ (methylene blue) injection[package insert]. Shirley, New York: American Regent; 2016. [Link]

PMID: 26157544

Methylene blue

By

Methylene blue

Product: Fexofenadine (hydrochloride)

Identifier : DBSNPE002113
Drug : DB09241 (Methylene blue)
Interacting Gene/Enzyme : Glucose-6-phosphate 1-dehydrogenase
Gene Name : G6PD
UniProt ID : P11413
Defining Change(s) :

  • 1192G->A

Allele Name : Puerto Limon
Genotype(s) : Not Available
Type(s) : ADR Inferred
Groups : G6PD deficiency
Description : Increased risk of hemolytic anemia or paradoxical methemoglobinemia.
References :

  1. Sikka P, Bindra VK, Kapoor S, Jain V, Saxena KK: Blue cures blue but be cautious. J Pharm Bioallied Sci. 2011 Oct;3(4):543-5. doi: 10.4103/0975-7406.90112. [PubMed:22219589 ]
  2. Provayblue™ (methylene blue) injection[package insert]. Shirley, New York: American Regent; 2016. [Link]

PMID: 25937172

Methylene blue

By

Methylene blue

Product: Ceftriaxone (sodium salt)

Identifier : DBSNPE002114
Drug : DB09241 (Methylene blue)
Interacting Gene/Enzyme : Glucose-6-phosphate 1-dehydrogenase
Gene Name : G6PD
UniProt ID : P11413
Defining Change(s) :

  • 1205C>A

Allele Name : Covao do Lobo
Genotype(s) : Not Available
Type(s) : ADR Inferred
Groups : G6PD deficiency
Description : Increased risk of hemolytic anemia or paradoxical methemoglobinemia.
References :

  1. Sikka P, Bindra VK, Kapoor S, Jain V, Saxena KK: Blue cures blue but be cautious. J Pharm Bioallied Sci. 2011 Oct;3(4):543-5. doi: 10.4103/0975-7406.90112. [PubMed:22219589 ]
  2. Provayblue™ (methylene blue) injection[package insert]. Shirley, New York: American Regent; 2016. [Link]

PMID: 23727046

Methylene blue

By

Methylene blue

Product: Ceftibuten (dihydrate)

Identifier : DBSNPE002115
Drug : DB09241 (Methylene blue)
Interacting Gene/Enzyme : Glucose-6-phosphate 1-dehydrogenase
Gene Name : G6PD
UniProt ID : P11413
Defining Change(s) :

  • 1215G->A

Allele Name : Clinic
Genotype(s) : Not Available
Type(s) : ADR Inferred
Groups : G6PD deficiency
Description : Increased risk of hemolytic anemia or paradoxical methemoglobinemia.
References :

  1. Sikka P, Bindra VK, Kapoor S, Jain V, Saxena KK: Blue cures blue but be cautious. J Pharm Bioallied Sci. 2011 Oct;3(4):543-5. doi: 10.4103/0975-7406.90112. [PubMed:22219589 ]
  2. Provayblue™ (methylene blue) injection[package insert]. Shirley, New York: American Regent; 2016. [Link]

PMID: 25137254

Methylene blue

By

Methylene blue

Product: Balsalazide (sodium hydrate)

Identifier : DBSNPE002116
Drug : DB09241 (Methylene blue)
Interacting Gene/Enzyme : Glucose-6-phosphate 1-dehydrogenase
Gene Name : G6PD
UniProt ID : P11413
Defining Change(s) :

  • 1225C->T

Allele Name : Udivecht
Genotype(s) : Not Available
Type(s) : ADR Inferred
Groups : G6PD deficiency
Description : Increased risk of hemolytic anemia or paradoxical methemoglobinemia.
References :

  1. Sikka P, Bindra VK, Kapoor S, Jain V, Saxena KK: Blue cures blue but be cautious. J Pharm Bioallied Sci. 2011 Oct;3(4):543-5. doi: 10.4103/0975-7406.90112. [PubMed:22219589 ]
  2. Provayblue™ (methylene blue) injection[package insert]. Shirley, New York: American Regent; 2016. [Link]

PMID: 16722652

Methylene blue

By

Methylene blue

Product: Almotriptan

Identifier : DBSNPE002117
Drug : DB09241 (Methylene blue)
Interacting Gene/Enzyme : Glucose-6-phosphate 1-dehydrogenase
Gene Name : G6PD
UniProt ID : P11413
Defining Change(s) :

  • 1226C->G

Allele Name : Suwalki
Genotype(s) : Not Available
Type(s) : ADR Inferred
Groups : G6PD deficiency
Description : Increased risk of hemolytic anemia or paradoxical methemoglobinemia.
References :

  1. Sikka P, Bindra VK, Kapoor S, Jain V, Saxena KK: Blue cures blue but be cautious. J Pharm Bioallied Sci. 2011 Oct;3(4):543-5. doi: 10.4103/0975-7406.90112. [PubMed:22219589 ]
  2. Provayblue™ (methylene blue) injection[package insert]. Shirley, New York: American Regent; 2016. [Link]

PMID: 19295507

Methylene blue

By

Methylene blue

Product: Methenolone (acetate)

Identifier : DBSNPE002118
Drug : DB09241 (Methylene blue)
Interacting Gene/Enzyme : Glucose-6-phosphate 1-dehydrogenase
Gene Name : G6PD
UniProt ID : P11413
Defining Change(s) :

  • 1228G->T

Allele Name : Riverside
Genotype(s) : Not Available
Type(s) : ADR Inferred
Groups : G6PD deficiency
Description : Increased risk of hemolytic anemia or paradoxical methemoglobinemia.
References :

  1. Sikka P, Bindra VK, Kapoor S, Jain V, Saxena KK: Blue cures blue but be cautious. J Pharm Bioallied Sci. 2011 Oct;3(4):543-5. doi: 10.4103/0975-7406.90112. [PubMed:22219589 ]
  2. Provayblue™ (methylene blue) injection[package insert]. Shirley, New York: American Regent; 2016. [Link]

PMID: 9682837

Methylene blue

By

Methylene blue

Product: Colistin (sulfate)

Identifier : DBSNPE002119
Drug : DB09241 (Methylene blue)
Interacting Gene/Enzyme : Glucose-6-phosphate 1-dehydrogenase
Gene Name : G6PD
UniProt ID : P11413
Defining Change(s) :

  • 1229G->A

Allele Name : Japan, Shinagawa
Genotype(s) : Not Available
Type(s) : ADR Inferred
Groups : G6PD deficiency
Description : Increased risk of hemolytic anemia or paradoxical methemoglobinemia.
References :

  1. Sikka P, Bindra VK, Kapoor S, Jain V, Saxena KK: Blue cures blue but be cautious. J Pharm Bioallied Sci. 2011 Oct;3(4):543-5. doi: 10.4103/0975-7406.90112. [PubMed:22219589 ]
  2. Provayblue™ (methylene blue) injection[package insert]. Shirley, New York: American Regent; 2016. [Link]

PMID: 9247969

Methylene blue

By

Methylene blue

Product: Pantoprazole (sodium hydrate)

Identifier : DBSNPE002120
Drug : DB09241 (Methylene blue)
Interacting Gene/Enzyme : Glucose-6-phosphate 1-dehydrogenase
Gene Name : G6PD
UniProt ID : P11413
Defining Change(s) :

  • 1229G->C

Allele Name : Kawasaki
Genotype(s) : Not Available
Type(s) : ADR Inferred
Groups : G6PD deficiency
Description : Increased risk of hemolytic anemia or paradoxical methemoglobinemia.
References :

  1. Sikka P, Bindra VK, Kapoor S, Jain V, Saxena KK: Blue cures blue but be cautious. J Pharm Bioallied Sci. 2011 Oct;3(4):543-5. doi: 10.4103/0975-7406.90112. [PubMed:22219589 ]
  2. Provayblue™ (methylene blue) injection[package insert]. Shirley, New York: American Regent; 2016. [Link]

PMID: 8008194

Methylene blue

By

Methylene blue

Product: Esomeprazole (potassium salt)

Identifier : DBSNPE002121
Drug : DB09241 (Methylene blue)
Interacting Gene/Enzyme : Glucose-6-phosphate 1-dehydrogenase
Gene Name : G6PD
UniProt ID : P11413
Defining Change(s) :

  • 1231A->G

Allele Name : Munich
Genotype(s) : Not Available
Type(s) : ADR Inferred
Groups : G6PD deficiency
Description : Increased risk of hemolytic anemia or paradoxical methemoglobinemia.
References :

  1. Sikka P, Bindra VK, Kapoor S, Jain V, Saxena KK: Blue cures blue but be cautious. J Pharm Bioallied Sci. 2011 Oct;3(4):543-5. doi: 10.4103/0975-7406.90112. [PubMed:22219589 ]
  2. Provayblue™ (methylene blue) injection[package insert]. Shirley, New York: American Regent; 2016. [Link]

PMID: 19446371

Methylene blue

By

Methylene blue

Product: SR9243

Identifier : DBSNPE002122
Drug : DB09241 (Methylene blue)
Interacting Gene/Enzyme : Glucose-6-phosphate 1-dehydrogenase
Gene Name : G6PD
UniProt ID : P11413
Defining Change(s) :

  • 1284C->A

Allele Name : Georgia
Genotype(s) : Not Available
Type(s) : ADR Inferred
Groups : G6PD deficiency
Description : Increased risk of hemolytic anemia or paradoxical methemoglobinemia.
References :

  1. Sikka P, Bindra VK, Kapoor S, Jain V, Saxena KK: Blue cures blue but be cautious. J Pharm Bioallied Sci. 2011 Oct;3(4):543-5. doi: 10.4103/0975-7406.90112. [PubMed:22219589 ]
  2. Provayblue™ (methylene blue) injection[package insert]. Shirley, New York: American Regent; 2016. [Link]

PMID: 18580579

Methylene blue

By

Methylene blue

Product: SW033291

Identifier : DBSNPE002123
Drug : DB09241 (Methylene blue)
Interacting Gene/Enzyme : Glucose-6-phosphate 1-dehydrogenase
Gene Name : G6PD
UniProt ID : P11413
Defining Change(s) :

  • 1292T->G

Allele Name : Sumare
Genotype(s) : Not Available
Type(s) : ADR Inferred
Groups : G6PD deficiency
Description : Increased risk of hemolytic anemia or paradoxical methemoglobinemia.
References :

  1. Sikka P, Bindra VK, Kapoor S, Jain V, Saxena KK: Blue cures blue but be cautious. J Pharm Bioallied Sci. 2011 Oct;3(4):543-5. doi: 10.4103/0975-7406.90112. [PubMed:22219589 ]
  2. Provayblue™ (methylene blue) injection[package insert]. Shirley, New York: American Regent; 2016. [Link]

PMID: 18796308

Methylene blue

By

Methylene blue

Product: TH287 (hydrochloride)

Identifier : DBSNPE002124
Drug : DB09241 (Methylene blue)
Interacting Gene/Enzyme : Glucose-6-phosphate 1-dehydrogenase
Gene Name : G6PD
UniProt ID : P11413
Defining Change(s) :

  • 1318C->T

Allele Name : Telti/Kobe
Genotype(s) : Not Available
Type(s) : ADR Inferred
Groups : G6PD deficiency
Description : Increased risk of hemolytic anemia or paradoxical methemoglobinemia.
References :

  1. Sikka P, Bindra VK, Kapoor S, Jain V, Saxena KK: Blue cures blue but be cautious. J Pharm Bioallied Sci. 2011 Oct;3(4):543-5. doi: 10.4103/0975-7406.90112. [PubMed:22219589 ]
  2. Provayblue™ (methylene blue) injection[package insert]. Shirley, New York: American Regent; 2016. [Link]

PMID: 16051282

Methylene blue

By

Methylene blue

Product: TH287

Identifier : DBSNPE002125
Drug : DB09241 (Methylene blue)
Interacting Gene/Enzyme : Glucose-6-phosphate 1-dehydrogenase
Gene Name : G6PD
UniProt ID : P11413
Defining Change(s) :

  • 1339G->A

Allele Name : Santiago de Cuba, Morioka
Genotype(s) : Not Available
Type(s) : ADR Inferred
Groups : G6PD deficiency
Description : Increased risk of hemolytic anemia or paradoxical methemoglobinemia.
References :

  1. Sikka P, Bindra VK, Kapoor S, Jain V, Saxena KK: Blue cures blue but be cautious. J Pharm Bioallied Sci. 2011 Oct;3(4):543-5. doi: 10.4103/0975-7406.90112. [PubMed:22219589 ]
  2. Provayblue™ (methylene blue) injection[package insert]. Shirley, New York: American Regent; 2016. [Link]

PMID: 1674587

Methylene blue

By

Methylene blue

Product: Anagliptin

Identifier : DBSNPE002126
Drug : DB09241 (Methylene blue)
Interacting Gene/Enzyme : Glucose-6-phosphate 1-dehydrogenase
Gene Name : G6PD
UniProt ID : P11413
Defining Change(s) :

  • 1358T->A

Allele Name : Harima
Genotype(s) : Not Available
Type(s) : ADR Inferred
Groups : G6PD deficiency
Description : Increased risk of hemolytic anemia or paradoxical methemoglobinemia.
References :

  1. Sikka P, Bindra VK, Kapoor S, Jain V, Saxena KK: Blue cures blue but be cautious. J Pharm Bioallied Sci. 2011 Oct;3(4):543-5. doi: 10.4103/0975-7406.90112. [PubMed:22219589 ]
  2. Provayblue™ (methylene blue) injection[package insert]. Shirley, New York: American Regent; 2016. [Link]

PMID: 1834473

Methylene blue

By

Methylene blue

Product: Clorgiline (hydrochloride)

Identifier : DBSNPE002127
Drug : DB09241 (Methylene blue)
Interacting Gene/Enzyme : Glucose-6-phosphate 1-dehydrogenase
Gene Name : G6PD
UniProt ID : P11413
Defining Change(s) :

  • 1366G->C

Allele Name : Figuera da Foz
Genotype(s) : Not Available
Type(s) : ADR Inferred
Groups : G6PD deficiency
Description : Increased risk of hemolytic anemia or paradoxical methemoglobinemia.
References :

  1. Sikka P, Bindra VK, Kapoor S, Jain V, Saxena KK: Blue cures blue but be cautious. J Pharm Bioallied Sci. 2011 Oct;3(4):543-5. doi: 10.4103/0975-7406.90112. [PubMed:22219589 ]
  2. Provayblue™ (methylene blue) injection[package insert]. Shirley, New York: American Regent; 2016. [Link]

PMID: 1975835

Methylene blue

By

Methylene blue

Product: Goserelin (acetate)

Identifier : DBSNPE002128
Drug : DB09241 (Methylene blue)
Interacting Gene/Enzyme : Glucose-6-phosphate 1-dehydrogenase
Gene Name : G6PD
UniProt ID : P11413
Defining Change(s) :

  • 1367A>T

Allele Name : Amiens
Genotype(s) : Not Available
Type(s) : ADR Inferred
Groups : G6PD deficiency
Description : Increased risk of hemolytic anemia or paradoxical methemoglobinemia.
References :

  1. Sikka P, Bindra VK, Kapoor S, Jain V, Saxena KK: Blue cures blue but be cautious. J Pharm Bioallied Sci. 2011 Oct;3(4):543-5. doi: 10.4103/0975-7406.90112. [PubMed:22219589 ]
  2. Provayblue™ (methylene blue) injection[package insert]. Shirley, New York: American Regent; 2016. [Link]

PMID: 18281903

Methylene blue

By

Methylene blue

Product: TH588 (hydrochloride)

Identifier : DBSNPE002129
Drug : DB09241 (Methylene blue)
Interacting Gene/Enzyme : Glucose-6-phosphate 1-dehydrogenase
Gene Name : G6PD
UniProt ID : P11413
Defining Change(s) :

  • 1376G->T, 1502T->G

Allele Name : Bangkok Noi
Genotype(s) : Not Available
Type(s) : ADR Inferred
Groups : G6PD deficiency
Description : Increased risk of hemolytic anemia or paradoxical methemoglobinemia.
References :

  1. Sikka P, Bindra VK, Kapoor S, Jain V, Saxena KK: Blue cures blue but be cautious. J Pharm Bioallied Sci. 2011 Oct;3(4):543-5. doi: 10.4103/0975-7406.90112. [PubMed:22219589 ]
  2. Provayblue™ (methylene blue) injection[package insert]. Shirley, New York: American Regent; 2016. [Link]

PMID: 8740453

Methylene blue

By

Methylene blue

Product: TH588

Identifier : DBSNPE002130
Drug : DB09241 (Methylene blue)
Interacting Gene/Enzyme : Glucose-6-phosphate 1-dehydrogenase
Gene Name : G6PD
UniProt ID : P11413
Defining Change(s) :

  • 1462G->A

Allele Name : Fukaya
Genotype(s) : Not Available
Type(s) : ADR Inferred
Groups : G6PD deficiency
Description : Increased risk of hemolytic anemia or paradoxical methemoglobinemia.
References :

  1. Sikka P, Bindra VK, Kapoor S, Jain V, Saxena KK: Blue cures blue but be cautious. J Pharm Bioallied Sci. 2011 Oct;3(4):543-5. doi: 10.4103/0975-7406.90112. [PubMed:22219589 ]
  2. Provayblue™ (methylene blue) injection[package insert]. Shirley, New York: American Regent; 2016. [Link]

