PI3KInhibitorpi3kinhibitor

Glyburide

By

Glyburide

Product: Apomorphine (hydrochloride hemihydrate)

Identifier : DBSNPE001746
Drug : DB01016 (Glyburide)
Interacting Gene/Enzyme : Glucose-6-phosphate 1-dehydrogenase
Gene Name : G6PD
UniProt ID : P11413
Defining Change(s) :

  • 1000_1002delACC

Allele Name : Villeurbanne
Genotype(s) : Not Available
Type(s) : ADR Inferred
Groups : G6PD deficiency
Description : Increased risk of hemolytic anemia.
References :

  1. Meloni G, Meloni T: Glyburide-induced acute haemolysis in a G6PD-deficient patient with NIDDM. Br J Haematol. 1996 Jan;92(1):159-60. [PubMed:8562390 ]
  2. Glyase® PresTab® micronized glyburide tablets[package insert]. New York City, New York: Pharmacia & Upjohn Co, Division of Pfizer Inc; 2015. [Link]

PMID: 22725677

Glyburide

By

Glyburide

Product: Calycosin-7-O-β-D-glucoside

Identifier : DBSNPE001747
Drug : DB01016 (Glyburide)
Interacting Gene/Enzyme : Glucose-6-phosphate 1-dehydrogenase
Gene Name : G6PD
UniProt ID : P11413
Defining Change(s) :

  • 1006A->G

Allele Name : Torun
Genotype(s) : Not Available
Type(s) : ADR Inferred
Groups : G6PD deficiency
Description : Increased risk of hemolytic anemia.
References :

  1. Meloni G, Meloni T: Glyburide-induced acute haemolysis in a G6PD-deficient patient with NIDDM. Br J Haematol. 1996 Jan;92(1):159-60. [PubMed:8562390 ]
  2. Glyase® PresTab® micronized glyburide tablets[package insert]. New York City, New York: Pharmacia & Upjohn Co, Division of Pfizer Inc; 2015. [Link]

PMID: 9849660

Glyburide

By

Glyburide

Product: Calycosin

Identifier : DBSNPE001748
Drug : DB01016 (Glyburide)
Interacting Gene/Enzyme : Glucose-6-phosphate 1-dehydrogenase
Gene Name : G6PD
UniProt ID : P11413
Defining Change(s) :

  • 105_107delCAT

Allele Name : Sunderland
Genotype(s) : Not Available
Type(s) : ADR Inferred
Groups : G6PD deficiency
Description : Increased risk of hemolytic anemia.
References :

  1. Meloni G, Meloni T: Glyburide-induced acute haemolysis in a G6PD-deficient patient with NIDDM. Br J Haematol. 1996 Jan;92(1):159-60. [PubMed:8562390 ]
  2. Glyase® PresTab® micronized glyburide tablets[package insert]. New York City, New York: Pharmacia & Upjohn Co, Division of Pfizer Inc; 2015. [Link]

PMID: 15331619

Glyburide

By

Glyburide

Product: α-Lipoic Acid

Identifier : DBSNPE001749
Drug : DB01016 (Glyburide)
Interacting Gene/Enzyme : Glucose-6-phosphate 1-dehydrogenase
Gene Name : G6PD
UniProt ID : P11413
Defining Change(s) :

  • 1081G->A

Allele Name : Iwatsuki
Genotype(s) : Not Available
Type(s) : ADR Inferred
Groups : G6PD deficiency
Description : Increased risk of hemolytic anemia.
References :

  1. Meloni G, Meloni T: Glyburide-induced acute haemolysis in a G6PD-deficient patient with NIDDM. Br J Haematol. 1996 Jan;92(1):159-60. [PubMed:8562390 ]
  2. Glyase® PresTab® micronized glyburide tablets[package insert]. New York City, New York: Pharmacia & Upjohn Co, Division of Pfizer Inc; 2015. [Link]

PMID: 6392929

Glyburide

By

Glyburide

Product: Wilforlide A

Identifier : DBSNPE001750
Drug : DB01016 (Glyburide)
Interacting Gene/Enzyme : Glucose-6-phosphate 1-dehydrogenase
Gene Name : G6PD
UniProt ID : P11413
Defining Change(s) :

  • 1082C->T

Allele Name : Serres
Genotype(s) : Not Available
Type(s) : ADR Inferred
Groups : G6PD deficiency
Description : Increased risk of hemolytic anemia.
References :

  1. Meloni G, Meloni T: Glyburide-induced acute haemolysis in a G6PD-deficient patient with NIDDM. Br J Haematol. 1996 Jan;92(1):159-60. [PubMed:8562390 ]
  2. Glyase® PresTab® micronized glyburide tablets[package insert]. New York City, New York: Pharmacia & Upjohn Co, Division of Pfizer Inc; 2015. [Link]

PMID: 16754668

Glyburide

By

Glyburide

Product: Triptophenolide

Identifier : DBSNPE001751
Drug : DB01016 (Glyburide)
Interacting Gene/Enzyme : Glucose-6-phosphate 1-dehydrogenase
Gene Name : G6PD
UniProt ID : P11413
Defining Change(s) :

  • 1084_1101delCTGAACGAGCGCAAGGCC

Allele Name : Tondela
Genotype(s) : Not Available
Type(s) : ADR Inferred
Groups : G6PD deficiency
Description : Increased risk of hemolytic anemia.
References :

  1. Meloni G, Meloni T: Glyburide-induced acute haemolysis in a G6PD-deficient patient with NIDDM. Br J Haematol. 1996 Jan;92(1):159-60. [PubMed:8562390 ]
  2. Glyase® PresTab® micronized glyburide tablets[package insert]. New York City, New York: Pharmacia & Upjohn Co, Division of Pfizer Inc; 2015. [Link]

PMID: 9336311

Glyburide

By

Glyburide

Product: L-Chicoric Acid

Identifier : DBSNPE001752
Drug : DB01016 (Glyburide)
Interacting Gene/Enzyme : Glucose-6-phosphate 1-dehydrogenase
Gene Name : G6PD
UniProt ID : P11413
Defining Change(s) :

  • 1089C->A

Allele Name : Loma Linda
Genotype(s) : Not Available
Type(s) : ADR Inferred
Groups : G6PD deficiency
Description : Increased risk of hemolytic anemia.
References :

  1. Meloni G, Meloni T: Glyburide-induced acute haemolysis in a G6PD-deficient patient with NIDDM. Br J Haematol. 1996 Jan;92(1):159-60. [PubMed:8562390 ]
  2. Glyase® PresTab® micronized glyburide tablets[package insert]. New York City, New York: Pharmacia & Upjohn Co, Division of Pfizer Inc; 2015. [Link]

PMID: 2830636

Glyburide

By

Glyburide

Product: Cichoric Acid

Identifier : DBSNPE001753
Drug : DB01016 (Glyburide)
Interacting Gene/Enzyme : Glucose-6-phosphate 1-dehydrogenase
Gene Name : G6PD
UniProt ID : P11413
Defining Change(s) :

  • 1089C->G

Allele Name : Aachen
Genotype(s) : Not Available
Type(s) : ADR Inferred
Groups : G6PD deficiency
Description : Increased risk of hemolytic anemia.
References :

  1. Meloni G, Meloni T: Glyburide-induced acute haemolysis in a G6PD-deficient patient with NIDDM. Br J Haematol. 1996 Jan;92(1):159-60. [PubMed:8562390 ]
  2. Glyase® PresTab® micronized glyburide tablets[package insert]. New York City, New York: Pharmacia & Upjohn Co, Division of Pfizer Inc; 2015. [Link]

PMID: 6215086

Glyburide

By

Glyburide

Product: 5-O-Methylvisammioside

Identifier : DBSNPE001754
Drug : DB01016 (Glyburide)
Interacting Gene/Enzyme : Glucose-6-phosphate 1-dehydrogenase
Gene Name : G6PD
UniProt ID : P11413
Defining Change(s) :

  • 1096A->G

Allele Name : Tenri
Genotype(s) : Not Available
Type(s) : ADR Inferred
Groups : G6PD deficiency
Description : Increased risk of hemolytic anemia.
References :

  1. Meloni G, Meloni T: Glyburide-induced acute haemolysis in a G6PD-deficient patient with NIDDM. Br J Haematol. 1996 Jan;92(1):159-60. [PubMed:8562390 ]
  2. Glyase® PresTab® micronized glyburide tablets[package insert]. New York City, New York: Pharmacia & Upjohn Co, Division of Pfizer Inc; 2015. [Link]

PMID: 25339733

Glyburide

By

Glyburide

Product: Astragaloside III

Identifier : DBSNPE001755
Drug : DB01016 (Glyburide)
Interacting Gene/Enzyme : Glucose-6-phosphate 1-dehydrogenase
Gene Name : G6PD
UniProt ID : P11413
Defining Change(s) :

  • 1132G>A

Allele Name : Montpellier
Genotype(s) : Not Available
Type(s) : ADR Inferred
Groups : G6PD deficiency
Description : Increased risk of hemolytic anemia.
References :

  1. Meloni G, Meloni T: Glyburide-induced acute haemolysis in a G6PD-deficient patient with NIDDM. Br J Haematol. 1996 Jan;92(1):159-60. [PubMed:8562390 ]
  2. Glyase® PresTab® micronized glyburide tablets[package insert]. New York City, New York: Pharmacia & Upjohn Co, Division of Pfizer Inc; 2015. [Link]

PMID: 23667248

Glyburide

By

Glyburide

Product: Astragaloside II

Identifier : DBSNPE001756
Drug : DB01016 (Glyburide)
Interacting Gene/Enzyme : Glucose-6-phosphate 1-dehydrogenase
Gene Name : G6PD
UniProt ID : P11413
Defining Change(s) :

  • 1138A->G

Allele Name : Calvo Mackenna
Genotype(s) : Not Available
Type(s) : ADR Inferred
Groups : G6PD deficiency
Description : Increased risk of hemolytic anemia.
References :

  1. Meloni G, Meloni T: Glyburide-induced acute haemolysis in a G6PD-deficient patient with NIDDM. Br J Haematol. 1996 Jan;92(1):159-60. [PubMed:8562390 ]
  2. Glyase® PresTab® micronized glyburide tablets[package insert]. New York City, New York: Pharmacia & Upjohn Co, Division of Pfizer Inc; 2015. [Link]

PMID: 21325686

Glyburide

By

Glyburide

Product: Astragaloside I

Identifier : DBSNPE001757
Drug : DB01016 (Glyburide)
Interacting Gene/Enzyme : Glucose-6-phosphate 1-dehydrogenase
Gene Name : G6PD
UniProt ID : P11413
Defining Change(s) :

  • 1139T->C

Allele Name : Riley
Genotype(s) : Not Available
Type(s) : ADR Inferred
Groups : G6PD deficiency
Description : Increased risk of hemolytic anemia.
References :

  1. Meloni G, Meloni T: Glyburide-induced acute haemolysis in a G6PD-deficient patient with NIDDM. Br J Haematol. 1996 Jan;92(1):159-60. [PubMed:8562390 ]
  2. Glyase® PresTab® micronized glyburide tablets[package insert]. New York City, New York: Pharmacia & Upjohn Co, Division of Pfizer Inc; 2015. [Link]

PMID: 21173225

Glyburide

By

Glyburide

Product: Alismoxide

Identifier : DBSNPE001758
Drug : DB01016 (Glyburide)
Interacting Gene/Enzyme : Glucose-6-phosphate 1-dehydrogenase
Gene Name : G6PD
UniProt ID : P11413
Defining Change(s) :

  • 1141T->C

Allele Name : Olomouc
Genotype(s) : Not Available
Type(s) : ADR Inferred
Groups : G6PD deficiency
Description : Increased risk of hemolytic anemia.
References :