PMID: 6546701

Methylene blue

By

Methylene blue

Product: Suramin (sodium salt)

Identifier : DBSNPE002131
Drug : DB09241 (Methylene blue)
Interacting Gene/Enzyme : Glucose-6-phosphate 1-dehydrogenase
Gene Name : G6PD
UniProt ID : P11413
Defining Change(s) :

  • 1463G->T

Allele Name : Campinas
Genotype(s) : Not Available
Type(s) : ADR Inferred
Groups : G6PD deficiency
Description : Increased risk of hemolytic anemia or paradoxical methemoglobinemia.
References :

  1. Sikka P, Bindra VK, Kapoor S, Jain V, Saxena KK: Blue cures blue but be cautious. J Pharm Bioallied Sci. 2011 Oct;3(4):543-5. doi: 10.4103/0975-7406.90112. [PubMed:22219589 ]
  2. Provayblue™ (methylene blue) injection[package insert]. Shirley, New York: American Regent; 2016. [Link]

PMID: 26601158

Methylene blue

By

Methylene blue

Product: 4-Nonylphenol polyethoxylate

Identifier : DBSNPE002132
Drug : DB09241 (Methylene blue)
Interacting Gene/Enzyme : Glucose-6-phosphate 1-dehydrogenase
Gene Name : G6PD
UniProt ID : P11413
Defining Change(s) :

  • 1465C>T

Allele Name : Buenos Aires
Genotype(s) : Not Available
Type(s) : ADR Inferred
Groups : G6PD deficiency
Description : Increased risk of hemolytic anemia or paradoxical methemoglobinemia.
References :

  1. Sikka P, Bindra VK, Kapoor S, Jain V, Saxena KK: Blue cures blue but be cautious. J Pharm Bioallied Sci. 2011 Oct;3(4):543-5. doi: 10.4103/0975-7406.90112. [PubMed:22219589 ]
  2. Provayblue™ (methylene blue) injection[package insert]. Shirley, New York: American Regent; 2016. [Link]

PMID: 23010798

Methylene blue

By

Methylene blue

Product: Permethrin

Identifier : DBSNPE002133
Drug : DB09241 (Methylene blue)
Interacting Gene/Enzyme : Glucose-6-phosphate 1-dehydrogenase
Gene Name : G6PD
UniProt ID : P11413
Defining Change(s) :

  • 1466C->T

Allele Name : Arakawa
Genotype(s) : Not Available
Type(s) : ADR Inferred
Groups : G6PD deficiency
Description : Increased risk of hemolytic anemia or paradoxical methemoglobinemia.
References :

  1. Sikka P, Bindra VK, Kapoor S, Jain V, Saxena KK: Blue cures blue but be cautious. J Pharm Bioallied Sci. 2011 Oct;3(4):543-5. doi: 10.4103/0975-7406.90112. [PubMed:22219589 ]
  2. Provayblue™ (methylene blue) injection[package insert]. Shirley, New York: American Regent; 2016. [Link]

PMID: 21093597

Methylene blue

By

Methylene blue

Product: Econazole

Identifier : DBSNPE002134
Drug : DB09241 (Methylene blue)
Interacting Gene/Enzyme : Glucose-6-phosphate 1-dehydrogenase
Gene Name : G6PD
UniProt ID : P11413
Defining Change(s) :

  • 1488_1490delGAA

Allele Name : Brighton
Genotype(s) : Not Available
Type(s) : ADR Inferred
Groups : G6PD deficiency
Description : Increased risk of hemolytic anemia or paradoxical methemoglobinemia.
References :

  1. Sikka P, Bindra VK, Kapoor S, Jain V, Saxena KK: Blue cures blue but be cautious. J Pharm Bioallied Sci. 2011 Oct;3(4):543-5. doi: 10.4103/0975-7406.90112. [PubMed:22219589 ]
  2. Provayblue™ (methylene blue) injection[package insert]. Shirley, New York: American Regent; 2016. [Link]

PMID: 27194588

Methylene blue

By

Methylene blue

Product: Minaprine (dihydrochloride)

Identifier : DBSNPE002135
Drug : DB09241 (Methylene blue)
Interacting Gene/Enzyme : Glucose-6-phosphate 1-dehydrogenase
Gene Name : G6PD
UniProt ID : P11413
Defining Change(s) :

  • 159G->C

Allele Name : Kozukata
Genotype(s) : Not Available
Type(s) : ADR Inferred
Groups : G6PD deficiency
Description : Increased risk of hemolytic anemia or paradoxical methemoglobinemia.
References :

  1. Sikka P, Bindra VK, Kapoor S, Jain V, Saxena KK: Blue cures blue but be cautious. J Pharm Bioallied Sci. 2011 Oct;3(4):543-5. doi: 10.4103/0975-7406.90112. [PubMed:22219589 ]
  2. Provayblue™ (methylene blue) injection[package insert]. Shirley, New York: American Regent; 2016. [Link]

PMID: 26461475

Methylene blue

By

Methylene blue

Product: Minaprine

Identifier : DBSNPE002136
Drug : DB09241 (Methylene blue)
Interacting Gene/Enzyme : Glucose-6-phosphate 1-dehydrogenase
Gene Name : G6PD
UniProt ID : P11413
Defining Change(s) :

  • 180_182delTCT

Allele Name : Amsterdam
Genotype(s) : Not Available
Type(s) : ADR Inferred
Groups : G6PD deficiency
Description : Increased risk of hemolytic anemia or paradoxical methemoglobinemia.
References :

  1. Sikka P, Bindra VK, Kapoor S, Jain V, Saxena KK: Blue cures blue but be cautious. J Pharm Bioallied Sci. 2011 Oct;3(4):543-5. doi: 10.4103/0975-7406.90112. [PubMed:22219589 ]
  2. Provayblue™ (methylene blue) injection[package insert]. Shirley, New York: American Regent; 2016. [Link]

PMID: 24991763

Methylene blue

By

Methylene blue

Product: Proflavine (hemisulfate)

Identifier : DBSNPE002137
Drug : DB09241 (Methylene blue)
Interacting Gene/Enzyme : Glucose-6-phosphate 1-dehydrogenase
Gene Name : G6PD
UniProt ID : P11413
Defining Change(s) :

  • 202G->A, 376A->G, 1264C>G

Allele Name : No name
Genotype(s) : Not Available
Type(s) : ADR Inferred
Groups : G6PD deficiency
Description : Increased risk of hemolytic anemia or paradoxical methemoglobinemia.
References :

  1. Sikka P, Bindra VK, Kapoor S, Jain V, Saxena KK: Blue cures blue but be cautious. J Pharm Bioallied Sci. 2011 Oct;3(4):543-5. doi: 10.4103/0975-7406.90112. [PubMed:22219589 ]
  2. Provayblue™ (methylene blue) injection[package insert]. Shirley, New York: American Regent; 2016. [Link]

PMID: 24723684

Methylene blue

By

Methylene blue

Product: Suramin

Identifier : DBSNPE002138
Drug : DB09241 (Methylene blue)
Interacting Gene/Enzyme : Glucose-6-phosphate 1-dehydrogenase
Gene Name : G6PD
UniProt ID : P11413
Defining Change(s) :

  • 224T->C

Allele Name : Swansea
Genotype(s) : Not Available
Type(s) : ADR Inferred
Groups : G6PD deficiency
Description : Increased risk of hemolytic anemia or paradoxical methemoglobinemia.
References :

  1. Sikka P, Bindra VK, Kapoor S, Jain V, Saxena KK: Blue cures blue but be cautious. J Pharm Bioallied Sci. 2011 Oct;3(4):543-5. doi: 10.4103/0975-7406.90112. [PubMed:22219589 ]
  2. Provayblue™ (methylene blue) injection[package insert]. Shirley, New York: American Regent; 2016. [Link]

PMID: 25354791

Methylene blue

By

Methylene blue

Product: Milbemycin oxime

Identifier : DBSNPE002139
Drug : DB09241 (Methylene blue)
Interacting Gene/Enzyme : Glucose-6-phosphate 1-dehydrogenase
Gene Name : G6PD
UniProt ID : P11413
Defining Change(s) :

  • 281_283delAGA

Allele Name : Urayasu
Genotype(s) : Not Available
Type(s) : ADR Inferred
Groups : G6PD deficiency
Description : Increased risk of hemolytic anemia or paradoxical methemoglobinemia.
References :

  1. Sikka P, Bindra VK, Kapoor S, Jain V, Saxena KK: Blue cures blue but be cautious. J Pharm Bioallied Sci. 2011 Oct;3(4):543-5. doi: 10.4103/0975-7406.90112. [PubMed:22219589 ]
  2. Provayblue™ (methylene blue) injection[package insert]. Shirley, New York: American Regent; 2016. [Link]

PMID: 24081304

Methylene blue

By

Methylene blue

Product: Pazufloxacin (mesylate)

Identifier : DBSNPE002140
Drug : DB09241 (Methylene blue)
Interacting Gene/Enzyme : Glucose-6-phosphate 1-dehydrogenase
Gene Name : G6PD
UniProt ID : P11413
Defining Change(s) :

  • 317C->G544C->T592C->T

Allele Name : Vancouver
Genotype(s) : Not Available
Type(s) : ADR Inferred
Groups : G6PD deficiency
Description : Increased risk of hemolytic anemia or paradoxical methemoglobinemia.
References :

  1. Sikka P, Bindra VK, Kapoor S, Jain V, Saxena KK: Blue cures blue but be cautious. J Pharm Bioallied Sci. 2011 Oct;3(4):543-5. doi: 10.4103/0975-7406.90112. [PubMed:22219589 ]
  2. Provayblue™ (methylene blue) injection[package insert]. Shirley, New York: American Regent; 2016. [Link]

PMID: 24614225

Methylene blue

By

Methylene blue

Product: Ceftriaxone (sodium hydrate)

Identifier : DBSNPE002141
Drug : DB09241 (Methylene blue)
Interacting Gene/Enzyme : Glucose-6-phosphate 1-dehydrogenase
Gene Name : G6PD
UniProt ID : P11413
Defining Change(s) :

  • 376A->G, 1159C->T

Allele Name : Mt Sinai
Genotype(s) : Not Available
Type(s) : ADR Inferred
Groups : G6PD deficiency
Description : Increased risk of hemolytic anemia or paradoxical methemoglobinemia.
References :

  1. Sikka P, Bindra VK, Kapoor S, Jain V, Saxena KK: Blue cures blue but be cautious. J Pharm Bioallied Sci. 2011 Oct;3(4):543-5. doi: 10.4103/0975-7406.90112. [PubMed:22219589 ]
  2. Provayblue™ (methylene blue) injection[package insert]. Shirley, New York: American Regent; 2016. [Link]

PMID: 24928390

Methylene blue

By

Methylene blue

Product: Azelaic acid

Identifier : DBSNPE002142
Drug : DB09241 (Methylene blue)
Interacting Gene/Enzyme : Glucose-6-phosphate 1-dehydrogenase
Gene Name : G6PD
UniProt ID : P11413
Defining Change(s) :

  • 488G->A

Allele Name : Plymouth
Genotype(s) : Not Available
Type(s) : ADR Inferred
Groups : G6PD deficiency
Description : Increased risk of hemolytic anemia or paradoxical methemoglobinemia.
References :

  1. Sikka P, Bindra VK, Kapoor S, Jain V, Saxena KK: Blue cures blue but be cautious. J Pharm Bioallied Sci. 2011 Oct;3(4):543-5. doi: 10.4103/0975-7406.90112. [PubMed:22219589 ]
  2. Provayblue™ (methylene blue) injection[package insert]. Shirley, New York: American Regent; 2016. [Link]

PMID: 23844184

Methylene blue

By

Methylene blue

Product: UK 14,304 (tartrate)

Identifier : DBSNPE002143
Drug : DB09241 (Methylene blue)
Interacting Gene/Enzyme : Glucose-6-phosphate 1-dehydrogenase
Gene Name : G6PD
UniProt ID : P11413
Defining Change(s) :

  • 514C->T

Allele Name : Volendam
Genotype(s) : Not Available
Type(s) : ADR Inferred
Groups : G6PD deficiency
Description : Increased risk of hemolytic anemia or paradoxical methemoglobinemia.
References :

  1. Sikka P, Bindra VK, Kapoor S, Jain V, Saxena KK: Blue cures blue but be cautious. J Pharm Bioallied Sci. 2011 Oct;3(4):543-5. doi: 10.4103/0975-7406.90112. [PubMed:22219589 ]
  2. Provayblue™ (methylene blue) injection[package insert]. Shirley, New York: American Regent; 2016. [Link]

PMID: 23072468

Methylene blue

By

Methylene blue

Product: Testosterone (undecanoate)

Identifier : DBSNPE002144
Drug : DB09241 (Methylene blue)
Interacting Gene/Enzyme : Glucose-6-phosphate 1-dehydrogenase
Gene Name : G6PD
UniProt ID : P11413
Defining Change(s) :

  • 527A->G

Allele Name : Shinshu
Genotype(s) : Not Available
Type(s) : ADR Inferred
Groups : G6PD deficiency
Description : Increased risk of hemolytic anemia or paradoxical methemoglobinemia.
References :

  1. Sikka P, Bindra VK, Kapoor S, Jain V, Saxena KK: Blue cures blue but be cautious. J Pharm Bioallied Sci. 2011 Oct;3(4):543-5. doi: 10.4103/0975-7406.90112. [PubMed:22219589 ]
  2. Provayblue™ (methylene blue) injection[package insert]. Shirley, New York: American Regent; 2016. [Link]

PMID: 24005302

Methylene blue

By

Methylene blue

Product: Mafenide (hydrochloride)

Identifier : DBSNPE002145
Drug : DB09241 (Methylene blue)
Interacting Gene/Enzyme : Glucose-6-phosphate 1-dehydrogenase
Gene Name : G6PD
UniProt ID : P11413
Defining Change(s) :

  • 535A->T

Allele Name : Chikugo
Genotype(s) : Not Available
Type(s) : ADR Inferred
Groups : G6PD deficiency
Description : Increased risk of hemolytic anemia or paradoxical methemoglobinemia.
References :

  1. Sikka P, Bindra VK, Kapoor S, Jain V, Saxena KK: Blue cures blue but be cautious. J Pharm Bioallied Sci. 2011 Oct;3(4):543-5. doi: 10.4103/0975-7406.90112. [PubMed:22219589 ]
  2. Provayblue™ (methylene blue) injection[package insert]. Shirley, New York: American Regent; 2016. [Link]

PMID: 23967245

Methylene blue

By

Methylene blue

Product: Levofloxacin (hydrate)

Identifier : DBSNPE002146
Drug : DB09241 (Methylene blue)
Interacting Gene/Enzyme : Glucose-6-phosphate 1-dehydrogenase
Gene Name : G6PD
UniProt ID : P11413
Defining Change(s) :

  • 561_563delCTC

Allele Name : Tsukui
Genotype(s) : Not Available
Type(s) : ADR Inferred
Groups : G6PD deficiency
Description : Increased risk of hemolytic anemia or paradoxical methemoglobinemia.
References :

  1. Sikka P, Bindra VK, Kapoor S, Jain V, Saxena KK: Blue cures blue but be cautious. J Pharm Bioallied Sci. 2011 Oct;3(4):543-5. doi: 10.4103/0975-7406.90112. [PubMed:22219589 ]
  2. Provayblue™ (methylene blue) injection[package insert]. Shirley, New York: American Regent; 2016. [Link]

PMID: 22804756

Methylene blue

By

Methylene blue

Product: L-(-)-α-Methyldopa (hydrate)

Identifier : DBSNPE002147
Drug : DB09241 (Methylene blue)
Interacting Gene/Enzyme : Glucose-6-phosphate 1-dehydrogenase
Gene Name : G6PD
UniProt ID : P11413
Defining Change(s) :

  • 573C>G

Allele Name : Pedoplis-Ckaro
Genotype(s) : Not Available
Type(s) : ADR Inferred
Groups : G6PD deficiency
Description : Increased risk of hemolytic anemia or paradoxical methemoglobinemia.
References :

  1. Sikka P, Bindra VK, Kapoor S, Jain V, Saxena KK: Blue cures blue but be cautious. J Pharm Bioallied Sci. 2011 Oct;3(4):543-5. doi: 10.4103/0975-7406.90112. [PubMed:22219589 ]
  2. Provayblue™ (methylene blue) injection[package insert]. Shirley, New York: American Regent; 2016. [Link]

PMID: 22686654

Methylene blue

By

Methylene blue

Product: Mexiletine (hydrochloride)

Identifier : DBSNPE002148
Drug : DB09241 (Methylene blue)
Interacting Gene/Enzyme : Glucose-6-phosphate 1-dehydrogenase
Gene Name : G6PD
UniProt ID : P11413
Defining Change(s) :

  • 593G->C

Allele Name : Santiago
Genotype(s) : Not Available
Type(s) : ADR Inferred
Groups : G6PD deficiency
Description : Increased risk of hemolytic anemia or paradoxical methemoglobinemia.
References :

  1. Sikka P, Bindra VK, Kapoor S, Jain V, Saxena KK: Blue cures blue but be cautious. J Pharm Bioallied Sci. 2011 Oct;3(4):543-5. doi: 10.4103/0975-7406.90112. [PubMed:22219589 ]
  2. Provayblue™ (methylene blue) injection[package insert]. Shirley, New York: American Regent; 2016. [Link]