  1. Meloni G, Meloni T: Glyburide-induced acute haemolysis in a G6PD-deficient patient with NIDDM. Br J Haematol. 1996 Jan;92(1):159-60. [PubMed:8562390 ]
  2. Glyase® PresTab® micronized glyburide tablets[package insert]. New York City, New York: Pharmacia & Upjohn Co, Division of Pfizer Inc; 2015. [Link]

PMID: 10478637

Glyburide

By

Glyburide

Product: Cycloastragenol

Identifier : DBSNPE001759
Drug : DB01016 (Glyburide)
Interacting Gene/Enzyme : Glucose-6-phosphate 1-dehydrogenase
Gene Name : G6PD
UniProt ID : P11413
Defining Change(s) :

  • 1153T->C

Allele Name : Tomah
Genotype(s) : Not Available
Type(s) : ADR Inferred
Groups : G6PD deficiency
Description : Increased risk of hemolytic anemia.
References :

  1. Meloni G, Meloni T: Glyburide-induced acute haemolysis in a G6PD-deficient patient with NIDDM. Br J Haematol. 1996 Jan;92(1):159-60. [PubMed:8562390 ]
  2. Glyase® PresTab® micronized glyburide tablets[package insert]. New York City, New York: Pharmacia & Upjohn Co, Division of Pfizer Inc; 2015. [Link]

PMID: 9335499

Glyburide

By

Glyburide

Product: Cinobufagin

Identifier : DBSNPE001760
Drug : DB01016 (Glyburide)
Interacting Gene/Enzyme : Glucose-6-phosphate 1-dehydrogenase
Gene Name : G6PD
UniProt ID : P11413
Defining Change(s) :

  • 1154G->T

Allele Name : Lynwood
Genotype(s) : Not Available
Type(s) : ADR Inferred
Groups : G6PD deficiency
Description : Increased risk of hemolytic anemia.
References :

  1. Meloni G, Meloni T: Glyburide-induced acute haemolysis in a G6PD-deficient patient with NIDDM. Br J Haematol. 1996 Jan;92(1):159-60. [PubMed:8562390 ]
  2. Glyase® PresTab® micronized glyburide tablets[package insert]. New York City, New York: Pharmacia & Upjohn Co, Division of Pfizer Inc; 2015. [Link]

PMID: 9046343

Glyburide

By

Glyburide

Product: Cucurbitacin E

Identifier : DBSNPE001761
Drug : DB01016 (Glyburide)
Interacting Gene/Enzyme : Glucose-6-phosphate 1-dehydrogenase
Gene Name : G6PD
UniProt ID : P11413
Defining Change(s) :

  • 1155C->G

Allele Name : Madrid
Genotype(s) : Not Available
Type(s) : ADR Inferred
Groups : G6PD deficiency
Description : Increased risk of hemolytic anemia.
References :

  1. Meloni G, Meloni T: Glyburide-induced acute haemolysis in a G6PD-deficient patient with NIDDM. Br J Haematol. 1996 Jan;92(1):159-60. [PubMed:8562390 ]
  2. Glyase® PresTab® micronized glyburide tablets[package insert]. New York City, New York: Pharmacia & Upjohn Co, Division of Pfizer Inc; 2015. [Link]

PMID: 16948848

Glyburide

By

Glyburide

Product: L-Cycloserine

Identifier : DBSNPE001762
Drug : DB01016 (Glyburide)
Interacting Gene/Enzyme : Glucose-6-phosphate 1-dehydrogenase
Gene Name : G6PD
UniProt ID : P11413
Defining Change(s) :

  • 1156A->G

Allele Name : Iowa, Walter Reed, Springfield
Genotype(s) : Not Available
Type(s) : ADR Inferred
Groups : G6PD deficiency
Description : Increased risk of hemolytic anemia.
References :

  1. Meloni G, Meloni T: Glyburide-induced acute haemolysis in a G6PD-deficient patient with NIDDM. Br J Haematol. 1996 Jan;92(1):159-60. [PubMed:8562390 ]
  2. Glyase® PresTab® micronized glyburide tablets[package insert]. New York City, New York: Pharmacia & Upjohn Co, Division of Pfizer Inc; 2015. [Link]

PMID: 10223631

Glyburide

By

Glyburide

Product: Flunisolide

Identifier : DBSNPE001763
Drug : DB01016 (Glyburide)
Interacting Gene/Enzyme : Glucose-6-phosphate 1-dehydrogenase
Gene Name : G6PD
UniProt ID : P11413
Defining Change(s) :

  • 1160G->A

Allele Name : Beverly Hills, Genova, Iwate, Niigata, Yamaguchi
Genotype(s) : Not Available
Type(s) : ADR Inferred
Groups : G6PD deficiency
Description : Increased risk of hemolytic anemia.
References :

  1. Meloni G, Meloni T: Glyburide-induced acute haemolysis in a G6PD-deficient patient with NIDDM. Br J Haematol. 1996 Jan;92(1):159-60. [PubMed:8562390 ]
  2. Glyase® PresTab® micronized glyburide tablets[package insert]. New York City, New York: Pharmacia & Upjohn Co, Division of Pfizer Inc; 2015. [Link]

PMID: 2540893

Glyburide

By

Glyburide

Product: Temephos

Identifier : DBSNPE001764
Drug : DB01016 (Glyburide)
Interacting Gene/Enzyme : Glucose-6-phosphate 1-dehydrogenase
Gene Name : G6PD
UniProt ID : P11413
Defining Change(s) :

  • 1162A->G

Allele Name : Hartford
Genotype(s) : Not Available
Type(s) : ADR Inferred
Groups : G6PD deficiency
Description : Increased risk of hemolytic anemia.
References :

  1. Meloni G, Meloni T: Glyburide-induced acute haemolysis in a G6PD-deficient patient with NIDDM. Br J Haematol. 1996 Jan;92(1):159-60. [PubMed:8562390 ]
  2. Glyase® PresTab® micronized glyburide tablets[package insert]. New York City, New York: Pharmacia & Upjohn Co, Division of Pfizer Inc; 2015. [Link]

PMID: 3513882

Glyburide

By

Glyburide

Product: Triclosan

Identifier : DBSNPE001765
Drug : DB01016 (Glyburide)
Interacting Gene/Enzyme : Glucose-6-phosphate 1-dehydrogenase
Gene Name : G6PD
UniProt ID : P11413
Defining Change(s) :

  • 1166A->G

Allele Name : Praha
Genotype(s) : Not Available
Type(s) : ADR Inferred
Groups : G6PD deficiency
Description : Increased risk of hemolytic anemia.
References :

  1. Meloni G, Meloni T: Glyburide-induced acute haemolysis in a G6PD-deficient patient with NIDDM. Br J Haematol. 1996 Jan;92(1):159-60. [PubMed:8562390 ]
  2. Glyase® PresTab® micronized glyburide tablets[package insert]. New York City, New York: Pharmacia & Upjohn Co, Division of Pfizer Inc; 2015. [Link]

PMID: 9584222

Glyburide

By

Glyburide

Product: Cefoxitin (sodium)

Identifier : DBSNPE001766
Drug : DB01016 (Glyburide)
Interacting Gene/Enzyme : Glucose-6-phosphate 1-dehydrogenase
Gene Name : G6PD
UniProt ID : P11413
Defining Change(s) :

  • 1175T>C

Allele Name : Krakow
Genotype(s) : Not Available
Type(s) : ADR Inferred
Groups : G6PD deficiency
Description : Increased risk of hemolytic anemia.
References :

  1. Meloni G, Meloni T: Glyburide-induced acute haemolysis in a G6PD-deficient patient with NIDDM. Br J Haematol. 1996 Jan;92(1):159-60. [PubMed:8562390 ]
  2. Glyase® PresTab® micronized glyburide tablets[package insert]. New York City, New York: Pharmacia & Upjohn Co, Division of Pfizer Inc; 2015. [Link]

PMID: 9357531

Glyburide

By

Glyburide

Product: Metaraminol (tartrate)

Identifier : DBSNPE001767
Drug : DB01016 (Glyburide)
Interacting Gene/Enzyme : Glucose-6-phosphate 1-dehydrogenase
Gene Name : G6PD
UniProt ID : P11413
Defining Change(s) :

  • 1177C->G

Allele Name : Wisconsin
Genotype(s) : Not Available
Type(s) : ADR Inferred
Groups : G6PD deficiency
Description : Increased risk of hemolytic anemia.
References :

  1. Meloni G, Meloni T: Glyburide-induced acute haemolysis in a G6PD-deficient patient with NIDDM. Br J Haematol. 1996 Jan;92(1):159-60. [PubMed:8562390 ]
  2. Glyase® PresTab® micronized glyburide tablets[package insert]. New York City, New York: Pharmacia & Upjohn Co, Division of Pfizer Inc; 2015. [Link]

PMID: 7515954

Glyburide

By

Glyburide

Product: Buspirone (hydrochloride)

Identifier : DBSNPE001768
Drug : DB01016 (Glyburide)
Interacting Gene/Enzyme : Glucose-6-phosphate 1-dehydrogenase
Gene Name : G6PD
UniProt ID : P11413
Defining Change(s) :

  • 1178G->A

Allele Name : Nashville, Anaheim, Portici
Genotype(s) : Not Available
Type(s) : ADR Inferred
Groups : G6PD deficiency
Description : Increased risk of hemolytic anemia.
References :

  1. Meloni G, Meloni T: Glyburide-induced acute haemolysis in a G6PD-deficient patient with NIDDM. Br J Haematol. 1996 Jan;92(1):159-60. [PubMed:8562390 ]
  2. Glyase® PresTab® micronized glyburide tablets[package insert]. New York City, New York: Pharmacia & Upjohn Co, Division of Pfizer Inc; 2015. [Link]

PMID: 1371315

Glyburide

By

Glyburide

Product: Fluorothyl

Identifier : DBSNPE001769
Drug : DB01016 (Glyburide)
Interacting Gene/Enzyme : Glucose-6-phosphate 1-dehydrogenase
Gene Name : G6PD
UniProt ID : P11413
Defining Change(s) :

  • 1180G->C

Allele Name : Alhambra
Genotype(s) : Not Available
Type(s) : ADR Inferred
Groups : G6PD deficiency
Description : Increased risk of hemolytic anemia.
References :

  1. Meloni G, Meloni T: Glyburide-induced acute haemolysis in a G6PD-deficient patient with NIDDM. Br J Haematol. 1996 Jan;92(1):159-60. [PubMed:8562390 ]
  2. Glyase® PresTab® micronized glyburide tablets[package insert]. New York City, New York: Pharmacia & Upjohn Co, Division of Pfizer Inc; 2015. [Link]

PMID: 20532231

Glyburide

By

Glyburide

Product: Labetalol (hydrochloride)

Identifier : DBSNPE001770
Drug : DB01016 (Glyburide)
Interacting Gene/Enzyme : Glucose-6-phosphate 1-dehydrogenase
Gene Name : G6PD
UniProt ID : P11413
Defining Change(s) :

  • 1187C->T

Allele Name : Bari
Genotype(s) : Not Available
Type(s) : ADR Inferred
Groups : G6PD deficiency
Description : Increased risk of hemolytic anemia.
References :

  1. Meloni G, Meloni T: Glyburide-induced acute haemolysis in a G6PD-deficient patient with NIDDM. Br J Haematol. 1996 Jan;92(1):159-60. [PubMed:8562390 ]
  2. Glyase® PresTab® micronized glyburide tablets[package insert]. New York City, New York: Pharmacia & Upjohn Co, Division of Pfizer Inc; 2015. [Link]

PMID: 25261782

Glyburide

By

Glyburide

Product: Tetrahydroxyquinone

Identifier : DBSNPE001771
Drug : DB01016 (Glyburide)
Interacting Gene/Enzyme : Glucose-6-phosphate 1-dehydrogenase
Gene Name : G6PD
UniProt ID : P11413
Defining Change(s) :