PMID: 21982949

Methylene blue

By

Methylene blue

Product: Trimethadione

Identifier : DBSNPE002149
Drug : DB09241 (Methylene blue)
Interacting Gene/Enzyme : Glucose-6-phosphate 1-dehydrogenase
Gene Name : G6PD
UniProt ID : P11413
Defining Change(s) :

  • 637G->T

Allele Name : Minnesota, Marion, Gastonia, LeJeune
Genotype(s) : Not Available
Type(s) : ADR Inferred
Groups : G6PD deficiency
Description : Increased risk of hemolytic anemia or paradoxical methemoglobinemia.
References :

  1. Sikka P, Bindra VK, Kapoor S, Jain V, Saxena KK: Blue cures blue but be cautious. J Pharm Bioallied Sci. 2011 Oct;3(4):543-5. doi: 10.4103/0975-7406.90112. [PubMed:22219589 ]
  2. Provayblue™ (methylene blue) injection[package insert]. Shirley, New York: American Regent; 2016. [Link]

PMID: 22563445

Methylene blue

By

Methylene blue

Product: Pargyline (hydrochloride)

Identifier : DBSNPE002150
Drug : DB09241 (Methylene blue)
Interacting Gene/Enzyme : Glucose-6-phosphate 1-dehydrogenase
Gene Name : G6PD
UniProt ID : P11413
Defining Change(s) :

  • 637G->T, 1037A->T

Allele Name : Cincinnati
Genotype(s) : Not Available
Type(s) : ADR Inferred
Groups : G6PD deficiency
Description : Increased risk of hemolytic anemia or paradoxical methemoglobinemia.
References :

  1. Sikka P, Bindra VK, Kapoor S, Jain V, Saxena KK: Blue cures blue but be cautious. J Pharm Bioallied Sci. 2011 Oct;3(4):543-5. doi: 10.4103/0975-7406.90112. [PubMed:22219589 ]
  2. Provayblue™ (methylene blue) injection[package insert]. Shirley, New York: American Regent; 2016. [Link]

PMID: 21283568

Methylene blue

By

Methylene blue

Product: Nitrofurantoin

Identifier : DBSNPE002151
Drug : DB09241 (Methylene blue)
Interacting Gene/Enzyme : Glucose-6-phosphate 1-dehydrogenase
Gene Name : G6PD
UniProt ID : P11413
Defining Change(s) :

  • 648T->G

Allele Name : Harilaou
Genotype(s) : Not Available
Type(s) : ADR Inferred
Groups : G6PD deficiency
Description : Increased risk of hemolytic anemia or paradoxical methemoglobinemia.
References :

  1. Sikka P, Bindra VK, Kapoor S, Jain V, Saxena KK: Blue cures blue but be cautious. J Pharm Bioallied Sci. 2011 Oct;3(4):543-5. doi: 10.4103/0975-7406.90112. [PubMed:22219589 ]
  2. Provayblue™ (methylene blue) injection[package insert]. Shirley, New York: American Regent; 2016. [Link]

PMID: 21324129

Methylene blue

By

Methylene blue

Product: Netilmicin (sulfate)

Identifier : DBSNPE002152
Drug : DB09241 (Methylene blue)
Interacting Gene/Enzyme : Glucose-6-phosphate 1-dehydrogenase
Gene Name : G6PD
UniProt ID : P11413
Defining Change(s) :

  • 683_685delACA

Allele Name : North Dallas
Genotype(s) : Not Available
Type(s) : ADR Inferred
Groups : G6PD deficiency
Description : Increased risk of hemolytic anemia or paradoxical methemoglobinemia.
References :

  1. Sikka P, Bindra VK, Kapoor S, Jain V, Saxena KK: Blue cures blue but be cautious. J Pharm Bioallied Sci. 2011 Oct;3(4):543-5. doi: 10.4103/0975-7406.90112. [PubMed:22219589 ]
  2. Provayblue™ (methylene blue) injection[package insert]. Shirley, New York: American Regent; 2016. [Link]

PMID: 21804034

Methylene blue

By

Methylene blue

Product: Benzydamine (hydrochloride)

Identifier : DBSNPE002153
Drug : DB09241 (Methylene blue)
Interacting Gene/Enzyme : Glucose-6-phosphate 1-dehydrogenase
Gene Name : G6PD
UniProt ID : P11413
Defining Change(s) :

  • 695G->A

Allele Name : Asahikawa
Genotype(s) : Not Available
Type(s) : ADR Inferred
Groups : G6PD deficiency
Description : Increased risk of hemolytic anemia or paradoxical methemoglobinemia.
References :

  1. Sikka P, Bindra VK, Kapoor S, Jain V, Saxena KK: Blue cures blue but be cautious. J Pharm Bioallied Sci. 2011 Oct;3(4):543-5. doi: 10.4103/0975-7406.90112. [PubMed:22219589 ]
  2. Provayblue™ (methylene blue) injection[package insert]. Shirley, New York: American Regent; 2016. [Link]

PMID: 21736925

Methylene blue

By

Methylene blue

Product: Bambuterol (hydrochloride)

Identifier : DBSNPE002154
Drug : DB09241 (Methylene blue)
Interacting Gene/Enzyme : Glucose-6-phosphate 1-dehydrogenase
Gene Name : G6PD
UniProt ID : P11413
Defining Change(s) :

  • 713A->G

Allele Name : Durham
Genotype(s) : Not Available
Type(s) : ADR Inferred
Groups : G6PD deficiency
Description : Increased risk of hemolytic anemia or paradoxical methemoglobinemia.
References :

  1. Sikka P, Bindra VK, Kapoor S, Jain V, Saxena KK: Blue cures blue but be cautious. J Pharm Bioallied Sci. 2011 Oct;3(4):543-5. doi: 10.4103/0975-7406.90112. [PubMed:22219589 ]
  2. Provayblue™ (methylene blue) injection[package insert]. Shirley, New York: American Regent; 2016. [Link]

PMID: 19911010

Methylene blue

By

Methylene blue

Product: Metoclopramide (hydrochloride hydrate)

Identifier : DBSNPE002155
Drug : DB09241 (Methylene blue)
Interacting Gene/Enzyme : Glucose-6-phosphate 1-dehydrogenase
Gene Name : G6PD
UniProt ID : P11413
Defining Change(s) :

  • 724_729delGGCACT

Allele Name : Stonybrook
Genotype(s) : Not Available
Type(s) : ADR Inferred
Groups : G6PD deficiency
Description : Increased risk of hemolytic anemia or paradoxical methemoglobinemia.
References :

  1. Sikka P, Bindra VK, Kapoor S, Jain V, Saxena KK: Blue cures blue but be cautious. J Pharm Bioallied Sci. 2011 Oct;3(4):543-5. doi: 10.4103/0975-7406.90112. [PubMed:22219589 ]
  2. Provayblue™ (methylene blue) injection[package insert]. Shirley, New York: American Regent; 2016. [Link]

PMID: 20688809

Methylene blue

By

Methylene blue

Product: GW627368

Identifier : DBSNPE002156
Drug : DB09241 (Methylene blue)
Interacting Gene/Enzyme : Glucose-6-phosphate 1-dehydrogenase
Gene Name : G6PD
UniProt ID : P11413
Defining Change(s) :

  • 769C->G

Allele Name : Wayne
Genotype(s) : Not Available
Type(s) : ADR Inferred
Groups : G6PD deficiency
Description : Increased risk of hemolytic anemia or paradoxical methemoglobinemia.
References :

  1. Sikka P, Bindra VK, Kapoor S, Jain V, Saxena KK: Blue cures blue but be cautious. J Pharm Bioallied Sci. 2011 Oct;3(4):543-5. doi: 10.4103/0975-7406.90112. [PubMed:22219589 ]
  2. Provayblue™ (methylene blue) injection[package insert]. Shirley, New York: American Regent; 2016. [Link]

PMID: 18045921

Methylene blue

By

Methylene blue

Product: CEP dipeptide 1

Identifier : DBSNPE002157
Drug : DB09241 (Methylene blue)
Interacting Gene/Enzyme : Glucose-6-phosphate 1-dehydrogenase
Gene Name : G6PD
UniProt ID : P11413
Defining Change(s) :

  • 806G->A

Allele Name : Aveiro
Genotype(s) : Not Available
Type(s) : ADR Inferred
Groups : G6PD deficiency
Description : Increased risk of hemolytic anemia or paradoxical methemoglobinemia.
References :

  1. Sikka P, Bindra VK, Kapoor S, Jain V, Saxena KK: Blue cures blue but be cautious. J Pharm Bioallied Sci. 2011 Oct;3(4):543-5. doi: 10.4103/0975-7406.90112. [PubMed:22219589 ]
  2. Provayblue™ (methylene blue) injection[package insert]. Shirley, New York: American Regent; 2016. [Link]

PMID: 16815481

Methylene blue

By

Methylene blue

Product: NS6180

Identifier : DBSNPE002158
Drug : DB09241 (Methylene blue)
Interacting Gene/Enzyme : Glucose-6-phosphate 1-dehydrogenase
Gene Name : G6PD
UniProt ID : P11413
Defining Change(s) :

  • 820G->A

Allele Name : Cleveland Corum
Genotype(s) : Not Available
Type(s) : ADR Inferred
Groups : G6PD deficiency
Description : Increased risk of hemolytic anemia or paradoxical methemoglobinemia.
References :

  1. Sikka P, Bindra VK, Kapoor S, Jain V, Saxena KK: Blue cures blue but be cautious. J Pharm Bioallied Sci. 2011 Oct;3(4):543-5. doi: 10.4103/0975-7406.90112. [PubMed:22219589 ]
  2. Provayblue™ (methylene blue) injection[package insert]. Shirley, New York: American Regent; 2016. [Link]

PMID: 15821750

Methylene blue

By

Methylene blue

Product: U-104

Identifier : DBSNPE002159
Drug : DB09241 (Methylene blue)
Interacting Gene/Enzyme : Glucose-6-phosphate 1-dehydrogenase
Gene Name : G6PD
UniProt ID : P11413
Defining Change(s) :

  • 821A>T

Allele Name : Lille
Genotype(s) : Not Available
Type(s) : ADR Inferred
Groups : G6PD deficiency
Description : Increased risk of hemolytic anemia or paradoxical methemoglobinemia.
References :

  1. Sikka P, Bindra VK, Kapoor S, Jain V, Saxena KK: Blue cures blue but be cautious. J Pharm Bioallied Sci. 2011 Oct;3(4):543-5. doi: 10.4103/0975-7406.90112. [PubMed:22219589 ]
  2. Provayblue™ (methylene blue) injection[package insert]. Shirley, New York: American Regent; 2016. [Link]

PMID: 15843606

Methylene blue

By

Methylene blue

Product: Chromafenozide

Identifier : DBSNPE002160
Drug : DB09241 (Methylene blue)
Interacting Gene/Enzyme : Glucose-6-phosphate 1-dehydrogenase
Gene Name : G6PD
UniProt ID : P11413
Defining Change(s) :

  • 825G>C

Allele Name : Bangkok
Genotype(s) : Not Available
Type(s) : ADR Inferred
Groups : G6PD deficiency
Description : Increased risk of hemolytic anemia or paradoxical methemoglobinemia.
References :

  1. Sikka P, Bindra VK, Kapoor S, Jain V, Saxena KK: Blue cures blue but be cautious. J Pharm Bioallied Sci. 2011 Oct;3(4):543-5. doi: 10.4103/0975-7406.90112. [PubMed:22219589 ]
  2. Provayblue™ (methylene blue) injection[package insert]. Shirley, New York: American Regent; 2016. [Link]

PMID: 15269258

Methylene blue

By

Methylene blue

Product: Furilazole

Identifier : DBSNPE002161
Drug : DB09241 (Methylene blue)
Interacting Gene/Enzyme : Glucose-6-phosphate 1-dehydrogenase
Gene Name : G6PD
UniProt ID : P11413
Defining Change(s) :

  • 826C->T

Allele Name : Sugao
Genotype(s) : Not Available
Type(s) : ADR Inferred
Groups : G6PD deficiency
Description : Increased risk of hemolytic anemia or paradoxical methemoglobinemia.
References :

  1. Sikka P, Bindra VK, Kapoor S, Jain V, Saxena KK: Blue cures blue but be cautious. J Pharm Bioallied Sci. 2011 Oct;3(4):543-5. doi: 10.4103/0975-7406.90112. [PubMed:22219589 ]
  2. Provayblue™ (methylene blue) injection[package insert]. Shirley, New York: American Regent; 2016. [Link]

PMID: 14523241

Methylene blue

By

Methylene blue

Product: Methasulfocarb

Identifier : DBSNPE002162
Drug : DB09241 (Methylene blue)
Interacting Gene/Enzyme : Glucose-6-phosphate 1-dehydrogenase
Gene Name : G6PD
UniProt ID : P11413
Defining Change(s) :

  • 832T->C

Allele Name : La Jolla
Genotype(s) : Not Available
Type(s) : ADR Inferred
Groups : G6PD deficiency
Description : Increased risk of hemolytic anemia or paradoxical methemoglobinemia.
References :

  1. Sikka P, Bindra VK, Kapoor S, Jain V, Saxena KK: Blue cures blue but be cautious. J Pharm Bioallied Sci. 2011 Oct;3(4):543-5. doi: 10.4103/0975-7406.90112. [PubMed:22219589 ]
  2. Provayblue™ (methylene blue) injection[package insert]. Shirley, New York: American Regent; 2016. [Link]

PMID: 11090117

Methylene blue

By

Methylene blue

Product: AMG-47a

Identifier : DBSNPE002163
Drug : DB09241 (Methylene blue)
Interacting Gene/Enzyme : Glucose-6-phosphate 1-dehydrogenase
Gene Name : G6PD
UniProt ID : P11413
Defining Change(s) :

  • 833C->T

Allele Name : Wexham
Genotype(s) : Not Available
Type(s) : ADR Inferred
Groups : G6PD deficiency
Description : Increased risk of hemolytic anemia or paradoxical methemoglobinemia.
References :

  1. Sikka P, Bindra VK, Kapoor S, Jain V, Saxena KK: Blue cures blue but be cautious. J Pharm Bioallied Sci. 2011 Oct;3(4):543-5. doi: 10.4103/0975-7406.90112. [PubMed:22219589 ]
  2. Provayblue™ (methylene blue) injection[package insert]. Shirley, New York: American Regent; 2016. [Link]

PMID: 1676371

Methylene blue

By

Methylene blue

Product: MK-6096

Identifier : DBSNPE002164
Drug : DB09241 (Methylene blue)
Interacting Gene/Enzyme : Glucose-6-phosphate 1-dehydrogenase
Gene Name : G6PD
UniProt ID : P11413
Defining Change(s) :

  • 851T>C

Allele Name : Piodivkow
Genotype(s) : Not Available
Type(s) : ADR Inferred
Groups : G6PD deficiency
Description : Increased risk of hemolytic anemia or paradoxical methemoglobinemia.
References :

  1. Sikka P, Bindra VK, Kapoor S, Jain V, Saxena KK: Blue cures blue but be cautious. J Pharm Bioallied Sci. 2011 Oct;3(4):543-5. doi: 10.4103/0975-7406.90112. [PubMed:22219589 ]
  2. Provayblue™ (methylene blue) injection[package insert]. Shirley, New York: American Regent; 2016. [Link]

PMID: 6268428

Methylene blue

By

Methylene blue

Product: SC144 (hydrochloride)

Identifier : DBSNPE002165
Drug : DB09241 (Methylene blue)
Interacting Gene/Enzyme : Glucose-6-phosphate 1-dehydrogenase
Gene Name : G6PD
UniProt ID : P11413
Defining Change(s) :

  • 910G->T

Allele Name : West Virginia
Genotype(s) : Not Available
Type(s) : ADR Inferred
Groups : G6PD deficiency
Description : Increased risk of hemolytic anemia or paradoxical methemoglobinemia.
References :

  1. Sikka P, Bindra VK, Kapoor S, Jain V, Saxena KK: Blue cures blue but be cautious. J Pharm Bioallied Sci. 2011 Oct;3(4):543-5. doi: 10.4103/0975-7406.90112. [PubMed:22219589 ]
  2. Provayblue™ (methylene blue) injection[package insert]. Shirley, New York: American Regent; 2016. [Link]

PMID: 8575516

Methylene blue

By

Methylene blue

Product: SC144

Identifier : DBSNPE002166
Drug : DB09241 (Methylene blue)
Interacting Gene/Enzyme : Glucose-6-phosphate 1-dehydrogenase
Gene Name : G6PD
UniProt ID : P11413
Defining Change(s) :

  • 921G->C

Allele Name : Omiya
Genotype(s) : Not Available
Type(s) : ADR Inferred
Groups : G6PD deficiency
Description : Increased risk of hemolytic anemia or paradoxical methemoglobinemia.
References :

  1. Sikka P, Bindra VK, Kapoor S, Jain V, Saxena KK: Blue cures blue but be cautious. J Pharm Bioallied Sci. 2011 Oct;3(4):543-5. doi: 10.4103/0975-7406.90112. [PubMed:22219589 ]
  2. Provayblue™ (methylene blue) injection[package insert]. Shirley, New York: American Regent; 2016. [Link]