  • 1192G->A

Allele Name : Puerto Limon
Genotype(s) : Not Available
Type(s) : ADR Inferred
Groups : G6PD deficiency
Description : Increased risk of hemolytic anemia.
References :

  1. Meloni G, Meloni T: Glyburide-induced acute haemolysis in a G6PD-deficient patient with NIDDM. Br J Haematol. 1996 Jan;92(1):159-60. [PubMed:8562390 ]
  2. Glyase® PresTab® micronized glyburide tablets[package insert]. New York City, New York: Pharmacia & Upjohn Co, Division of Pfizer Inc; 2015. [Link]

PMID: 25909085

Glyburide

By

Glyburide

Product: Indoprofen

Identifier : DBSNPE001772
Drug : DB01016 (Glyburide)
Interacting Gene/Enzyme : Glucose-6-phosphate 1-dehydrogenase
Gene Name : G6PD
UniProt ID : P11413
Defining Change(s) :

  • 1205C>A

Allele Name : Covao do Lobo
Genotype(s) : Not Available
Type(s) : ADR Inferred
Groups : G6PD deficiency
Description : Increased risk of hemolytic anemia.
References :

  1. Meloni G, Meloni T: Glyburide-induced acute haemolysis in a G6PD-deficient patient with NIDDM. Br J Haematol. 1996 Jan;92(1):159-60. [PubMed:8562390 ]
  2. Glyase® PresTab® micronized glyburide tablets[package insert]. New York City, New York: Pharmacia & Upjohn Co, Division of Pfizer Inc; 2015. [Link]

PMID: 25642169

Glyburide

By

Glyburide

Product: Hydroxyhexamide

Identifier : DBSNPE001773
Drug : DB01016 (Glyburide)
Interacting Gene/Enzyme : Glucose-6-phosphate 1-dehydrogenase
Gene Name : G6PD
UniProt ID : P11413
Defining Change(s) :

  • 1215G->A

Allele Name : Clinic
Genotype(s) : Not Available
Type(s) : ADR Inferred
Groups : G6PD deficiency
Description : Increased risk of hemolytic anemia.
References :

  1. Meloni G, Meloni T: Glyburide-induced acute haemolysis in a G6PD-deficient patient with NIDDM. Br J Haematol. 1996 Jan;92(1):159-60. [PubMed:8562390 ]
  2. Glyase® PresTab® micronized glyburide tablets[package insert]. New York City, New York: Pharmacia & Upjohn Co, Division of Pfizer Inc; 2015. [Link]

PMID: 25762896

Glyburide

By

Glyburide

Product: Evans Blue

Identifier : DBSNPE001774
Drug : DB01016 (Glyburide)
Interacting Gene/Enzyme : Glucose-6-phosphate 1-dehydrogenase
Gene Name : G6PD
UniProt ID : P11413
Defining Change(s) :

  • 1225C->T

Allele Name : Udivecht
Genotype(s) : Not Available
Type(s) : ADR Inferred
Groups : G6PD deficiency
Description : Increased risk of hemolytic anemia.
References :

  1. Meloni G, Meloni T: Glyburide-induced acute haemolysis in a G6PD-deficient patient with NIDDM. Br J Haematol. 1996 Jan;92(1):159-60. [PubMed:8562390 ]
  2. Glyase® PresTab® micronized glyburide tablets[package insert]. New York City, New York: Pharmacia & Upjohn Co, Division of Pfizer Inc; 2015. [Link]

PMID: 26109952

Glyburide

By

Glyburide

Product: Pimethixene

Identifier : DBSNPE001775
Drug : DB01016 (Glyburide)
Interacting Gene/Enzyme : Glucose-6-phosphate 1-dehydrogenase
Gene Name : G6PD
UniProt ID : P11413
Defining Change(s) :

  • 1226C->G

Allele Name : Suwalki
Genotype(s) : Not Available
Type(s) : ADR Inferred
Groups : G6PD deficiency
Description : Increased risk of hemolytic anemia.
References :

  1. Meloni G, Meloni T: Glyburide-induced acute haemolysis in a G6PD-deficient patient with NIDDM. Br J Haematol. 1996 Jan;92(1):159-60. [PubMed:8562390 ]
  2. Glyase® PresTab® micronized glyburide tablets[package insert]. New York City, New York: Pharmacia & Upjohn Co, Division of Pfizer Inc; 2015. [Link]

PMID: 24148856

Glyburide

By

Glyburide

Product: Estradiol (cypionate)

Identifier : DBSNPE001776
Drug : DB01016 (Glyburide)
Interacting Gene/Enzyme : Glucose-6-phosphate 1-dehydrogenase
Gene Name : G6PD
UniProt ID : P11413
Defining Change(s) :

  • 1228G->T

Allele Name : Riverside
Genotype(s) : Not Available
Type(s) : ADR Inferred
Groups : G6PD deficiency
Description : Increased risk of hemolytic anemia.
References :

  1. Meloni G, Meloni T: Glyburide-induced acute haemolysis in a G6PD-deficient patient with NIDDM. Br J Haematol. 1996 Jan;92(1):159-60. [PubMed:8562390 ]
  2. Glyase® PresTab® micronized glyburide tablets[package insert]. New York City, New York: Pharmacia & Upjohn Co, Division of Pfizer Inc; 2015. [Link]

PMID: 24402869

Glyburide

By

Glyburide

Product: Hydroxyamphetamine

Identifier : DBSNPE001777
Drug : DB01016 (Glyburide)
Interacting Gene/Enzyme : Glucose-6-phosphate 1-dehydrogenase
Gene Name : G6PD
UniProt ID : P11413
Defining Change(s) :

  • 1229G->A

Allele Name : Japan, Shinagawa
Genotype(s) : Not Available
Type(s) : ADR Inferred
Groups : G6PD deficiency
Description : Increased risk of hemolytic anemia.
References :

  1. Meloni G, Meloni T: Glyburide-induced acute haemolysis in a G6PD-deficient patient with NIDDM. Br J Haematol. 1996 Jan;92(1):159-60. [PubMed:8562390 ]
  2. Glyase® PresTab® micronized glyburide tablets[package insert]. New York City, New York: Pharmacia & Upjohn Co, Division of Pfizer Inc; 2015. [Link]

PMID: 23734103

Glyburide

By

Glyburide

Product: Fenaclon

Identifier : DBSNPE001778
Drug : DB01016 (Glyburide)
Interacting Gene/Enzyme : Glucose-6-phosphate 1-dehydrogenase
Gene Name : G6PD
UniProt ID : P11413
Defining Change(s) :

  • 1229G->C

Allele Name : Kawasaki
Genotype(s) : Not Available
Type(s) : ADR Inferred
Groups : G6PD deficiency
Description : Increased risk of hemolytic anemia.
References :

  1. Meloni G, Meloni T: Glyburide-induced acute haemolysis in a G6PD-deficient patient with NIDDM. Br J Haematol. 1996 Jan;92(1):159-60. [PubMed:8562390 ]
  2. Glyase® PresTab® micronized glyburide tablets[package insert]. New York City, New York: Pharmacia & Upjohn Co, Division of Pfizer Inc; 2015. [Link]

PMID: 23340416

Glyburide

By

Glyburide

Product: Etamivan

Identifier : DBSNPE001779
Drug : DB01016 (Glyburide)
Interacting Gene/Enzyme : Glucose-6-phosphate 1-dehydrogenase
Gene Name : G6PD
UniProt ID : P11413
Defining Change(s) :

  • 1231A->G

Allele Name : Munich
Genotype(s) : Not Available
Type(s) : ADR Inferred
Groups : G6PD deficiency
Description : Increased risk of hemolytic anemia.
References :

  1. Meloni G, Meloni T: Glyburide-induced acute haemolysis in a G6PD-deficient patient with NIDDM. Br J Haematol. 1996 Jan;92(1):159-60. [PubMed:8562390 ]
  2. Glyase® PresTab® micronized glyburide tablets[package insert]. New York City, New York: Pharmacia & Upjohn Co, Division of Pfizer Inc; 2015. [Link]

PMID: 22710612

Glyburide

By

Glyburide

Product: Prednisolone (hemisuccinate)

Identifier : DBSNPE001780
Drug : DB01016 (Glyburide)
Interacting Gene/Enzyme : Glucose-6-phosphate 1-dehydrogenase
Gene Name : G6PD
UniProt ID : P11413
Defining Change(s) :

  • 1284C->A

Allele Name : Georgia
Genotype(s) : Not Available
Type(s) : ADR Inferred
Groups : G6PD deficiency
Description : Increased risk of hemolytic anemia.
References :

  1. Meloni G, Meloni T: Glyburide-induced acute haemolysis in a G6PD-deficient patient with NIDDM. Br J Haematol. 1996 Jan;92(1):159-60. [PubMed:8562390 ]
  2. Glyase® PresTab® micronized glyburide tablets[package insert]. New York City, New York: Pharmacia & Upjohn Co, Division of Pfizer Inc; 2015. [Link]

PMID: 22876306

Glyburide

By

Glyburide

Product: N-Acetyl-DL-phenylalanine

Identifier : DBSNPE001781
Drug : DB01016 (Glyburide)
Interacting Gene/Enzyme : Glucose-6-phosphate 1-dehydrogenase
Gene Name : G6PD
UniProt ID : P11413
Defining Change(s) :

  • 1292T->G

Allele Name : Sumare
Genotype(s) : Not Available
Type(s) : ADR Inferred
Groups : G6PD deficiency
Description : Increased risk of hemolytic anemia.
References :

  1. Meloni G, Meloni T: Glyburide-induced acute haemolysis in a G6PD-deficient patient with NIDDM. Br J Haematol. 1996 Jan;92(1):159-60. [PubMed:8562390 ]
  2. Glyase® PresTab® micronized glyburide tablets[package insert]. New York City, New York: Pharmacia & Upjohn Co, Division of Pfizer Inc; 2015. [Link]

PMID: 22292013

Glyburide

By

Glyburide

Product: Cinoctramide

Identifier : DBSNPE001782
Drug : DB01016 (Glyburide)
Interacting Gene/Enzyme : Glucose-6-phosphate 1-dehydrogenase
Gene Name : G6PD
UniProt ID : P11413
Defining Change(s) :

  • 1318C->T

Allele Name : Telti/Kobe
Genotype(s) : Not Available
Type(s) : ADR Inferred
Groups : G6PD deficiency
Description : Increased risk of hemolytic anemia.
References :

  1. Meloni G, Meloni T: Glyburide-induced acute haemolysis in a G6PD-deficient patient with NIDDM. Br J Haematol. 1996 Jan;92(1):159-60. [PubMed:8562390 ]
  2. Glyase® PresTab® micronized glyburide tablets[package insert]. New York City, New York: Pharmacia & Upjohn Co, Division of Pfizer Inc; 2015. [Link]

PMID: 22555241

Glyburide

By

Glyburide

Product: Nicotinic acid N-oxide

Identifier : DBSNPE001783
Drug : DB01016 (Glyburide)
Interacting Gene/Enzyme : Glucose-6-phosphate 1-dehydrogenase
Gene Name : G6PD
UniProt ID : P11413
Defining Change(s) :

  • 1339G->A

Allele Name : Santiago de Cuba, Morioka
Genotype(s) : Not Available
Type(s) : ADR Inferred
Groups : G6PD deficiency
Description : Increased risk of hemolytic anemia.
References :

  1. Meloni G, Meloni T: Glyburide-induced acute haemolysis in a G6PD-deficient patient with NIDDM. Br J Haematol. 1996 Jan;92(1):159-60. [PubMed:8562390 ]
  2. Glyase® PresTab® micronized glyburide tablets[package insert]. New York City, New York: Pharmacia & Upjohn Co, Division of Pfizer Inc; 2015. [Link]

PMID: 21613508

Glyburide

By

Glyburide

Product: Tilmicosin (phosphate)