PMID: 7543185

Methylene blue

By

Methylene blue

Product: RSV604

Identifier : DBSNPE002167
Drug : DB09241 (Methylene blue)
Interacting Gene/Enzyme : Glucose-6-phosphate 1-dehydrogenase
Gene Name : G6PD
UniProt ID : P11413
Defining Change(s) :

  • 953_976delCCACCAAAGGGTACCTGGAC GACC

Allele Name : Nara
Genotype(s) : Not Available
Type(s) : ADR Inferred
Groups : G6PD deficiency
Description : Increased risk of hemolytic anemia or paradoxical methemoglobinemia.
References :

  1. Sikka P, Bindra VK, Kapoor S, Jain V, Saxena KK: Blue cures blue but be cautious. J Pharm Bioallied Sci. 2011 Oct;3(4):543-5. doi: 10.4103/0975-7406.90112. [PubMed:22219589 ]
  2. Provayblue™ (methylene blue) injection[package insert]. Shirley, New York: American Regent; 2016. [Link]

PMID: 1686860

Methylene blue

By

Methylene blue

Product: Schisantherin E

Identifier : DBSNPE002168
Drug : DB09241 (Methylene blue)
Interacting Gene/Enzyme : Glucose-6-phosphate 1-dehydrogenase
Gene Name : G6PD
UniProt ID : P11413
Defining Change(s) :

  • 962G->A

Allele Name : Manhattan
Genotype(s) : Not Available
Type(s) : ADR Inferred
Groups : G6PD deficiency
Description : Increased risk of hemolytic anemia or paradoxical methemoglobinemia.
References :

  1. Sikka P, Bindra VK, Kapoor S, Jain V, Saxena KK: Blue cures blue but be cautious. J Pharm Bioallied Sci. 2011 Oct;3(4):543-5. doi: 10.4103/0975-7406.90112. [PubMed:22219589 ]
  2. Provayblue™ (methylene blue) injection[package insert]. Shirley, New York: American Regent; 2016. [Link]

PMID: 15996549

Methylene blue

By

Methylene blue

Product: Schisanhenol

Identifier : DBSNPE002170
Drug : DB09241 (Methylene blue)
Interacting Gene/Enzyme : Glucose-6-phosphate 1-dehydrogenase
Gene Name : G6PD
UniProt ID : P11413
Defining Change(s) :

  • 99A->G
  • 1360C->T

Allele Name : Honiara
Genotype(s) : Not Available
Type(s) : ADR Inferred
Groups : G6PD deficiency
Description : Increased risk of hemolytic anemia or paradoxical methemoglobinemia.
References :

  1. Sikka P, Bindra VK, Kapoor S, Jain V, Saxena KK: Blue cures blue but be cautious. J Pharm Bioallied Sci. 2011 Oct;3(4):543-5. doi: 10.4103/0975-7406.90112. [PubMed:22219589 ]
  2. Provayblue™ (methylene blue) injection[package insert]. Shirley, New York: American Regent; 2016. [Link]

PMID: 2158004

Methylene blue

By

Methylene blue

Product: Gomisin G

Identifier : DBSNPE002171
Drug : DB09241 (Methylene blue)
Interacting Gene/Enzyme : Glucose-6-phosphate 1-dehydrogenase
Gene Name : G6PD
UniProt ID : P11413
Defining Change(s) :

  • 1246G->A

Allele Name : Tokyo, Fukushima
Genotype(s) : Not Available
Type(s) : ADR Inferred
Groups : G6PD deficiency
Description : Increased risk of hemolytic anemia or paradoxical methemoglobinemia.
References :

  1. Sikka P, Bindra VK, Kapoor S, Jain V, Saxena KK: Blue cures blue but be cautious. J Pharm Bioallied Sci. 2011 Oct;3(4):543-5. doi: 10.4103/0975-7406.90112. [PubMed:22219589 ]
  2. Provayblue™ (methylene blue) injection[package insert]. Shirley, New York: American Regent; 2016. [Link]

PMID: 2542048

Methylene blue

By

Methylene blue

Product: Betaine (hydrochloride)

Identifier : DBSNPE002172
Drug : DB09241 (Methylene blue)
Interacting Gene/Enzyme : Glucose-6-phosphate 1-dehydrogenase
Gene Name : G6PD
UniProt ID : P11413
Defining Change(s) :

  • 1003G->A

Allele Name : Chatham
Genotype(s) : Not Available
Type(s) : ADR Inferred
Groups : G6PD deficiency
Description : Increased risk of hemolytic anemia or paradoxical methemoglobinemia.
References :

  1. Sikka P, Bindra VK, Kapoor S, Jain V, Saxena KK: Blue cures blue but be cautious. J Pharm Bioallied Sci. 2011 Oct;3(4):543-5. doi: 10.4103/0975-7406.90112. [PubMed:22219589 ]
  2. Provayblue™ (methylene blue) injection[package insert]. Shirley, New York: American Regent; 2016. [Link]

PMID: 26041915

Methylene blue

By

Methylene blue

Product: Hydroxyprogesterone caproate

Identifier : DBSNPE002173
Drug : DB09241 (Methylene blue)
Interacting Gene/Enzyme : Glucose-6-phosphate 1-dehydrogenase
Gene Name : G6PD
UniProt ID : P11413
Defining Change(s) :

  • 1004C->A

Allele Name : Fushan
Genotype(s) : Not Available
Type(s) : ADR Inferred
Groups : G6PD deficiency
Description : Increased risk of hemolytic anemia or paradoxical methemoglobinemia.
References :

  1. Sikka P, Bindra VK, Kapoor S, Jain V, Saxena KK: Blue cures blue but be cautious. J Pharm Bioallied Sci. 2011 Oct;3(4):543-5. doi: 10.4103/0975-7406.90112. [PubMed:22219589 ]
  2. Provayblue™ (methylene blue) injection[package insert]. Shirley, New York: American Regent; 2016. [Link]

PMID: 26492372

Methylene blue

By

Methylene blue

Product: Levobupivacaine (hydrochloride)

Identifier : DBSNPE002174
Drug : DB09241 (Methylene blue)
Interacting Gene/Enzyme : Glucose-6-phosphate 1-dehydrogenase
Gene Name : G6PD
UniProt ID : P11413
Defining Change(s) :

  • 1052G->T

Allele Name : Partenope
Genotype(s) : Not Available
Type(s) : ADR Inferred
Groups : G6PD deficiency
Description : Increased risk of hemolytic anemia or paradoxical methemoglobinemia.
References :

  1. Sikka P, Bindra VK, Kapoor S, Jain V, Saxena KK: Blue cures blue but be cautious. J Pharm Bioallied Sci. 2011 Oct;3(4):543-5. doi: 10.4103/0975-7406.90112. [PubMed:22219589 ]
  2. Provayblue™ (methylene blue) injection[package insert]. Shirley, New York: American Regent; 2016. [Link]

PMID: 25827910

Methylene blue

By

Methylene blue

Product: Cefotaxime (sodium salt)

Identifier : DBSNPE002175
Drug : DB09241 (Methylene blue)
Interacting Gene/Enzyme : Glucose-6-phosphate 1-dehydrogenase
Gene Name : G6PD
UniProt ID : P11413
Defining Change(s) :

  • 1057C->T

Allele Name : Ierapediva
Genotype(s) : Not Available
Type(s) : ADR Inferred
Groups : G6PD deficiency
Description : Increased risk of hemolytic anemia or paradoxical methemoglobinemia.
References :

  1. Sikka P, Bindra VK, Kapoor S, Jain V, Saxena KK: Blue cures blue but be cautious. J Pharm Bioallied Sci. 2011 Oct;3(4):543-5. doi: 10.4103/0975-7406.90112. [PubMed:22219589 ]
  2. Provayblue™ (methylene blue) injection[package insert]. Shirley, New York: American Regent; 2016. [Link]

PMID: 25904785

Methylene blue

By

Methylene blue

Product: 4-(Benzyloxy)phenol

Identifier : DBSNPE002176
Drug : DB09241 (Methylene blue)
Interacting Gene/Enzyme : Glucose-6-phosphate 1-dehydrogenase
Gene Name : G6PD
UniProt ID : P11413
Defining Change(s) :

  • 1193A->G

Allele Name : Anadia
Genotype(s) : Not Available
Type(s) : ADR Inferred
Groups : G6PD deficiency
Description : Increased risk of hemolytic anemia or paradoxical methemoglobinemia.
References :

  1. Sikka P, Bindra VK, Kapoor S, Jain V, Saxena KK: Blue cures blue but be cautious. J Pharm Bioallied Sci. 2011 Oct;3(4):543-5. doi: 10.4103/0975-7406.90112. [PubMed:22219589 ]
  2. Provayblue™ (methylene blue) injection[package insert]. Shirley, New York: American Regent; 2016. [Link]

PMID: 26659605

Methylene blue

By

Methylene blue

Product: CDDO-Im

Identifier : DBSNPE002177
Drug : DB09241 (Methylene blue)
Interacting Gene/Enzyme : Glucose-6-phosphate 1-dehydrogenase
Gene Name : G6PD
UniProt ID : P11413
Defining Change(s) :

  • 1220A->C

Allele Name : Abeno
Genotype(s) : Not Available
Type(s) : ADR Inferred
Groups : G6PD deficiency
Description : Increased risk of hemolytic anemia or paradoxical methemoglobinemia.
References :

  1. Sikka P, Bindra VK, Kapoor S, Jain V, Saxena KK: Blue cures blue but be cautious. J Pharm Bioallied Sci. 2011 Oct;3(4):543-5. doi: 10.4103/0975-7406.90112. [PubMed:22219589 ]
  2. Provayblue™ (methylene blue) injection[package insert]. Shirley, New York: American Regent; 2016. [Link]

PMID: 22703994

Methylene blue

By

Methylene blue

Product: TAK-960 (hydrochloride)

Identifier : DBSNPE002178
Drug : DB09241 (Methylene blue)
Interacting Gene/Enzyme : Glucose-6-phosphate 1-dehydrogenase
Gene Name : G6PD
UniProt ID : P11413
Defining Change(s) :

  • 1291G->A

Allele Name : Surabaya
Genotype(s) : Not Available
Type(s) : ADR Inferred
Groups : G6PD deficiency
Description : Increased risk of hemolytic anemia or paradoxical methemoglobinemia.
References :

  1. Sikka P, Bindra VK, Kapoor S, Jain V, Saxena KK: Blue cures blue but be cautious. J Pharm Bioallied Sci. 2011 Oct;3(4):543-5. doi: 10.4103/0975-7406.90112. [PubMed:22219589 ]
  2. Provayblue™ (methylene blue) injection[package insert]. Shirley, New York: American Regent; 2016. [Link]

PMID: 22341316

Methylene blue

By

Methylene blue

Product: TAK-960

Identifier : DBSNPE002179
Drug : DB09241 (Methylene blue)
Interacting Gene/Enzyme : Glucose-6-phosphate 1-dehydrogenase
Gene Name : G6PD
UniProt ID : P11413
Defining Change(s) :

  • 1316G->C

Allele Name : Pawnee
Genotype(s) : Not Available
Type(s) : ADR Inferred
Groups : G6PD deficiency
Description : Increased risk of hemolytic anemia or paradoxical methemoglobinemia.
References :

  1. Sikka P, Bindra VK, Kapoor S, Jain V, Saxena KK: Blue cures blue but be cautious. J Pharm Bioallied Sci. 2011 Oct;3(4):543-5. doi: 10.4103/0975-7406.90112. [PubMed:22219589 ]
  2. Provayblue™ (methylene blue) injection[package insert]. Shirley, New York: American Regent; 2016. [Link]

PMID: 21697378

Methylene blue

By

Methylene blue

Product: Nalfurafine (hydrochloride)

Identifier : DBSNPE002180
Drug : DB09241 (Methylene blue)
Interacting Gene/Enzyme : Glucose-6-phosphate 1-dehydrogenase
Gene Name : G6PD
UniProt ID : P11413
Defining Change(s) :

  • 1342A->G

Allele Name : S. Antioco
Genotype(s) : Not Available
Type(s) : ADR Inferred
Groups : G6PD deficiency
Description : Increased risk of hemolytic anemia or paradoxical methemoglobinemia.
References :

  1. Sikka P, Bindra VK, Kapoor S, Jain V, Saxena KK: Blue cures blue but be cautious. J Pharm Bioallied Sci. 2011 Oct;3(4):543-5. doi: 10.4103/0975-7406.90112. [PubMed:22219589 ]
  2. Provayblue™ (methylene blue) injection[package insert]. Shirley, New York: American Regent; 2016. [Link]

PMID: 21198977

Methylene blue

By

Methylene blue

Product: Nalfurafine

Identifier : DBSNPE002181
Drug : DB09241 (Methylene blue)
Interacting Gene/Enzyme : Glucose-6-phosphate 1-dehydrogenase
Gene Name : G6PD
UniProt ID : P11413
Defining Change(s) :

  • 1347G->C

Allele Name : Cassano
Genotype(s) : Not Available
Type(s) : ADR Inferred
Groups : G6PD deficiency
Description : Increased risk of hemolytic anemia or paradoxical methemoglobinemia.
References :

  1. Sikka P, Bindra VK, Kapoor S, Jain V, Saxena KK: Blue cures blue but be cautious. J Pharm Bioallied Sci. 2011 Oct;3(4):543-5. doi: 10.4103/0975-7406.90112. [PubMed:22219589 ]
  2. Provayblue™ (methylene blue) injection[package insert]. Shirley, New York: American Regent; 2016. [Link]

PMID: 19968761

Methylene blue

By

Methylene blue

Product: Harringtonine

Identifier : DBSNPE002182
Drug : DB09241 (Methylene blue)
Interacting Gene/Enzyme : Glucose-6-phosphate 1-dehydrogenase
Gene Name : G6PD
UniProt ID : P11413
Defining Change(s) :

  • 1347G->C
  • 1360C->T

Allele Name : Hermoupolis
Genotype(s) : Not Available
Type(s) : ADR Inferred
Groups : G6PD deficiency
Description : Increased risk of hemolytic anemia or paradoxical methemoglobinemia.
References :

  1. Sikka P, Bindra VK, Kapoor S, Jain V, Saxena KK: Blue cures blue but be cautious. J Pharm Bioallied Sci. 2011 Oct;3(4):543-5. doi: 10.4103/0975-7406.90112. [PubMed:22219589 ]
  2. Provayblue™ (methylene blue) injection[package insert]. Shirley, New York: American Regent; 2016. [Link]

PMID: 20011099

Methylene blue

By

Methylene blue

Product: Mupirocin

Identifier : DBSNPE002183
Drug : DB09241 (Methylene blue)
Interacting Gene/Enzyme : Glucose-6-phosphate 1-dehydrogenase
Gene Name : G6PD
UniProt ID : P11413
Defining Change(s) :

  • 1360C->T

Allele Name : Union,Maewo, Chinese-2, Kalo
Genotype(s) : Not Available
Type(s) : ADR Inferred
Groups : G6PD deficiency
Description : Increased risk of hemolytic anemia or paradoxical methemoglobinemia.
References :

  1. Sikka P, Bindra VK, Kapoor S, Jain V, Saxena KK: Blue cures blue but be cautious. J Pharm Bioallied Sci. 2011 Oct;3(4):543-5. doi: 10.4103/0975-7406.90112. [PubMed:22219589 ]
  2. Provayblue™ (methylene blue) injection[package insert]. Shirley, New York: American Regent; 2016. [Link]

PMID: 16452252

Methylene blue

By

Methylene blue

Product: Hexahydrocurcumin

Identifier : DBSNPE002184
Drug : DB09241 (Methylene blue)
Interacting Gene/Enzyme : Glucose-6-phosphate 1-dehydrogenase
Gene Name : G6PD
UniProt ID : P11413
Defining Change(s) :

  • 1361G->A

Allele Name : Andalus
Genotype(s) : Not Available
Type(s) : ADR Inferred
Groups : G6PD deficiency
Description : Increased risk of hemolytic anemia or paradoxical methemoglobinemia.
References :

  1. Sikka P, Bindra VK, Kapoor S, Jain V, Saxena KK: Blue cures blue but be cautious. J Pharm Bioallied Sci. 2011 Oct;3(4):543-5. doi: 10.4103/0975-7406.90112. [PubMed:22219589 ]
  2. Provayblue™ (methylene blue) injection[package insert]. Shirley, New York: American Regent; 2016. [Link]

PMID: 16307610

Methylene blue

By

Methylene blue

Product: Ajugol

Identifier : DBSNPE002185
Drug : DB09241 (Methylene blue)
Interacting Gene/Enzyme : Glucose-6-phosphate 1-dehydrogenase
Gene Name : G6PD
UniProt ID : P11413
Defining Change(s) :

  • 1376G->C

Allele Name : Cosenza
Genotype(s) : Not Available
Type(s) : ADR Inferred
Groups : G6PD deficiency
Description : Increased risk of hemolytic anemia or paradoxical methemoglobinemia.
References :

  1. Sikka P, Bindra VK, Kapoor S, Jain V, Saxena KK: Blue cures blue but be cautious. J Pharm Bioallied Sci. 2011 Oct;3(4):543-5. doi: 10.4103/0975-7406.90112. [PubMed:22219589 ]
  2. Provayblue™ (methylene blue) injection[package insert]. Shirley, New York: American Regent; 2016. [Link]