Identifier : DBSNPE001784
Drug : DB01016 (Glyburide)
Interacting Gene/Enzyme : Glucose-6-phosphate 1-dehydrogenase
Gene Name : G6PD
UniProt ID : P11413
Defining Change(s) :

  • 1358T->A

Allele Name : Harima
Genotype(s) : Not Available
Type(s) : ADR Inferred
Groups : G6PD deficiency
Description : Increased risk of hemolytic anemia.
References :

  1. Meloni G, Meloni T: Glyburide-induced acute haemolysis in a G6PD-deficient patient with NIDDM. Br J Haematol. 1996 Jan;92(1):159-60. [PubMed:8562390 ]
  2. Glyase® PresTab® micronized glyburide tablets[package insert]. New York City, New York: Pharmacia & Upjohn Co, Division of Pfizer Inc; 2015. [Link]

PMID: 20731874

Glyburide

By

Glyburide

Product: Givinostat (hydrochloride)

Identifier : DBSNPE001785
Drug : DB01016 (Glyburide)
Interacting Gene/Enzyme : Glucose-6-phosphate 1-dehydrogenase
Gene Name : G6PD
UniProt ID : P11413
Defining Change(s) :

  • 1366G->C

Allele Name : Figuera da Foz
Genotype(s) : Not Available
Type(s) : ADR Inferred
Groups : G6PD deficiency
Description : Increased risk of hemolytic anemia.
References :

  1. Meloni G, Meloni T: Glyburide-induced acute haemolysis in a G6PD-deficient patient with NIDDM. Br J Haematol. 1996 Jan;92(1):159-60. [PubMed:8562390 ]
  2. Glyase® PresTab® micronized glyburide tablets[package insert]. New York City, New York: Pharmacia & Upjohn Co, Division of Pfizer Inc; 2015. [Link]

PMID: 18657617

Glyburide

By

Glyburide

Product: Givinostat

Identifier : DBSNPE001786
Drug : DB01016 (Glyburide)
Interacting Gene/Enzyme : Glucose-6-phosphate 1-dehydrogenase
Gene Name : G6PD
UniProt ID : P11413
Defining Change(s) :

  • 1367A>T

Allele Name : Amiens
Genotype(s) : Not Available
Type(s) : ADR Inferred
Groups : G6PD deficiency
Description : Increased risk of hemolytic anemia.
References :

  1. Meloni G, Meloni T: Glyburide-induced acute haemolysis in a G6PD-deficient patient with NIDDM. Br J Haematol. 1996 Jan;92(1):159-60. [PubMed:8562390 ]
  2. Glyase® PresTab® micronized glyburide tablets[package insert]. New York City, New York: Pharmacia & Upjohn Co, Division of Pfizer Inc; 2015. [Link]

PMID: 15041741

Glyburide

By

Glyburide

Product: Cucurbitacin B

Identifier : DBSNPE001787
Drug : DB01016 (Glyburide)
Interacting Gene/Enzyme : Glucose-6-phosphate 1-dehydrogenase
Gene Name : G6PD
UniProt ID : P11413
Defining Change(s) :

  • 1376G->T, 1502T->G

Allele Name : Bangkok Noi
Genotype(s) : Not Available
Type(s) : ADR Inferred
Groups : G6PD deficiency
Description : Increased risk of hemolytic anemia.
References :

  1. Meloni G, Meloni T: Glyburide-induced acute haemolysis in a G6PD-deficient patient with NIDDM. Br J Haematol. 1996 Jan;92(1):159-60. [PubMed:8562390 ]
  2. Glyase® PresTab® micronized glyburide tablets[package insert]. New York City, New York: Pharmacia & Upjohn Co, Division of Pfizer Inc; 2015. [Link]

PMID: 17348638

Glyburide

By

Glyburide

Product: Nomifensine

Identifier : DBSNPE001788
Drug : DB01016 (Glyburide)
Interacting Gene/Enzyme : Glucose-6-phosphate 1-dehydrogenase
Gene Name : G6PD
UniProt ID : P11413
Defining Change(s) :

  • 1462G->A

Allele Name : Fukaya
Genotype(s) : Not Available
Type(s) : ADR Inferred
Groups : G6PD deficiency
Description : Increased risk of hemolytic anemia.
References :

  1. Meloni G, Meloni T: Glyburide-induced acute haemolysis in a G6PD-deficient patient with NIDDM. Br J Haematol. 1996 Jan;92(1):159-60. [PubMed:8562390 ]
  2. Glyase® PresTab® micronized glyburide tablets[package insert]. New York City, New York: Pharmacia & Upjohn Co, Division of Pfizer Inc; 2015. [Link]

PMID: 25071549

Glyburide

By

Glyburide

Product: N-Acetylprocainamide

Identifier : DBSNPE001789
Drug : DB01016 (Glyburide)
Interacting Gene/Enzyme : Glucose-6-phosphate 1-dehydrogenase
Gene Name : G6PD
UniProt ID : P11413
Defining Change(s) :

  • 1463G->T

Allele Name : Campinas
Genotype(s) : Not Available
Type(s) : ADR Inferred
Groups : G6PD deficiency
Description : Increased risk of hemolytic anemia.
References :

  1. Meloni G, Meloni T: Glyburide-induced acute haemolysis in a G6PD-deficient patient with NIDDM. Br J Haematol. 1996 Jan;92(1):159-60. [PubMed:8562390 ]
  2. Glyase® PresTab® micronized glyburide tablets[package insert]. New York City, New York: Pharmacia & Upjohn Co, Division of Pfizer Inc; 2015. [Link]

PMID: 14985418

Glyburide

By

Glyburide

Product: D-Mannitol 1,2:5,6-bis-acetonide

Identifier : DBSNPE001790
Drug : DB01016 (Glyburide)
Interacting Gene/Enzyme : Glucose-6-phosphate 1-dehydrogenase
Gene Name : G6PD
UniProt ID : P11413
Defining Change(s) :

  • 1465C>T

Allele Name : Buenos Aires
Genotype(s) : Not Available
Type(s) : ADR Inferred
Groups : G6PD deficiency
Description : Increased risk of hemolytic anemia.
References :

  1. Meloni G, Meloni T: Glyburide-induced acute haemolysis in a G6PD-deficient patient with NIDDM. Br J Haematol. 1996 Jan;92(1):159-60. [PubMed:8562390 ]
  2. Glyase® PresTab® micronized glyburide tablets[package insert]. New York City, New York: Pharmacia & Upjohn Co, Division of Pfizer Inc; 2015. [Link]

PMID: 16302825

Glyburide

By

Glyburide

Product: Amitraz

Identifier : DBSNPE001791
Drug : DB01016 (Glyburide)
Interacting Gene/Enzyme : Glucose-6-phosphate 1-dehydrogenase
Gene Name : G6PD
UniProt ID : P11413
Defining Change(s) :

  • 1466C->T

Allele Name : Arakawa
Genotype(s) : Not Available
Type(s) : ADR Inferred
Groups : G6PD deficiency
Description : Increased risk of hemolytic anemia.
References :

  1. Meloni G, Meloni T: Glyburide-induced acute haemolysis in a G6PD-deficient patient with NIDDM. Br J Haematol. 1996 Jan;92(1):159-60. [PubMed:8562390 ]
  2. Glyase® PresTab® micronized glyburide tablets[package insert]. New York City, New York: Pharmacia & Upjohn Co, Division of Pfizer Inc; 2015. [Link]

PMID: 15165833

Glyburide

By

Glyburide

Product: Nomifensine (maleate)

Identifier : DBSNPE001792
Drug : DB01016 (Glyburide)
Interacting Gene/Enzyme : Glucose-6-phosphate 1-dehydrogenase
Gene Name : G6PD
UniProt ID : P11413
Defining Change(s) :

  • 1488_1490delGAA

Allele Name : Brighton
Genotype(s) : Not Available
Type(s) : ADR Inferred
Groups : G6PD deficiency
Description : Increased risk of hemolytic anemia.
References :

  1. Meloni G, Meloni T: Glyburide-induced acute haemolysis in a G6PD-deficient patient with NIDDM. Br J Haematol. 1996 Jan;92(1):159-60. [PubMed:8562390 ]
  2. Glyase® PresTab® micronized glyburide tablets[package insert]. New York City, New York: Pharmacia & Upjohn Co, Division of Pfizer Inc; 2015. [Link]

PMID: 26075099

Glyburide

By

Glyburide

Product: Lipoamide

Identifier : DBSNPE001793
Drug : DB01016 (Glyburide)
Interacting Gene/Enzyme : Glucose-6-phosphate 1-dehydrogenase
Gene Name : G6PD
UniProt ID : P11413
Defining Change(s) :

  • 159G->C

Allele Name : Kozukata
Genotype(s) : Not Available
Type(s) : ADR Inferred
Groups : G6PD deficiency
Description : Increased risk of hemolytic anemia.
References :

  1. Meloni G, Meloni T: Glyburide-induced acute haemolysis in a G6PD-deficient patient with NIDDM. Br J Haematol. 1996 Jan;92(1):159-60. [PubMed:8562390 ]
  2. Glyase® PresTab® micronized glyburide tablets[package insert]. New York City, New York: Pharmacia & Upjohn Co, Division of Pfizer Inc; 2015. [Link]

PMID: 25157087

Glyburide

By

Glyburide

Product: Clofibric acid

Identifier : DBSNPE001794
Drug : DB01016 (Glyburide)
Interacting Gene/Enzyme : Glucose-6-phosphate 1-dehydrogenase
Gene Name : G6PD
UniProt ID : P11413
Defining Change(s) :

  • 180_182delTCT

Allele Name : Amsterdam
Genotype(s) : Not Available
Type(s) : ADR Inferred
Groups : G6PD deficiency
Description : Increased risk of hemolytic anemia.
References :

  1. Meloni G, Meloni T: Glyburide-induced acute haemolysis in a G6PD-deficient patient with NIDDM. Br J Haematol. 1996 Jan;92(1):159-60. [PubMed:8562390 ]
  2. Glyase® PresTab® micronized glyburide tablets[package insert]. New York City, New York: Pharmacia & Upjohn Co, Division of Pfizer Inc; 2015. [Link]

PMID: 16540562

Glyburide

By

Glyburide

Product: Bronopol

Identifier : DBSNPE001795
Drug : DB01016 (Glyburide)
Interacting Gene/Enzyme : Glucose-6-phosphate 1-dehydrogenase
Gene Name : G6PD
UniProt ID : P11413
Defining Change(s) :

  • 202G->A, 376A->G, 1264C>G

Allele Name : No name
Genotype(s) : Not Available
Type(s) : ADR Inferred
Groups : G6PD deficiency
Description : Increased risk of hemolytic anemia.
References :

  1. Meloni G, Meloni T: Glyburide-induced acute haemolysis in a G6PD-deficient patient with NIDDM. Br J Haematol. 1996 Jan;92(1):159-60. [PubMed:8562390 ]
  2. Glyase® PresTab® micronized glyburide tablets[package insert]. New York City, New York: Pharmacia & Upjohn Co, Division of Pfizer Inc; 2015. [Link]

PMID: 15123241

Glyburide

By

Glyburide

Product: Neostigmine (methyl sulfate)

Identifier : DBSNPE001796
Drug : DB01016 (Glyburide)
Interacting Gene/Enzyme : Glucose-6-phosphate 1-dehydrogenase
Gene Name : G6PD
UniProt ID : P11413
Defining Change(s) :

  • 224T->C

Allele Name : Swansea
Genotype(s) : Not Available
Type(s) : ADR Inferred
Groups : G6PD deficiency
Description : Increased risk of hemolytic anemia.
References :

  1. Meloni G, Meloni T: Glyburide-induced acute haemolysis in a G6PD-deficient patient with NIDDM. Br J Haematol. 1996 Jan;92(1):159-60. [PubMed:8562390 ]
  2. Glyase® PresTab® micronized glyburide tablets[package insert]. New York City, New York: Pharmacia & Upjohn Co, Division of Pfizer Inc; 2015. [Link]

PMID: 11476756

Glyburide

By

Glyburide

Product: Histamine

Identifier : DBSNPE001797
Drug : DB01016 (Glyburide)
Interacting Gene/Enzyme : Glucose-6-phosphate 1-dehydrogenase
Gene Name : G6PD
UniProt ID : P11413
Defining Change(s) :

  • 281_283delAGA

Allele Name : Urayasu
Genotype(s) : Not Available
Type(s) : ADR Inferred
Groups : G6PD deficiency
Description : Increased risk of hemolytic anemia.
References :

  1. Meloni G, Meloni T: Glyburide-induced acute haemolysis in a G6PD-deficient patient with NIDDM. Br J Haematol. 1996 Jan;92(1):159-60. [PubMed:8562390 ]
  2. Glyase® PresTab® micronized glyburide tablets[package insert]. New York City, New York: Pharmacia & Upjohn Co, Division of Pfizer Inc; 2015. [Link]

PMID: 10771029

Glyburide

By

Glyburide

Product: Cefadroxil

Identifier : DBSNPE001798
Drug : DB01016 (Glyburide)
Interacting Gene/Enzyme : Glucose-6-phosphate 1-dehydrogenase
Gene Name : G6PD
UniProt ID : P11413
Defining Change(s) :

  • 317C->G544C->T592C->T

Allele Name : Vancouver
Genotype(s) : Not Available
Type(s) : ADR Inferred
Groups : G6PD deficiency
Description : Increased risk of hemolytic anemia.
References :

  1. Meloni G, Meloni T: Glyburide-induced acute haemolysis in a G6PD-deficient patient with NIDDM. Br J Haematol. 1996 Jan;92(1):159-60. [PubMed:8562390 ]
  2. Glyase® PresTab® micronized glyburide tablets[package insert]. New York City, New York: Pharmacia & Upjohn Co, Division of Pfizer Inc; 2015. [Link]

PMID: 9301676

Glyburide

By

Glyburide

Product: Midodrine (hydrochloride)

Identifier : DBSNPE001799
Drug : DB01016 (Glyburide)
Interacting Gene/Enzyme : Glucose-6-phosphate 1-dehydrogenase
Gene Name : G6PD
UniProt ID : P11413
Defining Change(s) :

  • 376A->G, 1159C->T

Allele Name : Mt Sinai
Genotype(s) : Not Available
Type(s) : ADR Inferred
Groups : G6PD deficiency
Description : Increased risk of hemolytic anemia.
References :

  1. Meloni G, Meloni T: Glyburide-induced acute haemolysis in a G6PD-deficient patient with NIDDM. Br J Haematol. 1996 Jan;92(1):159-60. [PubMed:8562390 ]
  2. Glyase® PresTab® micronized glyburide tablets[package insert]. New York City, New York: Pharmacia & Upjohn Co, Division of Pfizer Inc; 2015. [Link]

PMID: 19940105

Glyburide

By

Glyburide

Product: Midodrine

Identifier : DBSNPE001800
Drug : DB01016 (Glyburide)
Interacting Gene/Enzyme : Glucose-6-phosphate 1-dehydrogenase
Gene Name : G6PD
UniProt ID : P11413
Defining Change(s) :

  • 488G->A

Allele Name : Plymouth
Genotype(s) : Not Available
Type(s) : ADR Inferred
Groups : G6PD deficiency
Description : Increased risk of hemolytic anemia.
References :

  1. Meloni G, Meloni T: Glyburide-induced acute haemolysis in a G6PD-deficient patient with NIDDM. Br J Haematol. 1996 Jan;92(1):159-60. [PubMed:8562390 ]
  2. Glyase® PresTab® micronized glyburide tablets[package insert]. New York City, New York: Pharmacia & Upjohn Co, Division of Pfizer Inc; 2015. [Link]

PMID: 21627638

Glyburide

By

Glyburide

Product: Pargyline

Identifier : DBSNPE001801
Drug : DB01016 (Glyburide)
Interacting Gene/Enzyme : Glucose-6-phosphate 1-dehydrogenase
Gene Name : G6PD
UniProt ID : P11413
Defining Change(s) :

  • 514C->T

Allele Name : Volendam
Genotype(s) : Not Available
Type(s) : ADR Inferred
Groups : G6PD deficiency
Description : Increased risk of hemolytic anemia.
References :

  1. Meloni G, Meloni T: Glyburide-induced acute haemolysis in a G6PD-deficient patient with NIDDM. Br J Haematol. 1996 Jan;92(1):159-60. [PubMed:8562390 ]
  2. Glyase® PresTab® micronized glyburide tablets[package insert]. New York City, New York: Pharmacia & Upjohn Co, Division of Pfizer Inc; 2015. [Link]

PMID: 7617150

Glyburide

By

Glyburide

Product: Chlormadinone (acetate)

Identifier : DBSNPE001802
Drug : DB01016 (Glyburide)
Interacting Gene/Enzyme : Glucose-6-phosphate 1-dehydrogenase
Gene Name : G6PD
UniProt ID : P11413
Defining Change(s) :

  • 527A->G

Allele Name : Shinshu
Genotype(s) : Not Available
Type(s) : ADR Inferred
Groups : G6PD deficiency
Description : Increased risk of hemolytic anemia.
References :

  1. Meloni G, Meloni T: Glyburide-induced acute haemolysis in a G6PD-deficient patient with NIDDM. Br J Haematol. 1996 Jan;92(1):159-60. [PubMed:8562390 ]
  2. Glyase® PresTab® micronized glyburide tablets[package insert]. New York City, New York: Pharmacia & Upjohn Co, Division of Pfizer Inc; 2015. [Link]

PMID: 8742431

Glyburide

By

Glyburide

Product: Aklomide

Identifier : DBSNPE001803
Drug : DB01016 (Glyburide)
Interacting Gene/Enzyme : Glucose-6-phosphate 1-dehydrogenase
Gene Name : G6PD
UniProt ID : P11413
Defining Change(s) :

  • 535A->T

Allele Name : Chikugo
Genotype(s) : Not Available
Type(s) : ADR Inferred
Groups : G6PD deficiency
Description : Increased risk of hemolytic anemia.
References :

  1. Meloni G, Meloni T: Glyburide-induced acute haemolysis in a G6PD-deficient patient with NIDDM. Br J Haematol. 1996 Jan;92(1):159-60. [PubMed:8562390 ]
  2. Glyase® PresTab® micronized glyburide tablets[package insert]. New York City, New York: Pharmacia & Upjohn Co, Division of Pfizer Inc; 2015. [Link]

PMID: 1329206

Glyburide

By

Glyburide

Product: Verinurad

Identifier : DBSNPE001804
Drug : DB01016 (Glyburide)
Interacting Gene/Enzyme : Glucose-6-phosphate 1-dehydrogenase
Gene Name : G6PD
UniProt ID : P11413
Defining Change(s) :

  • 561_563delCTC

Allele Name : Tsukui
Genotype(s) : Not Available
Type(s) : ADR Inferred
Groups : G6PD deficiency
Description : Increased risk of hemolytic anemia.
References :

  1. Meloni G, Meloni T: Glyburide-induced acute haemolysis in a G6PD-deficient patient with NIDDM. Br J Haematol. 1996 Jan;92(1):159-60. [PubMed:8562390 ]
  2. Glyase® PresTab® micronized glyburide tablets[package insert]. New York City, New York: Pharmacia & Upjohn Co, Division of Pfizer Inc; 2015. [Link]

PMID: 25881041

Glyburide

By

Glyburide

Product: 4-Chloro-3-methylphenol

Identifier : DBSNPE001805
Drug : DB01016 (Glyburide)
Interacting Gene/Enzyme : Glucose-6-phosphate 1-dehydrogenase
Gene Name : G6PD
UniProt ID : P11413
Defining Change(s) :

  • 573C>G

Allele Name : Pedoplis-Ckaro
Genotype(s) : Not Available
Type(s) : ADR Inferred
Groups : G6PD deficiency
Description : Increased risk of hemolytic anemia.
References :

  1. Meloni G, Meloni T: Glyburide-induced acute haemolysis in a G6PD-deficient patient with NIDDM. Br J Haematol. 1996 Jan;92(1):159-60. [PubMed:8562390 ]
  2. Glyase® PresTab® micronized glyburide tablets[package insert]. New York City, New York: Pharmacia & Upjohn Co, Division of Pfizer Inc; 2015. [Link]

PMID: 25095892

Glyburide

By

Glyburide

Product: p-Phenylene diisothiocyanate

Identifier : DBSNPE001806
Drug : DB01016 (Glyburide)
Interacting Gene/Enzyme : Glucose-6-phosphate 1-dehydrogenase
Gene Name : G6PD
UniProt ID : P11413
Defining Change(s) :

  • 593G->C

Allele Name : Santiago
Genotype(s) : Not Available
Type(s) : ADR Inferred
Groups : G6PD deficiency
Description : Increased risk of hemolytic anemia.
References :

  1. Meloni G, Meloni T: Glyburide-induced acute haemolysis in a G6PD-deficient patient with NIDDM. Br J Haematol. 1996 Jan;92(1):159-60. [PubMed:8562390 ]
  2. Glyase® PresTab® micronized glyburide tablets[package insert]. New York City, New York: Pharmacia & Upjohn Co, Division of Pfizer Inc; 2015. [Link]

PMID: 26635537

Glyburide

By

Glyburide

Product: Coptisine

Identifier : DBSNPE001807
Drug : DB01016 (Glyburide)
Interacting Gene/Enzyme : Glucose-6-phosphate 1-dehydrogenase
Gene Name : G6PD
UniProt ID : P11413
Defining Change(s) :

  • 637G->T

Allele Name : Minnesota, Marion, Gastonia, LeJeune
Genotype(s) : Not Available
Type(s) : ADR Inferred
Groups : G6PD deficiency
Description : Increased risk of hemolytic anemia.
References :

  1. Meloni G, Meloni T: Glyburide-induced acute haemolysis in a G6PD-deficient patient with NIDDM. Br J Haematol. 1996 Jan;92(1):159-60. [PubMed:8562390 ]
  2. Glyase® PresTab® micronized glyburide tablets[package insert]. New York City, New York: Pharmacia & Upjohn Co, Division of Pfizer Inc; 2015. [Link]

PMID: 25650413

Glyburide

By

Glyburide

Product: PQR309

Identifier : DBSNPE001808
Drug : DB01016 (Glyburide)
Interacting Gene/Enzyme : Glucose-6-phosphate 1-dehydrogenase
Gene Name : G6PD
UniProt ID : P11413
Defining Change(s) :

  • 637G->T, 1037A->T

Allele Name : Cincinnati
Genotype(s) : Not Available
Type(s) : ADR Inferred
Groups : G6PD deficiency
Description : Increased risk of hemolytic anemia.
References :

  1. Meloni G, Meloni T: Glyburide-induced acute haemolysis in a G6PD-deficient patient with NIDDM. Br J Haematol. 1996 Jan;92(1):159-60. [PubMed:8562390 ]
  2. Glyase® PresTab® micronized glyburide tablets[package insert]. New York City, New York: Pharmacia & Upjohn Co, Division of Pfizer Inc; 2015. [Link]

PMID: 24764063

Glyburide

By

Glyburide

Product: Mangiferin

Identifier : DBSNPE001809
Drug : DB01016 (Glyburide)
Interacting Gene/Enzyme : Glucose-6-phosphate 1-dehydrogenase
Gene Name : G6PD
UniProt ID : P11413
Defining Change(s) :

  • 648T->G

Allele Name : Harilaou
Genotype(s) : Not Available
Type(s) : ADR Inferred
Groups : G6PD deficiency
Description : Increased risk of hemolytic anemia.
References :