PMID: 15448144

Methylene blue

By

Methylene blue

Product: Manninotriose

Identifier : DBSNPE002186
Drug : DB09241 (Methylene blue)
Interacting Gene/Enzyme : Glucose-6-phosphate 1-dehydrogenase
Gene Name : G6PD
UniProt ID : P11413
Defining Change(s) :

  • 1376G->T

Allele Name : Canton, Taiwan- Hakka, Gifu-like, Agrigento-like
Genotype(s) : Not Available
Type(s) : ADR Inferred
Groups : G6PD deficiency
Description : Increased risk of hemolytic anemia or paradoxical methemoglobinemia.
References :

  1. Sikka P, Bindra VK, Kapoor S, Jain V, Saxena KK: Blue cures blue but be cautious. J Pharm Bioallied Sci. 2011 Oct;3(4):543-5. doi: 10.4103/0975-7406.90112. [PubMed:22219589 ]
  2. Provayblue™ (methylene blue) injection[package insert]. Shirley, New York: American Regent; 2016. [Link]

PMID: 9641557

Methylene blue

By

Methylene blue

Product: Rehmannioside D

Identifier : DBSNPE002187
Drug : DB09241 (Methylene blue)
Interacting Gene/Enzyme : Glucose-6-phosphate 1-dehydrogenase
Gene Name : G6PD
UniProt ID : P11413
Defining Change(s) :

  • 1387C->A

Allele Name : Flores
Genotype(s) : Not Available
Type(s) : ADR Inferred
Groups : G6PD deficiency
Description : Increased risk of hemolytic anemia or paradoxical methemoglobinemia.
References :

  1. Sikka P, Bindra VK, Kapoor S, Jain V, Saxena KK: Blue cures blue but be cautious. J Pharm Bioallied Sci. 2011 Oct;3(4):543-5. doi: 10.4103/0975-7406.90112. [PubMed:22219589 ]
  2. Provayblue™ (methylene blue) injection[package insert]. Shirley, New York: American Regent; 2016. [Link]

PMID: 7532812

Methylene blue

By

Methylene blue

Product: Rehmannioside A

Identifier : DBSNPE002188
Drug : DB09241 (Methylene blue)
Interacting Gene/Enzyme : Glucose-6-phosphate 1-dehydrogenase
Gene Name : G6PD
UniProt ID : P11413
Defining Change(s) :

  • 1388G->A

Allele Name : Kaiping, Anant, Dhon, Sapporo-like, Wosera
Genotype(s) : Not Available
Type(s) : ADR Inferred
Groups : G6PD deficiency
Description : Increased risk of hemolytic anemia or paradoxical methemoglobinemia.
References :

  1. Sikka P, Bindra VK, Kapoor S, Jain V, Saxena KK: Blue cures blue but be cautious. J Pharm Bioallied Sci. 2011 Oct;3(4):543-5. doi: 10.4103/0975-7406.90112. [PubMed:22219589 ]
  2. Provayblue™ (methylene blue) injection[package insert]. Shirley, New York: American Regent; 2016. [Link]

PMID: 2155812

Methylene blue

By

Methylene blue

Product: Ingenol-3,4,5,20-diacetonide

Identifier : DBSNPE002189
Drug : DB09241 (Methylene blue)
Interacting Gene/Enzyme : Glucose-6-phosphate 1-dehydrogenase
Gene Name : G6PD
UniProt ID : P11413
Defining Change(s) :

  • 169C->T

Allele Name : Kamogawa
Genotype(s) : Not Available
Type(s) : ADR Inferred
Groups : G6PD deficiency
Description : Increased risk of hemolytic anemia or paradoxical methemoglobinemia.
References :

  1. Sikka P, Bindra VK, Kapoor S, Jain V, Saxena KK: Blue cures blue but be cautious. J Pharm Bioallied Sci. 2011 Oct;3(4):543-5. doi: 10.4103/0975-7406.90112. [PubMed:22219589 ]
  2. Provayblue™ (methylene blue) injection[package insert]. Shirley, New York: American Regent; 2016. [Link]

PMID: 10884477

Methylene blue

By

Methylene blue

Product: Notoginsenoside Ft1

Identifier : DBSNPE002190
Drug : DB09241 (Methylene blue)
Interacting Gene/Enzyme : Glucose-6-phosphate 1-dehydrogenase
Gene Name : G6PD
UniProt ID : P11413
Defining Change(s) :

  • 179T>C

Allele Name : Costanzo
Genotype(s) : Not Available
Type(s) : ADR Inferred
Groups : G6PD deficiency
Description : Increased risk of hemolytic anemia or paradoxical methemoglobinemia.
References :

  1. Sikka P, Bindra VK, Kapoor S, Jain V, Saxena KK: Blue cures blue but be cautious. J Pharm Bioallied Sci. 2011 Oct;3(4):543-5. doi: 10.4103/0975-7406.90112. [PubMed:22219589 ]
  2. Provayblue™ (methylene blue) injection[package insert]. Shirley, New York: American Regent; 2016. [Link]

PMID: 8295213

Methylene blue

By

Methylene blue

Product: Notoginsenoside R2

Identifier : DBSNPE002191
Drug : DB09241 (Methylene blue)
Interacting Gene/Enzyme : Glucose-6-phosphate 1-dehydrogenase
Gene Name : G6PD
UniProt ID : P11413
Defining Change(s) :

  • 185C->A

Allele Name : Amazonia
Genotype(s) : Not Available
Type(s) : ADR Inferred
Groups : G6PD deficiency
Description : Increased risk of hemolytic anemia or paradoxical methemoglobinemia.
References :

  1. Sikka P, Bindra VK, Kapoor S, Jain V, Saxena KK: Blue cures blue but be cautious. J Pharm Bioallied Sci. 2011 Oct;3(4):543-5. doi: 10.4103/0975-7406.90112. [PubMed:22219589 ]
  2. Provayblue™ (methylene blue) injection[package insert]. Shirley, New York: American Regent; 2016. [Link]

PMID: 1671593

Methylene blue

By

Methylene blue

Product: Ginsenoside Rg5

Identifier : DBSNPE002192
Drug : DB09241 (Methylene blue)
Interacting Gene/Enzyme : Glucose-6-phosphate 1-dehydrogenase
Gene Name : G6PD
UniProt ID : P11413
Defining Change(s) :

  • 196T->A

Allele Name : Songklanagarind
Genotype(s) : Not Available
Type(s) : ADR Inferred
Groups : G6PD deficiency
Description : Increased risk of hemolytic anemia or paradoxical methemoglobinemia.
References :

  1. Sikka P, Bindra VK, Kapoor S, Jain V, Saxena KK: Blue cures blue but be cautious. J Pharm Bioallied Sci. 2011 Oct;3(4):543-5. doi: 10.4103/0975-7406.90112. [PubMed:22219589 ]
  2. Provayblue™ (methylene blue) injection[package insert]. Shirley, New York: American Regent; 2016. [Link]

PMID: 1972895

Methylene blue

By

Methylene blue

Product: Ginsenoside Rg6

Identifier : DBSNPE002193
Drug : DB09241 (Methylene blue)
Interacting Gene/Enzyme : Glucose-6-phosphate 1-dehydrogenase
Gene Name : G6PD
UniProt ID : P11413
Defining Change(s) :

  • 202G->A
  • 871G->A

Allele Name : Hechi
Genotype(s) : Not Available
Type(s) : ADR Inferred
Groups : G6PD deficiency
Description : Increased risk of hemolytic anemia or paradoxical methemoglobinemia.
References :

  1. Sikka P, Bindra VK, Kapoor S, Jain V, Saxena KK: Blue cures blue but be cautious. J Pharm Bioallied Sci. 2011 Oct;3(4):543-5. doi: 10.4103/0975-7406.90112. [PubMed:22219589 ]
  2. Provayblue™ (methylene blue) injection[package insert]. Shirley, New York: American Regent; 2016. [Link]

PMID: 1976098

Methylene blue

By

Methylene blue

Product: Ginsenoside Rk3

Identifier : DBSNPE002194
Drug : DB09241 (Methylene blue)
Interacting Gene/Enzyme : Glucose-6-phosphate 1-dehydrogenase
Gene Name : G6PD
UniProt ID : P11413
Defining Change(s) :

  • 208T->C

Allele Name : Namouru
Genotype(s) : Not Available
Type(s) : ADR Inferred
Groups : G6PD deficiency
Description : Increased risk of hemolytic anemia or paradoxical methemoglobinemia.
References :

  1. Sikka P, Bindra VK, Kapoor S, Jain V, Saxena KK: Blue cures blue but be cautious. J Pharm Bioallied Sci. 2011 Oct;3(4):543-5. doi: 10.4103/0975-7406.90112. [PubMed:22219589 ]
  2. Provayblue™ (methylene blue) injection[package insert]. Shirley, New York: American Regent; 2016. [Link]

PMID: 25749097

Methylene blue

By

Methylene blue

Product: Desacetylcinobufotalin

Identifier : DBSNPE002195
Drug : DB09241 (Methylene blue)
Interacting Gene/Enzyme : Glucose-6-phosphate 1-dehydrogenase
Gene Name : G6PD
UniProt ID : P11413
Defining Change(s) :

  • 352T>C

Allele Name : Bao Loc
Genotype(s) : Not Available
Type(s) : ADR Inferred
Groups : G6PD deficiency
Description : Increased risk of hemolytic anemia or paradoxical methemoglobinemia.
References :

  1. Sikka P, Bindra VK, Kapoor S, Jain V, Saxena KK: Blue cures blue but be cautious. J Pharm Bioallied Sci. 2011 Oct;3(4):543-5. doi: 10.4103/0975-7406.90112. [PubMed:22219589 ]
  2. Provayblue™ (methylene blue) injection[package insert]. Shirley, New York: American Regent; 2016. [Link]

PMID: 10027090

Methylene blue

By

Methylene blue

Product: Desacetylcinobufagin

Identifier : DBSNPE002196
Drug : DB09241 (Methylene blue)
Interacting Gene/Enzyme : Glucose-6-phosphate 1-dehydrogenase
Gene Name : G6PD
UniProt ID : P11413
Defining Change(s) :

  • 375G->T, 379G->T383T->C384C>T

Allele Name : Crispim
Genotype(s) : Not Available
Type(s) : ADR Inferred
Groups : G6PD deficiency
Description : Increased risk of hemolytic anemia or paradoxical methemoglobinemia.
References :

  1. Sikka P, Bindra VK, Kapoor S, Jain V, Saxena KK: Blue cures blue but be cautious. J Pharm Bioallied Sci. 2011 Oct;3(4):543-5. doi: 10.4103/0975-7406.90112. [PubMed:22219589 ]
  2. Provayblue™ (methylene blue) injection[package insert]. Shirley, New York: American Regent; 2016. [Link]

PMID: 22308372

Methylene blue

By

Methylene blue

Product: Ingenol-5,20-acetonide-3-O-angelate

Identifier : DBSNPE002197
Drug : DB09241 (Methylene blue)
Interacting Gene/Enzyme : Glucose-6-phosphate 1-dehydrogenase
Gene Name : G6PD
UniProt ID : P11413
Defining Change(s) :

  • 376A->G
  • 463C->G

Allele Name : Acrokorinthos
Genotype(s) : Not Available
Type(s) : ADR Inferred
Groups : G6PD deficiency
Description : Increased risk of hemolytic anemia or paradoxical methemoglobinemia.
References :

  1. Sikka P, Bindra VK, Kapoor S, Jain V, Saxena KK: Blue cures blue but be cautious. J Pharm Bioallied Sci. 2011 Oct;3(4):543-5. doi: 10.4103/0975-7406.90112. [PubMed:22219589 ]
  2. Provayblue™ (methylene blue) injection[package insert]. Shirley, New York: American Regent; 2016. [Link]

PMID: 10636248

Methylene blue

By

Methylene blue

Product: Ingenol-5,20-acetonide

Identifier : DBSNPE002198
Drug : DB09241 (Methylene blue)
Interacting Gene/Enzyme : Glucose-6-phosphate 1-dehydrogenase
Gene Name : G6PD
UniProt ID : P11413
Defining Change(s) :

  • 376A->G
  • 542A->T

Allele Name : Santa Maria
Genotype(s) : Not Available
Type(s) : ADR Inferred
Groups : G6PD deficiency
Description : Increased risk of hemolytic anemia or paradoxical methemoglobinemia.
References :

  1. Sikka P, Bindra VK, Kapoor S, Jain V, Saxena KK: Blue cures blue but be cautious. J Pharm Bioallied Sci. 2011 Oct;3(4):543-5. doi: 10.4103/0975-7406.90112. [PubMed:22219589 ]
  2. Provayblue™ (methylene blue) injection[package insert]. Shirley, New York: American Regent; 2016. [Link]

PMID: 10021939

Methylene blue

By

Methylene blue

Product: 20-O-Acetylingenol-3-angelate

Identifier : DBSNPE002199
Drug : DB09241 (Methylene blue)
Interacting Gene/Enzyme : Glucose-6-phosphate 1-dehydrogenase
Gene Name : G6PD
UniProt ID : P11413
Defining Change(s) :

  • 376A->G
  • 871G->A

Allele Name : Ananindeua
Genotype(s) : Not Available
Type(s) : ADR Inferred
Groups : G6PD deficiency
Description : Increased risk of hemolytic anemia or paradoxical methemoglobinemia.
References :

  1. Sikka P, Bindra VK, Kapoor S, Jain V, Saxena KK: Blue cures blue but be cautious. J Pharm Bioallied Sci. 2011 Oct;3(4):543-5. doi: 10.4103/0975-7406.90112. [PubMed:22219589 ]
  2. Provayblue™ (methylene blue) injection[package insert]. Shirley, New York: American Regent; 2016. [Link]

PMID: 9223571

Methylene blue

By

Methylene blue

Product: Dodecanoic acid ingenol ester

Identifier : DBSNPE002200
Drug : DB09241 (Methylene blue)
Interacting Gene/Enzyme : Glucose-6-phosphate 1-dehydrogenase
Gene Name : G6PD
UniProt ID : P11413
Defining Change(s) :

  • 383T->C

Allele Name : Vanua Lava
Genotype(s) : Not Available
Type(s) : ADR Inferred
Groups : G6PD deficiency
Description : Increased risk of hemolytic anemia or paradoxical methemoglobinemia.
References :

  1. Sikka P, Bindra VK, Kapoor S, Jain V, Saxena KK: Blue cures blue but be cautious. J Pharm Bioallied Sci. 2011 Oct;3(4):543-5. doi: 10.4103/0975-7406.90112. [PubMed:22219589 ]
  2. Provayblue™ (methylene blue) injection[package insert]. Shirley, New York: American Regent; 2016. [Link]

PMID: 8021913

Methylene blue

By

Methylene blue

Product: 20-Deoxyingenol

Identifier : DBSNPE002201
Drug : DB09241 (Methylene blue)
Interacting Gene/Enzyme : Glucose-6-phosphate 1-dehydrogenase
Gene Name : G6PD
UniProt ID : P11413
Defining Change(s) :

  • 406C->T

Allele Name : Valladolid
Genotype(s) : Not Available
Type(s) : ADR Inferred
Groups : G6PD deficiency
Description : Increased risk of hemolytic anemia or paradoxical methemoglobinemia.
References :

  1. Sikka P, Bindra VK, Kapoor S, Jain V, Saxena KK: Blue cures blue but be cautious. J Pharm Bioallied Sci. 2011 Oct;3(4):543-5. doi: 10.4103/0975-7406.90112. [PubMed:22219589 ]
  2. Provayblue™ (methylene blue) injection[package insert]. Shirley, New York: American Regent; 2016. [Link]

PMID: 7673380

Methylene blue

By

Methylene blue

Product: Macranthoidin B

Identifier : DBSNPE002202
Drug : DB09241 (Methylene blue)
Interacting Gene/Enzyme : Glucose-6-phosphate 1-dehydrogenase
Gene Name : G6PD
UniProt ID : P11413
Defining Change(s) :

  • 409C->T

Allele Name : Belem
Genotype(s) : Not Available
Type(s) : ADR Inferred
Groups : G6PD deficiency
Description : Increased risk of hemolytic anemia or paradoxical methemoglobinemia.
References :

  1. Sikka P, Bindra VK, Kapoor S, Jain V, Saxena KK: Blue cures blue but be cautious. J Pharm Bioallied Sci. 2011 Oct;3(4):543-5. doi: 10.4103/0975-7406.90112. [PubMed:22219589 ]
  2. Provayblue™ (methylene blue) injection[package insert]. Shirley, New York: American Regent; 2016. [Link]

PMID: 2547931

Methylene blue

By

Methylene blue

Product: Methyl protodioscin

Identifier : DBSNPE002203
Drug : DB09241 (Methylene blue)
Interacting Gene/Enzyme : Glucose-6-phosphate 1-dehydrogenase
Gene Name : G6PD
UniProt ID : P11413
Defining Change(s) :

  • 442G->A

Allele Name : Liuzhou
Genotype(s) : Not Available
Type(s) : ADR Inferred
Groups : G6PD deficiency
Description : Increased risk of hemolytic anemia or paradoxical methemoglobinemia.
References :

  1. Sikka P, Bindra VK, Kapoor S, Jain V, Saxena KK: Blue cures blue but be cautious. J Pharm Bioallied Sci. 2011 Oct;3(4):543-5. doi: 10.4103/0975-7406.90112. [PubMed:22219589 ]
  2. Provayblue™ (methylene blue) injection[package insert]. Shirley, New York: American Regent; 2016. [Link]