  1. Meloni G, Meloni T: Glyburide-induced acute haemolysis in a G6PD-deficient patient with NIDDM. Br J Haematol. 1996 Jan;92(1):159-60. [PubMed:8562390 ]
  2. Glyase® PresTab® micronized glyburide tablets[package insert]. New York City, New York: Pharmacia & Upjohn Co, Division of Pfizer Inc; 2015. [Link]

PMID: 23054605

Glyburide

By

Glyburide

Product: Fenchlorphos

Identifier : DBSNPE001810
Drug : DB01016 (Glyburide)
Interacting Gene/Enzyme : Glucose-6-phosphate 1-dehydrogenase
Gene Name : G6PD
UniProt ID : P11413
Defining Change(s) :

  • 683_685delACA

Allele Name : North Dallas
Genotype(s) : Not Available
Type(s) : ADR Inferred
Groups : G6PD deficiency
Description : Increased risk of hemolytic anemia.
References :

  1. Meloni G, Meloni T: Glyburide-induced acute haemolysis in a G6PD-deficient patient with NIDDM. Br J Haematol. 1996 Jan;92(1):159-60. [PubMed:8562390 ]
  2. Glyase® PresTab® micronized glyburide tablets[package insert]. New York City, New York: Pharmacia & Upjohn Co, Division of Pfizer Inc; 2015. [Link]

PMID: 23926260

Glyburide

By

Glyburide

Product: Gluconate (Calcium)

Identifier : DBSNPE001811
Drug : DB01016 (Glyburide)
Interacting Gene/Enzyme : Glucose-6-phosphate 1-dehydrogenase
Gene Name : G6PD
UniProt ID : P11413
Defining Change(s) :

  • 695G->A

Allele Name : Asahikawa
Genotype(s) : Not Available
Type(s) : ADR Inferred
Groups : G6PD deficiency
Description : Increased risk of hemolytic anemia.
References :

  1. Meloni G, Meloni T: Glyburide-induced acute haemolysis in a G6PD-deficient patient with NIDDM. Br J Haematol. 1996 Jan;92(1):159-60. [PubMed:8562390 ]
  2. Glyase® PresTab® micronized glyburide tablets[package insert]. New York City, New York: Pharmacia & Upjohn Co, Division of Pfizer Inc; 2015. [Link]

PMID: 22609935

Glyburide

By

Glyburide

Product: Cinnarizine

Identifier : DBSNPE001812
Drug : DB01016 (Glyburide)
Interacting Gene/Enzyme : Glucose-6-phosphate 1-dehydrogenase
Gene Name : G6PD
UniProt ID : P11413
Defining Change(s) :

  • 713A->G

Allele Name : Durham
Genotype(s) : Not Available
Type(s) : ADR Inferred
Groups : G6PD deficiency
Description : Increased risk of hemolytic anemia.
References :

  1. Meloni G, Meloni T: Glyburide-induced acute haemolysis in a G6PD-deficient patient with NIDDM. Br J Haematol. 1996 Jan;92(1):159-60. [PubMed:8562390 ]
  2. Glyase® PresTab® micronized glyburide tablets[package insert]. New York City, New York: Pharmacia & Upjohn Co, Division of Pfizer Inc; 2015. [Link]

PMID: 22896717

Glyburide

By

Glyburide

Product: Clopidol

Identifier : DBSNPE001813
Drug : DB01016 (Glyburide)
Interacting Gene/Enzyme : Glucose-6-phosphate 1-dehydrogenase
Gene Name : G6PD
UniProt ID : P11413
Defining Change(s) :

  • 724_729delGGCACT

Allele Name : Stonybrook
Genotype(s) : Not Available
Type(s) : ADR Inferred
Groups : G6PD deficiency
Description : Increased risk of hemolytic anemia.
References :

  1. Meloni G, Meloni T: Glyburide-induced acute haemolysis in a G6PD-deficient patient with NIDDM. Br J Haematol. 1996 Jan;92(1):159-60. [PubMed:8562390 ]
  2. Glyase® PresTab® micronized glyburide tablets[package insert]. New York City, New York: Pharmacia & Upjohn Co, Division of Pfizer Inc; 2015. [Link]

PMID: 22634728

Glyburide

By

Glyburide

Product: Cinoxacin

Identifier : DBSNPE001814
Drug : DB01016 (Glyburide)
Interacting Gene/Enzyme : Glucose-6-phosphate 1-dehydrogenase
Gene Name : G6PD
UniProt ID : P11413
Defining Change(s) :

  • 769C->G

Allele Name : Wayne
Genotype(s) : Not Available
Type(s) : ADR Inferred
Groups : G6PD deficiency
Description : Increased risk of hemolytic anemia.
References :

  1. Meloni G, Meloni T: Glyburide-induced acute haemolysis in a G6PD-deficient patient with NIDDM. Br J Haematol. 1996 Jan;92(1):159-60. [PubMed:8562390 ]
  2. Glyase® PresTab® micronized glyburide tablets[package insert]. New York City, New York: Pharmacia & Upjohn Co, Division of Pfizer Inc; 2015. [Link]

PMID: 22880066

Glyburide

By

Glyburide

Product: Antimonyl (potassium tartrate trihydrate)

Identifier : DBSNPE001815
Drug : DB01016 (Glyburide)
Interacting Gene/Enzyme : Glucose-6-phosphate 1-dehydrogenase
Gene Name : G6PD
UniProt ID : P11413
Defining Change(s) :

  • 806G->A

Allele Name : Aveiro
Genotype(s) : Not Available
Type(s) : ADR Inferred
Groups : G6PD deficiency
Description : Increased risk of hemolytic anemia.
References :

  1. Meloni G, Meloni T: Glyburide-induced acute haemolysis in a G6PD-deficient patient with NIDDM. Br J Haematol. 1996 Jan;92(1):159-60. [PubMed:8562390 ]
  2. Glyase® PresTab® micronized glyburide tablets[package insert]. New York City, New York: Pharmacia & Upjohn Co, Division of Pfizer Inc; 2015. [Link]

PMID: 21734298

Glyburide

By

Glyburide

Product: Oxidopamine (hydrochloride)

Identifier : DBSNPE001816
Drug : DB01016 (Glyburide)
Interacting Gene/Enzyme : Glucose-6-phosphate 1-dehydrogenase
Gene Name : G6PD
UniProt ID : P11413
Defining Change(s) :

  • 820G->A

Allele Name : Cleveland Corum
Genotype(s) : Not Available
Type(s) : ADR Inferred
Groups : G6PD deficiency
Description : Increased risk of hemolytic anemia.
References :

  1. Meloni G, Meloni T: Glyburide-induced acute haemolysis in a G6PD-deficient patient with NIDDM. Br J Haematol. 1996 Jan;92(1):159-60. [PubMed:8562390 ]
  2. Glyase® PresTab® micronized glyburide tablets[package insert]. New York City, New York: Pharmacia & Upjohn Co, Division of Pfizer Inc; 2015. [Link]

PMID: 22069494

Glyburide

By

Glyburide

Product: Prednisolone (21-acetate)

Identifier : DBSNPE001817
Drug : DB01016 (Glyburide)
Interacting Gene/Enzyme : Glucose-6-phosphate 1-dehydrogenase
Gene Name : G6PD
UniProt ID : P11413
Defining Change(s) :

  • 821A>T

Allele Name : Lille
Genotype(s) : Not Available
Type(s) : ADR Inferred
Groups : G6PD deficiency
Description : Increased risk of hemolytic anemia.
References :

  1. Meloni G, Meloni T: Glyburide-induced acute haemolysis in a G6PD-deficient patient with NIDDM. Br J Haematol. 1996 Jan;92(1):159-60. [PubMed:8562390 ]
  2. Glyase® PresTab® micronized glyburide tablets[package insert]. New York City, New York: Pharmacia & Upjohn Co, Division of Pfizer Inc; 2015. [Link]

PMID: 19797214

Glyburide

By

Glyburide

Product: Ethynodiol (diacetate)

Identifier : DBSNPE001818
Drug : DB01016 (Glyburide)
Interacting Gene/Enzyme : Glucose-6-phosphate 1-dehydrogenase
Gene Name : G6PD
UniProt ID : P11413
Defining Change(s) :

  • 825G>C

Allele Name : Bangkok
Genotype(s) : Not Available
Type(s) : ADR Inferred
Groups : G6PD deficiency
Description : Increased risk of hemolytic anemia.
References :

  1. Meloni G, Meloni T: Glyburide-induced acute haemolysis in a G6PD-deficient patient with NIDDM. Br J Haematol. 1996 Jan;92(1):159-60. [PubMed:8562390 ]
  2. Glyase® PresTab® micronized glyburide tablets[package insert]. New York City, New York: Pharmacia & Upjohn Co, Division of Pfizer Inc; 2015. [Link]

PMID: 19319185

Glyburide

By

Glyburide

Product: Tilorone (dihydrochloride)

Identifier : DBSNPE001819
Drug : DB01016 (Glyburide)
Interacting Gene/Enzyme : Glucose-6-phosphate 1-dehydrogenase
Gene Name : G6PD
UniProt ID : P11413
Defining Change(s) :

  • 826C->T

Allele Name : Sugao
Genotype(s) : Not Available
Type(s) : ADR Inferred
Groups : G6PD deficiency
Description : Increased risk of hemolytic anemia.
References :

  1. Meloni G, Meloni T: Glyburide-induced acute haemolysis in a G6PD-deficient patient with NIDDM. Br J Haematol. 1996 Jan;92(1):159-60. [PubMed:8562390 ]
  2. Glyase® PresTab® micronized glyburide tablets[package insert]. New York City, New York: Pharmacia & Upjohn Co, Division of Pfizer Inc; 2015. [Link]

PMID: 18549785

Glyburide

By

Glyburide

Product: Suxibuzone

Identifier : DBSNPE001820
Drug : DB01016 (Glyburide)
Interacting Gene/Enzyme : Glucose-6-phosphate 1-dehydrogenase
Gene Name : G6PD
UniProt ID : P11413
Defining Change(s) :

  • 832T->C

Allele Name : La Jolla
Genotype(s) : Not Available
Type(s) : ADR Inferred
Groups : G6PD deficiency
Description : Increased risk of hemolytic anemia.
References :

  1. Meloni G, Meloni T: Glyburide-induced acute haemolysis in a G6PD-deficient patient with NIDDM. Br J Haematol. 1996 Jan;92(1):159-60. [PubMed:8562390 ]
  2. Glyase® PresTab® micronized glyburide tablets[package insert]. New York City, New York: Pharmacia & Upjohn Co, Division of Pfizer Inc; 2015. [Link]

PMID: 17460082

Glyburide

By

Glyburide

Product: Cefazolin (sodium)

Identifier : DBSNPE001821
Drug : DB01016 (Glyburide)
Interacting Gene/Enzyme : Glucose-6-phosphate 1-dehydrogenase
Gene Name : G6PD
UniProt ID : P11413
Defining Change(s) :

  • 833C->T

Allele Name : Wexham
Genotype(s) : Not Available
Type(s) : ADR Inferred
Groups : G6PD deficiency
Description : Increased risk of hemolytic anemia.
References :

  1. Meloni G, Meloni T: Glyburide-induced acute haemolysis in a G6PD-deficient patient with NIDDM. Br J Haematol. 1996 Jan;92(1):159-60. [PubMed:8562390 ]
  2. Glyase® PresTab® micronized glyburide tablets[package insert]. New York City, New York: Pharmacia & Upjohn Co, Division of Pfizer Inc; 2015. [Link]

PMID: 12684257

Glyburide

By

Glyburide

Product: DL-Xylose

Identifier : DBSNPE001822
Drug : DB01016 (Glyburide)
Interacting Gene/Enzyme : Glucose-6-phosphate 1-dehydrogenase
Gene Name : G6PD
UniProt ID : P11413
Defining Change(s) :