PMID: 2899170

Methylene blue

By

Methylene blue

Product: Bisoctrizole

Identifier : DBSNPE002204
Drug : DB09241 (Methylene blue)
Interacting Gene/Enzyme : Glucose-6-phosphate 1-dehydrogenase
Gene Name : G6PD
UniProt ID : P11413
Defining Change(s) :

  • 473G>A

Allele Name : Shenzen
Genotype(s) : Not Available
Type(s) : ADR Inferred
Groups : G6PD deficiency
Description : Increased risk of hemolytic anemia or paradoxical methemoglobinemia.
References :

  1. Sikka P, Bindra VK, Kapoor S, Jain V, Saxena KK: Blue cures blue but be cautious. J Pharm Bioallied Sci. 2011 Oct;3(4):543-5. doi: 10.4103/0975-7406.90112. [PubMed:22219589 ]
  2. Provayblue™ (methylene blue) injection[package insert]. Shirley, New York: American Regent; 2016. [Link]

PMID: 22952988

Methylene blue

By

Methylene blue

Product: Pardoprunox

Identifier : DBSNPE002205
Drug : DB09241 (Methylene blue)
Interacting Gene/Enzyme : Glucose-6-phosphate 1-dehydrogenase
Gene Name : G6PD
UniProt ID : P11413
Defining Change(s) :

  • 493A->G

Allele Name : Taipei “Chinese- 3”
Genotype(s) : Not Available
Type(s) : ADR Inferred
Groups : G6PD deficiency
Description : Increased risk of hemolytic anemia or paradoxical methemoglobinemia.
References :

  1. Sikka P, Bindra VK, Kapoor S, Jain V, Saxena KK: Blue cures blue but be cautious. J Pharm Bioallied Sci. 2011 Oct;3(4):543-5. doi: 10.4103/0975-7406.90112. [PubMed:22219589 ]
  2. Provayblue™ (methylene blue) injection[package insert]. Shirley, New York: American Regent; 2016. [Link]

PMID: 16314856

Methylene blue

By

Methylene blue

Product: Cyclo(-RGDfK)

Identifier : DBSNPE002206
Drug : DB09241 (Methylene blue)
Interacting Gene/Enzyme : Glucose-6-phosphate 1-dehydrogenase
Gene Name : G6PD
UniProt ID : P11413
Defining Change(s) :

  • 496C>T

Allele Name : Toledo
Genotype(s) : Not Available
Type(s) : ADR Inferred
Groups : G6PD deficiency
Description : Increased risk of hemolytic anemia or paradoxical methemoglobinemia.
References :

  1. Sikka P, Bindra VK, Kapoor S, Jain V, Saxena KK: Blue cures blue but be cautious. J Pharm Bioallied Sci. 2011 Oct;3(4):543-5. doi: 10.4103/0975-7406.90112. [PubMed:22219589 ]
  2. Provayblue™ (methylene blue) injection[package insert]. Shirley, New York: American Regent; 2016. [Link]

PMID: 8941386

Methylene blue

By

Methylene blue

Product: pGlu-Pro-Arg-MNA

Identifier : DBSNPE002207
Drug : DB09241 (Methylene blue)
Interacting Gene/Enzyme : Glucose-6-phosphate 1-dehydrogenase
Gene Name : G6PD
UniProt ID : P11413
Defining Change(s) :

  • 497G->A

Allele Name : Naone
Genotype(s) : Not Available
Type(s) : ADR Inferred
Groups : G6PD deficiency
Description : Increased risk of hemolytic anemia or paradoxical methemoglobinemia.
References :

  1. Sikka P, Bindra VK, Kapoor S, Jain V, Saxena KK: Blue cures blue but be cautious. J Pharm Bioallied Sci. 2011 Oct;3(4):543-5. doi: 10.4103/0975-7406.90112. [PubMed:22219589 ]
  2. Provayblue™ (methylene blue) injection[package insert]. Shirley, New York: American Regent; 2016. [Link]

PMID: 8788956

Methylene blue

By

Methylene blue

Product: D-Lys(Z)-Pro-Arg-pNA

Identifier : DBSNPE002208
Drug : DB09241 (Methylene blue)
Interacting Gene/Enzyme : Glucose-6-phosphate 1-dehydrogenase
Gene Name : G6PD
UniProt ID : P11413
Defining Change(s) :

  • 517T->C

Allele Name : Nankang
Genotype(s) : Not Available
Type(s) : ADR Inferred
Groups : G6PD deficiency
Description : Increased risk of hemolytic anemia or paradoxical methemoglobinemia.
References :

  1. Sikka P, Bindra VK, Kapoor S, Jain V, Saxena KK: Blue cures blue but be cautious. J Pharm Bioallied Sci. 2011 Oct;3(4):543-5. doi: 10.4103/0975-7406.90112. [PubMed:22219589 ]
  2. Provayblue™ (methylene blue) injection[package insert]. Shirley, New York: American Regent; 2016. [Link]

PMID: 12604092

Methylene blue

By

Methylene blue

Product: Tos-Gly-Pro-Arg-ANBA-IPA

Identifier : DBSNPE002209
Drug : DB09241 (Methylene blue)
Interacting Gene/Enzyme : Glucose-6-phosphate 1-dehydrogenase
Gene Name : G6PD
UniProt ID : P11413
Defining Change(s) :

  • 519C->G

Allele Name : Miaoli
Genotype(s) : Not Available
Type(s) : ADR Inferred
Groups : G6PD deficiency
Description : Increased risk of hemolytic anemia or paradoxical methemoglobinemia.
References :

  1. Sikka P, Bindra VK, Kapoor S, Jain V, Saxena KK: Blue cures blue but be cautious. J Pharm Bioallied Sci. 2011 Oct;3(4):543-5. doi: 10.4103/0975-7406.90112. [PubMed:22219589 ]
  2. Provayblue™ (methylene blue) injection[package insert]. Shirley, New York: American Regent; 2016. [Link]

PMID: 12183650

Methylene blue

By

Methylene blue

Product: Z-Gly-Gly-Arg-AMC

Identifier : DBSNPE002210
Drug : DB09241 (Methylene blue)
Interacting Gene/Enzyme : Glucose-6-phosphate 1-dehydrogenase
Gene Name : G6PD
UniProt ID : P11413
Defining Change(s) :

  • 563C->T

Allele Name : Mediterranean, Dallas, Panama‚ Sassari, Cagliari, Birmingham
Genotype(s) : Not Available
Type(s) : ADR Inferred
Groups : G6PD deficiency
Description : Increased risk of hemolytic anemia or paradoxical methemoglobinemia.
References :

  1. Sikka P, Bindra VK, Kapoor S, Jain V, Saxena KK: Blue cures blue but be cautious. J Pharm Bioallied Sci. 2011 Oct;3(4):543-5. doi: 10.4103/0975-7406.90112. [PubMed:22219589 ]
  2. Provayblue™ (methylene blue) injection[package insert]. Shirley, New York: American Regent; 2016. [Link]

PMID: 10425109

Methylene blue

By

Methylene blue

Product: Pepstatin

Identifier : DBSNPE002211
Drug : DB09241 (Methylene blue)
Interacting Gene/Enzyme : Glucose-6-phosphate 1-dehydrogenase
Gene Name : G6PD
UniProt ID : P11413
Defining Change(s) :

  • 592C->T

Allele Name : Coimbra Shunde
Genotype(s) : Not Available
Type(s) : ADR Inferred
Groups : G6PD deficiency
Description : Increased risk of hemolytic anemia or paradoxical methemoglobinemia.
References :

  1. Sikka P, Bindra VK, Kapoor S, Jain V, Saxena KK: Blue cures blue but be cautious. J Pharm Bioallied Sci. 2011 Oct;3(4):543-5. doi: 10.4103/0975-7406.90112. [PubMed:22219589 ]
  2. Provayblue™ (methylene blue) injection[package insert]. Shirley, New York: American Regent; 2016. [Link]

PMID: 25450957

Methylene blue

By

Methylene blue

Product: (-)-Isocorypalmine

Identifier : DBSNPE002212
Drug : DB09241 (Methylene blue)
Interacting Gene/Enzyme : Glucose-6-phosphate 1-dehydrogenase
Gene Name : G6PD
UniProt ID : P11413
Defining Change(s) :

  • 593G>A

Allele Name : Nilgiri
Genotype(s) : Not Available
Type(s) : ADR Inferred
Groups : G6PD deficiency
Description : Increased risk of hemolytic anemia or paradoxical methemoglobinemia.
References :

  1. Sikka P, Bindra VK, Kapoor S, Jain V, Saxena KK: Blue cures blue but be cautious. J Pharm Bioallied Sci. 2011 Oct;3(4):543-5. doi: 10.4103/0975-7406.90112. [PubMed:22219589 ]
  2. Provayblue™ (methylene blue) injection[package insert]. Shirley, New York: American Regent; 2016. [Link]

PMID: 18632800

Methylene blue

By

Methylene blue

Product: Columbamine

Identifier : DBSNPE002213
Drug : DB09241 (Methylene blue)
Interacting Gene/Enzyme : Glucose-6-phosphate 1-dehydrogenase
Gene Name : G6PD
UniProt ID : P11413
Defining Change(s) :

  • 679C->T

Allele Name : Radlowo
Genotype(s) : Not Available
Type(s) : ADR Inferred
Groups : G6PD deficiency
Description : Increased risk of hemolytic anemia or paradoxical methemoglobinemia.
References :

  1. Sikka P, Bindra VK, Kapoor S, Jain V, Saxena KK: Blue cures blue but be cautious. J Pharm Bioallied Sci. 2011 Oct;3(4):543-5. doi: 10.4103/0975-7406.90112. [PubMed:22219589 ]
  2. Provayblue™ (methylene blue) injection[package insert]. Shirley, New York: American Regent; 2016. [Link]

PMID: 10633160

Methylene blue

By

Methylene blue

Product: Tetrahydroberberine

Identifier : DBSNPE002215
Drug : DB09241 (Methylene blue)
Interacting Gene/Enzyme : Glucose-6-phosphate 1-dehydrogenase
Gene Name : G6PD
UniProt ID : P11413
Defining Change(s) :

  • 835A->G

Allele Name : Haikou
Genotype(s) : Not Available
Type(s) : ADR Inferred
Groups : G6PD deficiency
Description : Increased risk of hemolytic anemia or paradoxical methemoglobinemia.
References :

  1. Sikka P, Bindra VK, Kapoor S, Jain V, Saxena KK: Blue cures blue but be cautious. J Pharm Bioallied Sci. 2011 Oct;3(4):543-5. doi: 10.4103/0975-7406.90112. [PubMed:22219589 ]
  2. Provayblue™ (methylene blue) injection[package insert]. Shirley, New York: American Regent; 2016. [Link]

PMID: 10953056

Methylene blue

By

Methylene blue

Product: Tetrahydrocoptisine

Identifier : DBSNPE002216
Drug : DB09241 (Methylene blue)
Interacting Gene/Enzyme : Glucose-6-phosphate 1-dehydrogenase
Gene Name : G6PD
UniProt ID : P11413
Defining Change(s) :

  • 835A->T

Allele Name : Chinese-1
Genotype(s) : Not Available
Type(s) : ADR Inferred
Groups : G6PD deficiency
Description : Increased risk of hemolytic anemia or paradoxical methemoglobinemia.
References :

  1. Sikka P, Bindra VK, Kapoor S, Jain V, Saxena KK: Blue cures blue but be cautious. J Pharm Bioallied Sci. 2011 Oct;3(4):543-5. doi: 10.4103/0975-7406.90112. [PubMed:22219589 ]
  2. Provayblue™ (methylene blue) injection[package insert]. Shirley, New York: American Regent; 2016. [Link]

PMID: 10871336

Methylene blue

By

Methylene blue

Product: Corydaline

Identifier : DBSNPE002217
Drug : DB09241 (Methylene blue)
Interacting Gene/Enzyme : Glucose-6-phosphate 1-dehydrogenase
Gene Name : G6PD
UniProt ID : P11413
Defining Change(s) :

  • 848A>G

Allele Name : Mizushima
Genotype(s) : Not Available
Type(s) : ADR Inferred
Groups : G6PD deficiency
Description : Increased risk of hemolytic anemia or paradoxical methemoglobinemia.
References :

  1. Sikka P, Bindra VK, Kapoor S, Jain V, Saxena KK: Blue cures blue but be cautious. J Pharm Bioallied Sci. 2011 Oct;3(4):543-5. doi: 10.4103/0975-7406.90112. [PubMed:22219589 ]
  2. Provayblue™ (methylene blue) injection[package insert]. Shirley, New York: American Regent; 2016. [Link]

PMID: 11335724

Methylene blue

By

Methylene blue

Product: Methysticin

Identifier : DBSNPE002218
Drug : DB09241 (Methylene blue)
Interacting Gene/Enzyme : Glucose-6-phosphate 1-dehydrogenase
Gene Name : G6PD
UniProt ID : P11413
Defining Change(s) :

  • 853C->T

Allele Name : Osaka
Genotype(s) : Not Available
Type(s) : ADR Inferred
Groups : G6PD deficiency
Description : Increased risk of hemolytic anemia or paradoxical methemoglobinemia.
References :

  1. Sikka P, Bindra VK, Kapoor S, Jain V, Saxena KK: Blue cures blue but be cautious. J Pharm Bioallied Sci. 2011 Oct;3(4):543-5. doi: 10.4103/0975-7406.90112. [PubMed:22219589 ]
  2. Provayblue™ (methylene blue) injection[package insert]. Shirley, New York: American Regent; 2016. [Link]

PMID: 10734223

Methylene blue

By

Methylene blue

Product: Dihydromethysticin

Identifier : DBSNPE002219
Drug : DB09241 (Methylene blue)
Interacting Gene/Enzyme : Glucose-6-phosphate 1-dehydrogenase
Gene Name : G6PD
UniProt ID : P11413
Defining Change(s) :

  • 871G->A

Allele Name : Viangchan, Jammu
Genotype(s) : Not Available
Type(s) : ADR Inferred
Groups : G6PD deficiency
Description : Increased risk of hemolytic anemia or paradoxical methemoglobinemia.
References :

  1. Sikka P, Bindra VK, Kapoor S, Jain V, Saxena KK: Blue cures blue but be cautious. J Pharm Bioallied Sci. 2011 Oct;3(4):543-5. doi: 10.4103/0975-7406.90112. [PubMed:22219589 ]
  2. Provayblue™ (methylene blue) injection[package insert]. Shirley, New York: American Regent; 2016. [Link]

PMID: 11331410

Methylene blue

By

Methylene blue

Product: Dihydrokavain

Identifier : DBSNPE002220
Drug : DB09241 (Methylene blue)
Interacting Gene/Enzyme : Glucose-6-phosphate 1-dehydrogenase
Gene Name : G6PD
UniProt ID : P11413
Defining Change(s) :

  • 916G->A

Allele Name : Seoul
Genotype(s) : Not Available
Type(s) : ADR Inferred
Groups : G6PD deficiency
Description : Increased risk of hemolytic anemia or paradoxical methemoglobinemia.
References :

  1. Sikka P, Bindra VK, Kapoor S, Jain V, Saxena KK: Blue cures blue but be cautious. J Pharm Bioallied Sci. 2011 Oct;3(4):543-5. doi: 10.4103/0975-7406.90112. [PubMed:22219589 ]
  2. Provayblue™ (methylene blue) injection[package insert]. Shirley, New York: American Regent; 2016. [Link]

PMID: 10608277

Methylene blue

By

Methylene blue

Product: Yangonin

Identifier : DBSNPE002221
Drug : DB09241 (Methylene blue)
Interacting Gene/Enzyme : Glucose-6-phosphate 1-dehydrogenase
Gene Name : G6PD
UniProt ID : P11413
Defining Change(s) :

  • 929G->A

Allele Name : Ludhiana
Genotype(s) : Not Available
Type(s) : ADR Inferred
Groups : G6PD deficiency
Description : Increased risk of hemolytic anemia or paradoxical methemoglobinemia.
References :

  1. Sikka P, Bindra VK, Kapoor S, Jain V, Saxena KK: Blue cures blue but be cautious. J Pharm Bioallied Sci. 2011 Oct;3(4):543-5. doi: 10.4103/0975-7406.90112. [PubMed:22219589 ]
  2. Provayblue™ (methylene blue) injection[package insert]. Shirley, New York: American Regent; 2016. [Link]

PMID: 2180939

Methylene blue

By

Methylene blue

Product: Desmethoxyyangonin

Identifier : DBSNPE002222
Drug : DB09241 (Methylene blue)
Interacting Gene/Enzyme : Glucose-6-phosphate 1-dehydrogenase
Gene Name : G6PD
UniProt ID : P11413
Defining Change(s) :

  • 977C->A

Allele Name : Farroupilha
Genotype(s) : Not Available
Type(s) : ADR Inferred
Groups : G6PD deficiency
Description : Increased risk of hemolytic anemia or paradoxical methemoglobinemia.
References :

  1. Sikka P, Bindra VK, Kapoor S, Jain V, Saxena KK: Blue cures blue but be cautious. J Pharm Bioallied Sci. 2011 Oct;3(4):543-5. doi: 10.4103/0975-7406.90112. [PubMed:22219589 ]
  2. Provayblue™ (methylene blue) injection[package insert]. Shirley, New York: American Regent; 2016. [Link]

PMID: 14718249

Methylene blue

By

Methylene blue

Product: 6′-O-Malonylgenistin

Identifier : DBSNPE002223
Drug : DB09241 (Methylene blue)
Interacting Gene/Enzyme : Glucose-6-phosphate 1-dehydrogenase
Gene Name : G6PD
UniProt ID : P11413
Defining Change(s) :

  • 1024C->T

Allele Name : Chinese-5
Genotype(s) : Not Available
Type(s) : ADR Inferred
Groups : G6PD deficiency
Description : Increased risk of hemolytic anemia or paradoxical methemoglobinemia.
References :

  1. Sikka P, Bindra VK, Kapoor S, Jain V, Saxena KK: Blue cures blue but be cautious. J Pharm Bioallied Sci. 2011 Oct;3(4):543-5. doi: 10.4103/0975-7406.90112. [PubMed:22219589 ]
  2. Provayblue™ (methylene blue) injection[package insert]. Shirley, New York: American Regent; 2016. [Link]

PMID: 18350138

Methylene blue

By

Methylene blue

Product: Monomelittoside

Identifier : DBSNPE002224
Drug : DB09241 (Methylene blue)
Interacting Gene/Enzyme : Glucose-6-phosphate 1-dehydrogenase
Gene Name : G6PD
UniProt ID : P11413
Defining Change(s) :

  • 130G>A

Allele Name : Rignano
Genotype(s) : Not Available
Type(s) : ADR Inferred
Groups : G6PD deficiency
Description : Increased risk of hemolytic anemia or paradoxical methemoglobinemia.
References :

  1. Sikka P, Bindra VK, Kapoor S, Jain V, Saxena KK: Blue cures blue but be cautious. J Pharm Bioallied Sci. 2011 Oct;3(4):543-5. doi: 10.4103/0975-7406.90112. [PubMed:22219589 ]
  2. Provayblue™ (methylene blue) injection[package insert]. Shirley, New York: American Regent; 2016. [Link]

PMID: 2876749

Methylene blue

By

Methylene blue

Product: Melittoside

Identifier : DBSNPE002225
Drug : DB09241 (Methylene blue)
Interacting Gene/Enzyme : Glucose-6-phosphate 1-dehydrogenase
Gene Name : G6PD
UniProt ID : P11413
Defining Change(s) :

  • 131C->G

Allele Name : Orissa
Genotype(s) : Not Available
Type(s) : ADR Inferred
Groups : G6PD deficiency
Description : Increased risk of hemolytic anemia or paradoxical methemoglobinemia.
References :

  1. Sikka P, Bindra VK, Kapoor S, Jain V, Saxena KK: Blue cures blue but be cautious. J Pharm Bioallied Sci. 2011 Oct;3(4):543-5. doi: 10.4103/0975-7406.90112. [PubMed:22219589 ]
  2. Provayblue™ (methylene blue) injection[package insert]. Shirley, New York: American Regent; 2016. [Link]

PMID: 27267684

Methylene blue

By

Methylene blue

Product: Ingenol

Identifier : DBSNPE002226
Drug : DB09241 (Methylene blue)
Interacting Gene/Enzyme : Glucose-6-phosphate 1-dehydrogenase
Gene Name : G6PD
UniProt ID : P11413
Defining Change(s) :

  • 1380G>C

Allele Name : G6PDNice
Genotype(s) : Not Available
Type(s) : ADR Inferred
Groups : G6PD deficiency
Description : Increased risk of hemolytic anemia or paradoxical methemoglobinemia.
References :

  1. Sikka P, Bindra VK, Kapoor S, Jain V, Saxena KK: Blue cures blue but be cautious. J Pharm Bioallied Sci. 2011 Oct;3(4):543-5. doi: 10.4103/0975-7406.90112. [PubMed:22219589 ]
  2. Provayblue™ (methylene blue) injection[package insert]. Shirley, New York: American Regent; 2016. [Link]

PMID: 26483626

Methylene blue

By

Methylene blue

Product: p-Aminosalicylic acid (sodium salt dihydrate)

Identifier : DBSNPE002227
Drug : DB09241 (Methylene blue)
Interacting Gene/Enzyme : Glucose-6-phosphate 1-dehydrogenase
Gene Name : G6PD
UniProt ID : P11413
Defining Change(s) :

  • 1387C->T

Allele Name : Kamiube, Keelung
Genotype(s) : Not Available
Type(s) : ADR Inferred
Groups : G6PD deficiency
Description : Increased risk of hemolytic anemia or paradoxical methemoglobinemia.
References :

  1. Sikka P, Bindra VK, Kapoor S, Jain V, Saxena KK: Blue cures blue but be cautious. J Pharm Bioallied Sci. 2011 Oct;3(4):543-5. doi: 10.4103/0975-7406.90112. [PubMed:22219589 ]
  2. Provayblue™ (methylene blue) injection[package insert]. Shirley, New York: American Regent; 2016. [Link]

PMID: 25374364

Methylene blue

By

Methylene blue

Product: Edrophonium (chloride)

Identifier : DBSNPE002228
Drug : DB09241 (Methylene blue)
Interacting Gene/Enzyme : Glucose-6-phosphate 1-dehydrogenase
Gene Name : G6PD
UniProt ID : P11413
Defining Change(s) :

  • 1400C->G

Allele Name : Neapolis
Genotype(s) : Not Available
Type(s) : ADR Inferred
Groups : G6PD deficiency
Description : Increased risk of hemolytic anemia or paradoxical methemoglobinemia.
References :

  1. Sikka P, Bindra VK, Kapoor S, Jain V, Saxena KK: Blue cures blue but be cautious. J Pharm Bioallied Sci. 2011 Oct;3(4):543-5. doi: 10.4103/0975-7406.90112. [PubMed:22219589 ]
  2. Provayblue™ (methylene blue) injection[package insert]. Shirley, New York: American Regent; 2016. [Link]

PMID: 11517323

Methylene blue

By

Methylene blue

Product: Acetohexamide

Identifier : DBSNPE002229
Drug : DB09241 (Methylene blue)
Interacting Gene/Enzyme : Glucose-6-phosphate 1-dehydrogenase
Gene Name : G6PD
UniProt ID : P11413
Defining Change(s) :

  • 143T->C

Allele Name : Aures
Genotype(s) : Not Available
Type(s) : ADR Inferred
Groups : G6PD deficiency
Description : Increased risk of hemolytic anemia or paradoxical methemoglobinemia.
References :

  1. Sikka P, Bindra VK, Kapoor S, Jain V, Saxena KK: Blue cures blue but be cautious. J Pharm Bioallied Sci. 2011 Oct;3(4):543-5. doi: 10.4103/0975-7406.90112. [PubMed:22219589 ]
  2. Provayblue™ (methylene blue) injection[package insert]. Shirley, New York: American Regent; 2016. [Link]

PMID: 8378304

Methylene blue

By

Methylene blue

Product: Halobetasol (propionate)

Identifier : DBSNPE002230
Drug : DB09241 (Methylene blue)
Interacting Gene/Enzyme : Glucose-6-phosphate 1-dehydrogenase
Gene Name : G6PD
UniProt ID : P11413
Defining Change(s) :

  • 1442C->G

Allele Name : Split
Genotype(s) : Not Available
Type(s) : ADR Inferred
Groups : G6PD deficiency
Description : Increased risk of hemolytic anemia or paradoxical methemoglobinemia.
References :

  1. Sikka P, Bindra VK, Kapoor S, Jain V, Saxena KK: Blue cures blue but be cautious. J Pharm Bioallied Sci. 2011 Oct;3(4):543-5. doi: 10.4103/0975-7406.90112. [PubMed:22219589 ]
  2. Provayblue™ (methylene blue) injection[package insert]. Shirley, New York: American Regent; 2016. [Link]

PMID: 10422758

Methylene blue

By

Methylene blue

Product: Halcinonide

Identifier : DBSNPE002231
Drug : DB09241 (Methylene blue)
Interacting Gene/Enzyme : Glucose-6-phosphate 1-dehydrogenase
Gene Name : G6PD
UniProt ID : P11413
Defining Change(s) :

  • 148C->T

Allele Name : Kambos
Genotype(s) : Not Available
Type(s) : ADR Inferred
Groups : G6PD deficiency
Description : Increased risk of hemolytic anemia or paradoxical methemoglobinemia.
References :

  1. Sikka P, Bindra VK, Kapoor S, Jain V, Saxena KK: Blue cures blue but be cautious. J Pharm Bioallied Sci. 2011 Oct;3(4):543-5. doi: 10.4103/0975-7406.90112. [PubMed:22219589 ]
  2. Provayblue™ (methylene blue) injection[package insert]. Shirley, New York: American Regent; 2016. [Link]

PMID: 2166255

Methylene blue

By

Methylene blue

Product: Fomepizole

Identifier : DBSNPE002232
Drug : DB09241 (Methylene blue)
Interacting Gene/Enzyme : Glucose-6-phosphate 1-dehydrogenase
Gene Name : G6PD
UniProt ID : P11413
Defining Change(s) :

  • 170G>A

Allele Name : Palesdivina
Genotype(s) : Not Available
Type(s) : ADR Inferred
Groups : G6PD deficiency
Description : Increased risk of hemolytic anemia or paradoxical methemoglobinemia.
References :

  1. Sikka P, Bindra VK, Kapoor S, Jain V, Saxena KK: Blue cures blue but be cautious. J Pharm Bioallied Sci. 2011 Oct;3(4):543-5. doi: 10.4103/0975-7406.90112. [PubMed:22219589 ]
  2. Provayblue™ (methylene blue) injection[package insert]. Shirley, New York: American Regent; 2016. [Link]

PMID: 25394828

Methylene blue

By

Methylene blue

Product: Cefmenoxime (hydrochloride)

Identifier : DBSNPE002233
Drug : DB09241 (Methylene blue)
Interacting Gene/Enzyme : Glucose-6-phosphate 1-dehydrogenase
Gene Name : G6PD
UniProt ID : P11413
Defining Change(s) :

  • 172G->A

Allele Name : Metaponto
Genotype(s) : Not Available
Type(s) : ADR Inferred
Groups : G6PD deficiency
Description : Increased risk of hemolytic anemia or paradoxical methemoglobinemia.
References :

  1. Sikka P, Bindra VK, Kapoor S, Jain V, Saxena KK: Blue cures blue but be cautious. J Pharm Bioallied Sci. 2011 Oct;3(4):543-5. doi: 10.4103/0975-7406.90112. [PubMed:22219589 ]
  2. Provayblue™ (methylene blue) injection[package insert]. Shirley, New York: American Regent; 2016. [Link]

PMID: 18279363

Methylene blue

By

Methylene blue

Product: 1-Docosanol

Identifier : DBSNPE002234
Drug : DB09241 (Methylene blue)
Interacting Gene/Enzyme : Glucose-6-phosphate 1-dehydrogenase
Gene Name : G6PD
UniProt ID : P11413
Defining Change(s) :

  • 185C->T

Allele Name : Musashino
Genotype(s) : Not Available
Type(s) : ADR Inferred
Groups : G6PD deficiency
Description : Increased risk of hemolytic anemia or paradoxical methemoglobinemia.
References :

  1. Sikka P, Bindra VK, Kapoor S, Jain V, Saxena KK: Blue cures blue but be cautious. J Pharm Bioallied Sci. 2011 Oct;3(4):543-5. doi: 10.4103/0975-7406.90112. [PubMed:22219589 ]
  2. Provayblue™ (methylene blue) injection[package insert]. Shirley, New York: American Regent; 2016. [Link]

PMID: 3039122

Methylene blue

By

Methylene blue

Product: NS1643

Identifier : DBSNPE002235
Drug : DB09241 (Methylene blue)
Interacting Gene/Enzyme : Glucose-6-phosphate 1-dehydrogenase
Gene Name : G6PD
UniProt ID : P11413
Defining Change(s) :

  • 202G->A

Allele Name : Asahi
Genotype(s) : Not Available
Type(s) : ADR Inferred
Groups : G6PD deficiency
Description : Increased risk of hemolytic anemia or paradoxical methemoglobinemia.
References :

  1. Sikka P, Bindra VK, Kapoor S, Jain V, Saxena KK: Blue cures blue but be cautious. J Pharm Bioallied Sci. 2011 Oct;3(4):543-5. doi: 10.4103/0975-7406.90112. [PubMed:22219589 ]
  2. Provayblue™ (methylene blue) injection[package insert]. Shirley, New York: American Regent; 2016. [Link]

PMID: 24250364

Methylene blue

By

Methylene blue

Product: RPR-260243

Identifier : DBSNPE002236
Drug : DB09241 (Methylene blue)
Interacting Gene/Enzyme : Glucose-6-phosphate 1-dehydrogenase
Gene Name : G6PD
UniProt ID : P11413
Defining Change(s) :

  • 202G->A
  • 376A->G

Allele Name : A- (202), Ferrara I
Genotype(s) : Not Available
Type(s) : ADR Inferred
Groups : G6PD deficiency
Description : Increased risk of hemolytic anemia or paradoxical methemoglobinemia.
References :

  1. Sikka P, Bindra VK, Kapoor S, Jain V, Saxena KK: Blue cures blue but be cautious. J Pharm Bioallied Sci. 2011 Oct;3(4):543-5. doi: 10.4103/0975-7406.90112. [PubMed:22219589 ]
  2. Provayblue™ (methylene blue) injection[package insert]. Shirley, New York: American Regent; 2016. [Link]

PMID: 2172769

Methylene blue

By

Methylene blue

Product: MC1568

Identifier : DBSNPE002237
Drug : DB09241 (Methylene blue)
Interacting Gene/Enzyme : Glucose-6-phosphate 1-dehydrogenase
Gene Name : G6PD
UniProt ID : P11413
Defining Change(s) :

  • 209A->G

Allele Name : Murcia Oristano
Genotype(s) : Not Available
Type(s) : ADR Inferred
Groups : G6PD deficiency
Description : Increased risk of hemolytic anemia or paradoxical methemoglobinemia.
References :

  1. Sikka P, Bindra VK, Kapoor S, Jain V, Saxena KK: Blue cures blue but be cautious. J Pharm Bioallied Sci. 2011 Oct;3(4):543-5. doi: 10.4103/0975-7406.90112. [PubMed:22219589 ]
  2. Provayblue™ (methylene blue) injection[package insert]. Shirley, New York: American Regent; 2016. [Link]

PMID: 18990687

Methylene blue

By

Methylene blue

Product: TVP1022

Identifier : DBSNPE002238
Drug : DB09241 (Methylene blue)
Interacting Gene/Enzyme : Glucose-6-phosphate 1-dehydrogenase
Gene Name : G6PD
UniProt ID : P11413
Defining Change(s) :

  • 241C->T

Allele Name : Ube Konan
Genotype(s) : Not Available
Type(s) : ADR Inferred
Groups : G6PD deficiency
Description : Increased risk of hemolytic anemia or paradoxical methemoglobinemia.
References :

  1. Sikka P, Bindra VK, Kapoor S, Jain V, Saxena KK: Blue cures blue but be cautious. J Pharm Bioallied Sci. 2011 Oct;3(4):543-5. doi: 10.4103/0975-7406.90112. [PubMed:22219589 ]
  2. Provayblue™ (methylene blue) injection[package insert]. Shirley, New York: American Regent; 2016. [Link]

PMID: 7504360

Methylene blue

By

Methylene blue

Product: BPR1J-097

Identifier : DBSNPE002239
Drug : DB09241 (Methylene blue)
Interacting Gene/Enzyme : Glucose-6-phosphate 1-dehydrogenase
Gene Name : G6PD
UniProt ID : P11413
Defining Change(s) :

  • 242G->A

Allele Name : Lagosanto
Genotype(s) : Not Available
Type(s) : ADR Inferred
Groups : G6PD deficiency
Description : Increased risk of hemolytic anemia or paradoxical methemoglobinemia.
References :

  1. Sikka P, Bindra VK, Kapoor S, Jain V, Saxena KK: Blue cures blue but be cautious. J Pharm Bioallied Sci. 2011 Oct;3(4):543-5. doi: 10.4103/0975-7406.90112. [PubMed:22219589 ]
  2. Provayblue™ (methylene blue) injection[package insert]. Shirley, New York: American Regent; 2016. [Link]

PMID: 22651925

Methylene blue

By

Methylene blue

Product: SP-420

Identifier : DBSNPE002240
Drug : DB09241 (Methylene blue)
Interacting Gene/Enzyme : Glucose-6-phosphate 1-dehydrogenase
Gene Name : G6PD
UniProt ID : P11413
Defining Change(s) :

  • 274C->T

Allele Name : Guangzhou
Genotype(s) : Not Available
Type(s) : ADR Inferred
Groups : G6PD deficiency
Description : Increased risk of hemolytic anemia or paradoxical methemoglobinemia.
References :

  1. Sikka P, Bindra VK, Kapoor S, Jain V, Saxena KK: Blue cures blue but be cautious. J Pharm Bioallied Sci. 2011 Oct;3(4):543-5. doi: 10.4103/0975-7406.90112. [PubMed:22219589 ]
  2. Provayblue™ (methylene blue) injection[package insert]. Shirley, New York: American Regent; 2016. [Link]

PMID: 21807990

Methylene blue

By

Methylene blue

Product: Octocrylene

Identifier : DBSNPE002241
Drug : DB09241 (Methylene blue)
Interacting Gene/Enzyme : Glucose-6-phosphate 1-dehydrogenase
Gene Name : G6PD
UniProt ID : P11413
Defining Change(s) :