  • 851T>C

Allele Name : Piodivkow
Genotype(s) : Not Available
Type(s) : ADR Inferred
Groups : G6PD deficiency
Description : Increased risk of hemolytic anemia.
References :

  1. Meloni G, Meloni T: Glyburide-induced acute haemolysis in a G6PD-deficient patient with NIDDM. Br J Haematol. 1996 Jan;92(1):159-60. [PubMed:8562390 ]
  2. Glyase® PresTab® micronized glyburide tablets[package insert]. New York City, New York: Pharmacia & Upjohn Co, Division of Pfizer Inc; 2015. [Link]

PMID: 11847215

Glyburide

By

Glyburide

Product: Butylhydroxyanisole

Identifier : DBSNPE001823
Drug : DB01016 (Glyburide)
Interacting Gene/Enzyme : Glucose-6-phosphate 1-dehydrogenase
Gene Name : G6PD
UniProt ID : P11413
Defining Change(s) :

  • 910G->T

Allele Name : West Virginia
Genotype(s) : Not Available
Type(s) : ADR Inferred
Groups : G6PD deficiency
Description : Increased risk of hemolytic anemia.
References :

  1. Meloni G, Meloni T: Glyburide-induced acute haemolysis in a G6PD-deficient patient with NIDDM. Br J Haematol. 1996 Jan;92(1):159-60. [PubMed:8562390 ]
  2. Glyase® PresTab® micronized glyburide tablets[package insert]. New York City, New York: Pharmacia & Upjohn Co, Division of Pfizer Inc; 2015. [Link]

PMID: 22311707

Glyburide

By

Glyburide

Product: Luteolin

Identifier : DBSNPE001824
Drug : DB01016 (Glyburide)
Interacting Gene/Enzyme : Glucose-6-phosphate 1-dehydrogenase
Gene Name : G6PD
UniProt ID : P11413
Defining Change(s) :

  • 921G->C

Allele Name : Omiya
Genotype(s) : Not Available
Type(s) : ADR Inferred
Groups : G6PD deficiency
Description : Increased risk of hemolytic anemia.
References :

  1. Meloni G, Meloni T: Glyburide-induced acute haemolysis in a G6PD-deficient patient with NIDDM. Br J Haematol. 1996 Jan;92(1):159-60. [PubMed:8562390 ]
  2. Glyase® PresTab® micronized glyburide tablets[package insert]. New York City, New York: Pharmacia & Upjohn Co, Division of Pfizer Inc; 2015. [Link]

PMID: 12907308

Glyburide

By

Glyburide

Product: 6α-Methylprednisolone 21-hemisuccinate (sodium salt)

Identifier : DBSNPE001825
Drug : DB01016 (Glyburide)
Interacting Gene/Enzyme : Glucose-6-phosphate 1-dehydrogenase
Gene Name : G6PD
UniProt ID : P11413
Defining Change(s) :

  • 953_976delCCACCAAAGGGTACCTGGAC GACC

Allele Name : Nara
Genotype(s) : Not Available
Type(s) : ADR Inferred
Groups : G6PD deficiency
Description : Increased risk of hemolytic anemia.
References :

  1. Meloni G, Meloni T: Glyburide-induced acute haemolysis in a G6PD-deficient patient with NIDDM. Br J Haematol. 1996 Jan;92(1):159-60. [PubMed:8562390 ]
  2. Glyase® PresTab® micronized glyburide tablets[package insert]. New York City, New York: Pharmacia & Upjohn Co, Division of Pfizer Inc; 2015. [Link]

PMID: 11166323

Glyburide

By

Glyburide

Product: Ftaxilide

Identifier : DBSNPE001826
Drug : DB01016 (Glyburide)
Interacting Gene/Enzyme : Glucose-6-phosphate 1-dehydrogenase
Gene Name : G6PD
UniProt ID : P11413
Defining Change(s) :

  • 962G->A

Allele Name : Manhattan
Genotype(s) : Not Available
Type(s) : ADR Inferred
Groups : G6PD deficiency
Description : Increased risk of hemolytic anemia.
References :

  1. Meloni G, Meloni T: Glyburide-induced acute haemolysis in a G6PD-deficient patient with NIDDM. Br J Haematol. 1996 Jan;92(1):159-60. [PubMed:8562390 ]
  2. Glyase® PresTab® micronized glyburide tablets[package insert]. New York City, New York: Pharmacia & Upjohn Co, Division of Pfizer Inc; 2015. [Link]

PMID: 27708052

Glyburide

By

Glyburide

Product: L-Cysteine methyl ester (hydrochloride)

Identifier : DBSNPE001827
Drug : DB01016 (Glyburide)
Interacting Gene/Enzyme : Glucose-6-phosphate 1-dehydrogenase
Gene Name : G6PD
UniProt ID : P11413
Defining Change(s) :

  • 964T->C

Allele Name : Rehevot
Genotype(s) : Not Available
Type(s) : ADR Inferred
Groups : G6PD deficiency
Description : Increased risk of hemolytic anemia.
References :

  1. Meloni G, Meloni T: Glyburide-induced acute haemolysis in a G6PD-deficient patient with NIDDM. Br J Haematol. 1996 Jan;92(1):159-60. [PubMed:8562390 ]
  2. Glyase® PresTab® micronized glyburide tablets[package insert]. New York City, New York: Pharmacia & Upjohn Co, Division of Pfizer Inc; 2015. [Link]

PMID: 21868676

Glyburide

By

Glyburide

Product: Brigatinib

Identifier : DBSNPE001828
Drug : DB01016 (Glyburide)
Interacting Gene/Enzyme : Glucose-6-phosphate 1-dehydrogenase
Gene Name : G6PD
UniProt ID : P11413
Defining Change(s) :

  • 99A->G
  • 1360C->T

Allele Name : Honiara
Genotype(s) : Not Available
Type(s) : ADR Inferred
Groups : G6PD deficiency
Description : Increased risk of hemolytic anemia.
References :

  1. Meloni G, Meloni T: Glyburide-induced acute haemolysis in a G6PD-deficient patient with NIDDM. Br J Haematol. 1996 Jan;92(1):159-60. [PubMed:8562390 ]
  2. Glyase® PresTab® micronized glyburide tablets[package insert]. New York City, New York: Pharmacia & Upjohn Co, Division of Pfizer Inc; 2015. [Link]

PMID: 17884634

Glyburide

By

Glyburide

Product: Tetrahydropalmatine

Identifier : DBSNPE001829
Drug : DB01016 (Glyburide)
Interacting Gene/Enzyme : Glucose-6-phosphate 1-dehydrogenase
Gene Name : G6PD
UniProt ID : P11413
Defining Change(s) :

  • 1246G->A

Allele Name : Tokyo, Fukushima
Genotype(s) : Not Available
Type(s) : ADR Inferred
Groups : G6PD deficiency
Description : Increased risk of hemolytic anemia.
References :

  1. Meloni G, Meloni T: Glyburide-induced acute haemolysis in a G6PD-deficient patient with NIDDM. Br J Haematol. 1996 Jan;92(1):159-60. [PubMed:8562390 ]
  2. Glyase® PresTab® micronized glyburide tablets[package insert]. New York City, New York: Pharmacia & Upjohn Co, Division of Pfizer Inc; 2015. [Link]

PMID: 8880068

Glyburide

By

Glyburide

Product: Caftaric acid

Identifier : DBSNPE001830
Drug : DB01016 (Glyburide)
Interacting Gene/Enzyme : Glucose-6-phosphate 1-dehydrogenase
Gene Name : G6PD
UniProt ID : P11413
Defining Change(s) :

  • 1003G->A

Allele Name : Chatham
Genotype(s) : Not Available
Type(s) : ADR Inferred
Groups : G6PD deficiency
Description : Increased risk of hemolytic anemia.
References :

  1. Meloni G, Meloni T: Glyburide-induced acute haemolysis in a G6PD-deficient patient with NIDDM. Br J Haematol. 1996 Jan;92(1):159-60. [PubMed:8562390 ]
  2. Glyase® PresTab® micronized glyburide tablets[package insert]. New York City, New York: Pharmacia & Upjohn Co, Division of Pfizer Inc; 2015. [Link]

PMID: 8719808

Glyburide

By

Glyburide

Product: Curdione

Identifier : DBSNPE001831
Drug : DB01016 (Glyburide)
Interacting Gene/Enzyme : Glucose-6-phosphate 1-dehydrogenase
Gene Name : G6PD
UniProt ID : P11413
Defining Change(s) :

  • 1004C->A

Allele Name : Fushan
Genotype(s) : Not Available
Type(s) : ADR Inferred
Groups : G6PD deficiency
Description : Increased risk of hemolytic anemia.
References :

  1. Meloni G, Meloni T: Glyburide-induced acute haemolysis in a G6PD-deficient patient with NIDDM. Br J Haematol. 1996 Jan;92(1):159-60. [PubMed:8562390 ]
  2. Glyase® PresTab® micronized glyburide tablets[package insert]. New York City, New York: Pharmacia & Upjohn Co, Division of Pfizer Inc; 2015. [Link]

PMID: 7796182

Glyburide

By

Glyburide

Product: Rhynchophylline

Identifier : DBSNPE001832
Drug : DB01016 (Glyburide)
Interacting Gene/Enzyme : Glucose-6-phosphate 1-dehydrogenase
Gene Name : G6PD
UniProt ID : P11413
Defining Change(s) :

  • 1052G->T

Allele Name : Partenope
Genotype(s) : Not Available
Type(s) : ADR Inferred
Groups : G6PD deficiency
Description : Increased risk of hemolytic anemia.
References :

  1. Meloni G, Meloni T: Glyburide-induced acute haemolysis in a G6PD-deficient patient with NIDDM. Br J Haematol. 1996 Jan;92(1):159-60. [PubMed:8562390 ]
  2. Glyase® PresTab® micronized glyburide tablets[package insert]. New York City, New York: Pharmacia & Upjohn Co, Division of Pfizer Inc; 2015. [Link]

PMID: 10336568

Glyburide

By

Glyburide

Product: Corosolic acid

Identifier : DBSNPE001833
Drug : DB01016 (Glyburide)
Interacting Gene/Enzyme : Glucose-6-phosphate 1-dehydrogenase
Gene Name : G6PD
UniProt ID : P11413
Defining Change(s) :

  • 1057C->T

Allele Name : Ierapediva
Genotype(s) : Not Available
Type(s) : ADR Inferred
Groups : G6PD deficiency
Description : Increased risk of hemolytic anemia.
References :

  1. Meloni G, Meloni T: Glyburide-induced acute haemolysis in a G6PD-deficient patient with NIDDM. Br J Haematol. 1996 Jan;92(1):159-60. [PubMed:8562390 ]
  2. Glyase® PresTab® micronized glyburide tablets[package insert]. New York City, New York: Pharmacia & Upjohn Co, Division of Pfizer Inc; 2015. [Link]

PMID: 2544728

Glyburide

By

Glyburide

Product: (-)-Catechin gallate

Identifier : DBSNPE001834
Drug : DB01016 (Glyburide)
Interacting Gene/Enzyme : Glucose-6-phosphate 1-dehydrogenase
Gene Name : G6PD
UniProt ID : P11413
Defining Change(s) :

  • 1193A->G

Allele Name : Anadia
Genotype(s) : Not Available
Type(s) : ADR Inferred
Groups : G6PD deficiency
Description : Increased risk of hemolytic anemia.
References :

  1. Meloni G, Meloni T: Glyburide-induced acute haemolysis in a G6PD-deficient patient with NIDDM. Br J Haematol. 1996 Jan;92(1):159-60. [PubMed:8562390 ]
  2. Glyase® PresTab® micronized glyburide tablets[package insert]. New York City, New York: Pharmacia & Upjohn Co, Division of Pfizer Inc; 2015. [Link]