  • 323T->A

Allele Name : Hammersmith
Genotype(s) : Not Available
Type(s) : ADR Inferred
Groups : G6PD deficiency
Description : Increased risk of hemolytic anemia or paradoxical methemoglobinemia.
References :

  1. Sikka P, Bindra VK, Kapoor S, Jain V, Saxena KK: Blue cures blue but be cautious. J Pharm Bioallied Sci. 2011 Oct;3(4):543-5. doi: 10.4103/0975-7406.90112. [PubMed:22219589 ]
  2. Provayblue™ (methylene blue) injection[package insert]. Shirley, New York: American Regent; 2016. [Link]

PMID: 25081057

Methylene blue

By

Methylene blue

Product: AFN-1252

Identifier : DBSNPE002242
Drug : DB09241 (Methylene blue)
Interacting Gene/Enzyme : Glucose-6-phosphate 1-dehydrogenase
Gene Name : G6PD
UniProt ID : P11413
Defining Change(s) :

  • 34G->T

Allele Name : Sinnai
Genotype(s) : Not Available
Type(s) : ADR Inferred
Groups : G6PD deficiency
Description : Increased risk of hemolytic anemia or paradoxical methemoglobinemia.
References :

  1. Sikka P, Bindra VK, Kapoor S, Jain V, Saxena KK: Blue cures blue but be cautious. J Pharm Bioallied Sci. 2011 Oct;3(4):543-5. doi: 10.4103/0975-7406.90112. [PubMed:22219589 ]
  2. Provayblue™ (methylene blue) injection[package insert]. Shirley, New York: American Regent; 2016. [Link]

PMID: 15302678

Methylene blue

By

Methylene blue

Product: WIKI4

Identifier : DBSNPE002243
Drug : DB09241 (Methylene blue)
Interacting Gene/Enzyme : Glucose-6-phosphate 1-dehydrogenase
Gene Name : G6PD
UniProt ID : P11413
Defining Change(s) :

  • 376A->G
  • 680G->T

Allele Name : A- (680)
Genotype(s) : Not Available
Type(s) : ADR Inferred
Groups : G6PD deficiency
Description : Increased risk of hemolytic anemia or paradoxical methemoglobinemia.
References :

  1. Sikka P, Bindra VK, Kapoor S, Jain V, Saxena KK: Blue cures blue but be cautious. J Pharm Bioallied Sci. 2011 Oct;3(4):543-5. doi: 10.4103/0975-7406.90112. [PubMed:22219589 ]
  2. Provayblue™ (methylene blue) injection[package insert]. Shirley, New York: American Regent; 2016. [Link]

PMID: 8901012

Methylene blue

By

Methylene blue

Product: T338C Src-IN-2

Identifier : DBSNPE002244
Drug : DB09241 (Methylene blue)
Interacting Gene/Enzyme : Glucose-6-phosphate 1-dehydrogenase
Gene Name : G6PD
UniProt ID : P11413
Defining Change(s) :

  • 376A->G
  • 968T->C

Allele Name : A- (968), Betica,Selma, Guantanamo
Genotype(s) : Not Available
Type(s) : ADR Inferred
Groups : G6PD deficiency
Description : Increased risk of hemolytic anemia or paradoxical methemoglobinemia.
References :

  1. Sikka P, Bindra VK, Kapoor S, Jain V, Saxena KK: Blue cures blue but be cautious. J Pharm Bioallied Sci. 2011 Oct;3(4):543-5. doi: 10.4103/0975-7406.90112. [PubMed:22219589 ]
  2. Provayblue™ (methylene blue) injection[package insert]. Shirley, New York: American Regent; 2016. [Link]

PMID: 8050461

Methylene blue

By

Methylene blue

Product: T338C Src-IN-1

Identifier : DBSNPE002245
Drug : DB09241 (Methylene blue)
Interacting Gene/Enzyme : Glucose-6-phosphate 1-dehydrogenase
Gene Name : G6PD
UniProt ID : P11413
Defining Change(s) :

  • 383T>G

Allele Name : Salerno Pyrgos
Genotype(s) : Not Available
Type(s) : ADR Inferred
Groups : G6PD deficiency
Description : Increased risk of hemolytic anemia or paradoxical methemoglobinemia.
References :

  1. Sikka P, Bindra VK, Kapoor S, Jain V, Saxena KK: Blue cures blue but be cautious. J Pharm Bioallied Sci. 2011 Oct;3(4):543-5. doi: 10.4103/0975-7406.90112. [PubMed:22219589 ]
  2. Provayblue™ (methylene blue) injection[package insert]. Shirley, New York: American Regent; 2016. [Link]

PMID: 7529182

Methylene blue

By

Methylene blue

Product: Lemborexant

Identifier : DBSNPE002246
Drug : DB09241 (Methylene blue)
Interacting Gene/Enzyme : Glucose-6-phosphate 1-dehydrogenase
Gene Name : G6PD
UniProt ID : P11413
Defining Change(s) :

  • 392G->T

Allele Name : Quing Yan
Genotype(s) : Not Available
Type(s) : ADR Inferred
Groups : G6PD deficiency
Description : Increased risk of hemolytic anemia or paradoxical methemoglobinemia.
References :

  1. Sikka P, Bindra VK, Kapoor S, Jain V, Saxena KK: Blue cures blue but be cautious. J Pharm Bioallied Sci. 2011 Oct;3(4):543-5. doi: 10.4103/0975-7406.90112. [PubMed:22219589 ]
  2. Provayblue™ (methylene blue) injection[package insert]. Shirley, New York: American Regent; 2016. [Link]

PMID: 7875235

Methylene blue

By

Methylene blue

Product: Piboserod (hydrochloride)

Identifier : DBSNPE002247
Drug : DB09241 (Methylene blue)
Interacting Gene/Enzyme : Glucose-6-phosphate 1-dehydrogenase
Gene Name : G6PD
UniProt ID : P11413
Defining Change(s) :

  • 40G->A

Allele Name : Lages
Genotype(s) : Not Available
Type(s) : ADR Inferred
Groups : G6PD deficiency
Description : Increased risk of hemolytic anemia or paradoxical methemoglobinemia.
References :

  1. Sikka P, Bindra VK, Kapoor S, Jain V, Saxena KK: Blue cures blue but be cautious. J Pharm Bioallied Sci. 2011 Oct;3(4):543-5. doi: 10.4103/0975-7406.90112. [PubMed:22219589 ]
  2. Provayblue™ (methylene blue) injection[package insert]. Shirley, New York: American Regent; 2016. [Link]

PMID: 12745876

Methylene blue

By

Methylene blue

Product: Piboserod

Identifier : DBSNPE002248
Drug : DB09241 (Methylene blue)
Interacting Gene/Enzyme : Glucose-6-phosphate 1-dehydrogenase
Gene Name : G6PD
UniProt ID : P11413
Defining Change(s) :

  • 466G->A

Allele Name : Ilesha
Genotype(s) : Not Available
Type(s) : ADR Inferred
Groups : G6PD deficiency
Description : Increased risk of hemolytic anemia or paradoxical methemoglobinemia.
References :

  1. Sikka P, Bindra VK, Kapoor S, Jain V, Saxena KK: Blue cures blue but be cautious. J Pharm Bioallied Sci. 2011 Oct;3(4):543-5. doi: 10.4103/0975-7406.90112. [PubMed:22219589 ]
  2. Provayblue™ (methylene blue) injection[package insert]. Shirley, New York: American Regent; 2016. [Link]

PMID: 10729363

Methylene blue

By

Methylene blue

Product: Chembridge-5861528

Identifier : DBSNPE002249
Drug : DB09241 (Methylene blue)
Interacting Gene/Enzyme : Glucose-6-phosphate 1-dehydrogenase
Gene Name : G6PD
UniProt ID : P11413
Defining Change(s) :

  • 487G->A

Allele Name : Mahidol
Genotype(s) : Not Available
Type(s) : ADR Inferred
Groups : G6PD deficiency
Description : Increased risk of hemolytic anemia or paradoxical methemoglobinemia.
References :

  1. Sikka P, Bindra VK, Kapoor S, Jain V, Saxena KK: Blue cures blue but be cautious. J Pharm Bioallied Sci. 2011 Oct;3(4):543-5. doi: 10.4103/0975-7406.90112. [PubMed:22219589 ]
  2. Provayblue™ (methylene blue) injection[package insert]. Shirley, New York: American Regent; 2016. [Link]

PMID: 9083472

Methylene blue

By

Methylene blue

Product: TVP1022 (mesylate)

Identifier : DBSNPE002250
Drug : DB09241 (Methylene blue)
Interacting Gene/Enzyme : Glucose-6-phosphate 1-dehydrogenase
Gene Name : G6PD
UniProt ID : P11413
Defining Change(s) :

  • 542A->T

Allele Name : Malaga
Genotype(s) : Not Available
Type(s) : ADR Inferred
Groups : G6PD deficiency
Description : Increased risk of hemolytic anemia or paradoxical methemoglobinemia.
References :

  1. Sikka P, Bindra VK, Kapoor S, Jain V, Saxena KK: Blue cures blue but be cautious. J Pharm Bioallied Sci. 2011 Oct;3(4):543-5. doi: 10.4103/0975-7406.90112. [PubMed:22219589 ]
  2. Provayblue™ (methylene blue) injection[package insert]. Shirley, New York: American Regent; 2016. [Link]

PMID: 9051293

Methylene blue

By

Methylene blue

Product: Motolimod

Identifier : DBSNPE002251
Drug : DB09241 (Methylene blue)
Interacting Gene/Enzyme : Glucose-6-phosphate 1-dehydrogenase
Gene Name : G6PD
UniProt ID : P11413
Defining Change(s) :

  • 634A->G

Allele Name : Sibari
Genotype(s) : Not Available
Type(s) : ADR Inferred
Groups : G6PD deficiency
Description : Increased risk of hemolytic anemia or paradoxical methemoglobinemia.
References :

  1. Sikka P, Bindra VK, Kapoor S, Jain V, Saxena KK: Blue cures blue but be cautious. J Pharm Bioallied Sci. 2011 Oct;3(4):543-5. doi: 10.4103/0975-7406.90112. [PubMed:22219589 ]
  2. Provayblue™ (methylene blue) injection[package insert]. Shirley, New York: American Regent; 2016. [Link]

PMID: 1578355

Methylene blue

By

Methylene blue

Product: SB 242084 (hydrochloride)

Identifier : DBSNPE002252
Drug : DB09241 (Methylene blue)
Interacting Gene/Enzyme : Glucose-6-phosphate 1-dehydrogenase
Gene Name : G6PD
UniProt ID : P11413
Defining Change(s) :

  • 680G->A

Allele Name : Mexico City
Genotype(s) : Not Available
Type(s) : ADR Inferred
Groups : G6PD deficiency
Description : Increased risk of hemolytic anemia or paradoxical methemoglobinemia.
References :

  1. Sikka P, Bindra VK, Kapoor S, Jain V, Saxena KK: Blue cures blue but be cautious. J Pharm Bioallied Sci. 2011 Oct;3(4):543-5. doi: 10.4103/0975-7406.90112. [PubMed:22219589 ]
  2. Provayblue™ (methylene blue) injection[package insert]. Shirley, New York: American Regent; 2016. [Link]

PMID: 2153294

Methylene blue

By

Methylene blue

Product: SB 242084

Identifier : DBSNPE002253
Drug : DB09241 (Methylene blue)
Interacting Gene/Enzyme : Glucose-6-phosphate 1-dehydrogenase
Gene Name : G6PD
UniProt ID : P11413
Defining Change(s) :

  • 703C->T

Allele Name : Nanning
Genotype(s) : Not Available
Type(s) : ADR Inferred
Groups : G6PD deficiency
Description : Increased risk of hemolytic anemia or paradoxical methemoglobinemia.
References :

  1. Sikka P, Bindra VK, Kapoor S, Jain V, Saxena KK: Blue cures blue but be cautious. J Pharm Bioallied Sci. 2011 Oct;3(4):543-5. doi: 10.4103/0975-7406.90112. [PubMed:22219589 ]
  2. Provayblue™ (methylene blue) injection[package insert]. Shirley, New York: American Regent; 2016. [Link]

PMID: 15380375

Methylene blue

By

Methylene blue

Product: EGF816 (mesylate)

Identifier : DBSNPE002254
Drug : DB09241 (Methylene blue)
Interacting Gene/Enzyme : Glucose-6-phosphate 1-dehydrogenase
Gene Name : G6PD
UniProt ID : P11413
Defining Change(s) :

  • 844G->C

Allele Name : Seattle, Lodi, Modena, Ferrara II, Athens-like
Genotype(s) : Not Available
Type(s) : ADR Inferred
Groups : G6PD deficiency
Description : Increased risk of hemolytic anemia or paradoxical methemoglobinemia.
References :

  1. Sikka P, Bindra VK, Kapoor S, Jain V, Saxena KK: Blue cures blue but be cautious. J Pharm Bioallied Sci. 2011 Oct;3(4):543-5. doi: 10.4103/0975-7406.90112. [PubMed:22219589 ]
  2. Provayblue™ (methylene blue) injection[package insert]. Shirley, New York: American Regent; 2016. [Link]

PMID: 9353414

Methylene blue

By

Methylene blue

Product: EGF816

Identifier : DBSNPE002255
Drug : DB09241 (Methylene blue)
Interacting Gene/Enzyme : Glucose-6-phosphate 1-dehydrogenase
Gene Name : G6PD
UniProt ID : P11413
Defining Change(s) :

  • 844G->T

Allele Name : Bajo Maumere
Genotype(s) : Not Available
Type(s) : ADR Inferred
Groups : G6PD deficiency
Description : Increased risk of hemolytic anemia or paradoxical methemoglobinemia.
References :

  1. Sikka P, Bindra VK, Kapoor S, Jain V, Saxena KK: Blue cures blue but be cautious. J Pharm Bioallied Sci. 2011 Oct;3(4):543-5. doi: 10.4103/0975-7406.90112. [PubMed:22219589 ]
  2. Provayblue™ (methylene blue) injection[package insert]. Shirley, New York: American Regent; 2016. [Link]

PMID: 9424014

Methylene blue

By

Methylene blue

Product: AZD9496 (maleate)

Identifier : DBSNPE002256
Drug : DB09241 (Methylene blue)
Interacting Gene/Enzyme : Glucose-6-phosphate 1-dehydrogenase
Gene Name : G6PD
UniProt ID : P11413
Defining Change(s) :

  • 854G->A

Allele Name : Montalbano
Genotype(s) : Not Available
Type(s) : ADR Inferred
Groups : G6PD deficiency
Description : Increased risk of hemolytic anemia or paradoxical methemoglobinemia.
References :

  1. Sikka P, Bindra VK, Kapoor S, Jain V, Saxena KK: Blue cures blue but be cautious. J Pharm Bioallied Sci. 2011 Oct;3(4):543-5. doi: 10.4103/0975-7406.90112. [PubMed:22219589 ]
  2. Provayblue™ (methylene blue) injection[package insert]. Shirley, New York: American Regent; 2016. [Link]

PMID: 8298080

Methylene blue

By

Methylene blue

Product: AZD9496

Identifier : DBSNPE002257
Drug : DB09241 (Methylene blue)
Interacting Gene/Enzyme : Glucose-6-phosphate 1-dehydrogenase
Gene Name : G6PD
UniProt ID : P11413
Defining Change(s) :

  • 949G->A

Allele Name : Kalyan-Kerala, Jamnaga, Rohini
Genotype(s) : Not Available
Type(s) : ADR Inferred
Groups : G6PD deficiency
Description : Increased risk of hemolytic anemia or paradoxical methemoglobinemia.
References :

  1. Sikka P, Bindra VK, Kapoor S, Jain V, Saxena KK: Blue cures blue but be cautious. J Pharm Bioallied Sci. 2011 Oct;3(4):543-5. doi: 10.4103/0975-7406.90112. [PubMed:22219589 ]
  2. Provayblue™ (methylene blue) injection[package insert]. Shirley, New York: American Regent; 2016. [Link]

PMID: 17460149

Methylene blue

By

Methylene blue

Product: PT-2385

Identifier : DBSNPE002258
Drug : DB09241 (Methylene blue)
Interacting Gene/Enzyme : Glucose-6-phosphate 1-dehydrogenase
Gene Name : G6PD
UniProt ID : P11413
Defining Change(s) :

  • 95A->G

Allele Name : Gaohe
Genotype(s) : Not Available
Type(s) : ADR Inferred
Groups : G6PD deficiency
Description : Increased risk of hemolytic anemia or paradoxical methemoglobinemia.
References :

  1. Sikka P, Bindra VK, Kapoor S, Jain V, Saxena KK: Blue cures blue but be cautious. J Pharm Bioallied Sci. 2011 Oct;3(4):543-5. doi: 10.4103/0975-7406.90112. [PubMed:22219589 ]
  2. Provayblue™ (methylene blue) injection[package insert]. Shirley, New York: American Regent; 2016. [Link]

PMID: 8838458

By

Related Post

You Missed

Uncategorized

ROCK2 (Human) Recombinant Protein

Uncategorized

Human KIR2DL3 Protein 4652

Uncategorized

Cynomolgus IL-17F Protein, His Tag

Uncategorized

AKT1 (Human) Recombinant Protein