PMID: 18664603

Glyburide

By

Glyburide

Product: Ononin

Identifier : DBSNPE001835
Drug : DB01016 (Glyburide)
Interacting Gene/Enzyme : Glucose-6-phosphate 1-dehydrogenase
Gene Name : G6PD
UniProt ID : P11413
Defining Change(s) :

  • 1220A->C

Allele Name : Abeno
Genotype(s) : Not Available
Type(s) : ADR Inferred
Groups : G6PD deficiency
Description : Increased risk of hemolytic anemia.
References :

  1. Meloni G, Meloni T: Glyburide-induced acute haemolysis in a G6PD-deficient patient with NIDDM. Br J Haematol. 1996 Jan;92(1):159-60. [PubMed:8562390 ]
  2. Glyase® PresTab® micronized glyburide tablets[package insert]. New York City, New York: Pharmacia & Upjohn Co, Division of Pfizer Inc; 2015. [Link]

PMID: 18255102

Glyburide

By

Glyburide

Product: Epmedin C

Identifier : DBSNPE001836
Drug : DB01016 (Glyburide)
Interacting Gene/Enzyme : Glucose-6-phosphate 1-dehydrogenase
Gene Name : G6PD
UniProt ID : P11413
Defining Change(s) :

  • 1291G->A

Allele Name : Surabaya
Genotype(s) : Not Available
Type(s) : ADR Inferred
Groups : G6PD deficiency
Description : Increased risk of hemolytic anemia.
References :

  1. Meloni G, Meloni T: Glyburide-induced acute haemolysis in a G6PD-deficient patient with NIDDM. Br J Haematol. 1996 Jan;92(1):159-60. [PubMed:8562390 ]
  2. Glyase® PresTab® micronized glyburide tablets[package insert]. New York City, New York: Pharmacia & Upjohn Co, Division of Pfizer Inc; 2015. [Link]

PMID: 18625254

Glyburide

By

Glyburide

Product: Epimedin B

Identifier : DBSNPE001837
Drug : DB01016 (Glyburide)
Interacting Gene/Enzyme : Glucose-6-phosphate 1-dehydrogenase
Gene Name : G6PD
UniProt ID : P11413
Defining Change(s) :

  • 1316G->C

Allele Name : Pawnee
Genotype(s) : Not Available
Type(s) : ADR Inferred
Groups : G6PD deficiency
Description : Increased risk of hemolytic anemia.
References :

  1. Meloni G, Meloni T: Glyburide-induced acute haemolysis in a G6PD-deficient patient with NIDDM. Br J Haematol. 1996 Jan;92(1):159-60. [PubMed:8562390 ]
  2. Glyase® PresTab® micronized glyburide tablets[package insert]. New York City, New York: Pharmacia & Upjohn Co, Division of Pfizer Inc; 2015. [Link]

PMID: 3020251

Glyburide

By

Glyburide

Product: Aconine

Identifier : DBSNPE001839
Drug : DB01016 (Glyburide)
Interacting Gene/Enzyme : Glucose-6-phosphate 1-dehydrogenase
Gene Name : G6PD
UniProt ID : P11413
Defining Change(s) :

  • 1347G->C

Allele Name : Cassano
Genotype(s) : Not Available
Type(s) : ADR Inferred
Groups : G6PD deficiency
Description : Increased risk of hemolytic anemia.
References :

  1. Meloni G, Meloni T: Glyburide-induced acute haemolysis in a G6PD-deficient patient with NIDDM. Br J Haematol. 1996 Jan;92(1):159-60. [PubMed:8562390 ]
  2. Glyase® PresTab® micronized glyburide tablets[package insert]. New York City, New York: Pharmacia & Upjohn Co, Division of Pfizer Inc; 2015. [Link]

PMID: 9121605

Glyburide

By

Glyburide

Product: Flaconitine

Identifier : DBSNPE001840
Drug : DB01016 (Glyburide)
Interacting Gene/Enzyme : Glucose-6-phosphate 1-dehydrogenase
Gene Name : G6PD
UniProt ID : P11413
Defining Change(s) :

  • 1347G->C
  • 1360C->T

Allele Name : Hermoupolis
Genotype(s) : Not Available
Type(s) : ADR Inferred
Groups : G6PD deficiency
Description : Increased risk of hemolytic anemia.
References :

  1. Meloni G, Meloni T: Glyburide-induced acute haemolysis in a G6PD-deficient patient with NIDDM. Br J Haematol. 1996 Jan;92(1):159-60. [PubMed:8562390 ]
  2. Glyase® PresTab® micronized glyburide tablets[package insert]. New York City, New York: Pharmacia & Upjohn Co, Division of Pfizer Inc; 2015. [Link]

PMID: 8922731

Glyburide

By

Glyburide

Product: Lappaconitine

Identifier : DBSNPE001841
Drug : DB01016 (Glyburide)
Interacting Gene/Enzyme : Glucose-6-phosphate 1-dehydrogenase
Gene Name : G6PD
UniProt ID : P11413
Defining Change(s) :

  • 1360C->T

Allele Name : Union,Maewo, Chinese-2, Kalo
Genotype(s) : Not Available
Type(s) : ADR Inferred
Groups : G6PD deficiency
Description : Increased risk of hemolytic anemia.
References :

  1. Meloni G, Meloni T: Glyburide-induced acute haemolysis in a G6PD-deficient patient with NIDDM. Br J Haematol. 1996 Jan;92(1):159-60. [PubMed:8562390 ]
  2. Glyase® PresTab® micronized glyburide tablets[package insert]. New York City, New York: Pharmacia & Upjohn Co, Division of Pfizer Inc; 2015. [Link]

PMID: 10530814

Glyburide

By

Glyburide

Product: Hypaconitine

Identifier : DBSNPE001842
Drug : DB01016 (Glyburide)
Interacting Gene/Enzyme : Glucose-6-phosphate 1-dehydrogenase
Gene Name : G6PD
UniProt ID : P11413
Defining Change(s) :

  • 1361G->A

Allele Name : Andalus
Genotype(s) : Not Available
Type(s) : ADR Inferred
Groups : G6PD deficiency
Description : Increased risk of hemolytic anemia.
References :

  1. Meloni G, Meloni T: Glyburide-induced acute haemolysis in a G6PD-deficient patient with NIDDM. Br J Haematol. 1996 Jan;92(1):159-60. [PubMed:8562390 ]
  2. Glyase® PresTab® micronized glyburide tablets[package insert]. New York City, New York: Pharmacia & Upjohn Co, Division of Pfizer Inc; 2015. [Link]

PMID: 9886667

Glyburide

By

Glyburide

Product: BD-1047 (dihydrobromide)

Identifier : DBSNPE001843
Drug : DB01016 (Glyburide)
Interacting Gene/Enzyme : Glucose-6-phosphate 1-dehydrogenase
Gene Name : G6PD
UniProt ID : P11413
Defining Change(s) :

  • 1376G->C

Allele Name : Cosenza
Genotype(s) : Not Available
Type(s) : ADR Inferred
Groups : G6PD deficiency
Description : Increased risk of hemolytic anemia.
References :

  1. Meloni G, Meloni T: Glyburide-induced acute haemolysis in a G6PD-deficient patient with NIDDM. Br J Haematol. 1996 Jan;92(1):159-60. [PubMed:8562390 ]
  2. Glyase® PresTab® micronized glyburide tablets[package insert]. New York City, New York: Pharmacia & Upjohn Co, Division of Pfizer Inc; 2015. [Link]

PMID: 9680254

Glyburide

By

Glyburide

Product: Modaline (sulfate)

Identifier : DBSNPE001844
Drug : DB01016 (Glyburide)
Interacting Gene/Enzyme : Glucose-6-phosphate 1-dehydrogenase
Gene Name : G6PD
UniProt ID : P11413
Defining Change(s) :

  • 1376G->T

Allele Name : Canton, Taiwan- Hakka, Gifu-like, Agrigento-like
Genotype(s) : Not Available
Type(s) : ADR Inferred
Groups : G6PD deficiency
Description : Increased risk of hemolytic anemia.
References :

  1. Meloni G, Meloni T: Glyburide-induced acute haemolysis in a G6PD-deficient patient with NIDDM. Br J Haematol. 1996 Jan;92(1):159-60. [PubMed:8562390 ]
  2. Glyase® PresTab® micronized glyburide tablets[package insert]. New York City, New York: Pharmacia & Upjohn Co, Division of Pfizer Inc; 2015. [Link]

PMID: 9464367

Glyburide

By

Glyburide

Product: Gliquidone

Identifier : DBSNPE001845
Drug : DB01016 (Glyburide)
Interacting Gene/Enzyme : Glucose-6-phosphate 1-dehydrogenase
Gene Name : G6PD
UniProt ID : P11413
Defining Change(s) :

  • 1387C->A

Allele Name : Flores
Genotype(s) : Not Available
Type(s) : ADR Inferred
Groups : G6PD deficiency
Description : Increased risk of hemolytic anemia.
References :

  1. Meloni G, Meloni T: Glyburide-induced acute haemolysis in a G6PD-deficient patient with NIDDM. Br J Haematol. 1996 Jan;92(1):159-60. [PubMed:8562390 ]
  2. Glyase® PresTab® micronized glyburide tablets[package insert]. New York City, New York: Pharmacia & Upjohn Co, Division of Pfizer Inc; 2015. [Link]

PMID: 25568131

Glyburide

By

Glyburide

Product: Pramocaine (hydrochloride)

Identifier : DBSNPE001846
Drug : DB01016 (Glyburide)
Interacting Gene/Enzyme : Glucose-6-phosphate 1-dehydrogenase
Gene Name : G6PD
UniProt ID : P11413
Defining Change(s) :

  • 1388G->A

Allele Name : Kaiping, Anant, Dhon, Sapporo-like, Wosera
Genotype(s) : Not Available
Type(s) : ADR Inferred
Groups : G6PD deficiency
Description : Increased risk of hemolytic anemia.
References :

  1. Meloni G, Meloni T: Glyburide-induced acute haemolysis in a G6PD-deficient patient with NIDDM. Br J Haematol. 1996 Jan;92(1):159-60. [PubMed:8562390 ]
  2. Glyase® PresTab® micronized glyburide tablets[package insert]. New York City, New York: Pharmacia & Upjohn Co, Division of Pfizer Inc; 2015. [Link]

PMID: 25673837

Glyburide

By

Glyburide

Product: Secnidazole

Identifier : DBSNPE001847
Drug : DB01016 (Glyburide)
Interacting Gene/Enzyme : Glucose-6-phosphate 1-dehydrogenase
Gene Name : G6PD
UniProt ID : P11413
Defining Change(s) :

  • 169C->T

Allele Name : Kamogawa
Genotype(s) : Not Available
Type(s) : ADR Inferred
Groups : G6PD deficiency
Description : Increased risk of hemolytic anemia.
References :

  1. Meloni G, Meloni T: Glyburide-induced acute haemolysis in a G6PD-deficient patient with NIDDM. Br J Haematol. 1996 Jan;92(1):159-60. [PubMed:8562390 ]
  2. Glyase® PresTab® micronized glyburide tablets[package insert]. New York City, New York: Pharmacia & Upjohn Co, Division of Pfizer Inc; 2015. [Link]

PMID: 26655894

Glyburide

By

Glyburide

Product: Penfluridol

Identifier : DBSNPE001848
Drug : DB01016 (Glyburide)
Interacting Gene/Enzyme : Glucose-6-phosphate 1-dehydrogenase
Gene Name : G6PD
UniProt ID : P11413
Defining Change(s) :

  • 179T>C

Allele Name : Costanzo
Genotype(s) : Not Available
Type(s) : ADR Inferred
Groups : G6PD deficiency
Description : Increased risk of hemolytic anemia.
References :

  1. Meloni G, Meloni T: Glyburide-induced acute haemolysis in a G6PD-deficient patient with NIDDM. Br J Haematol. 1996 Jan;92(1):159-60. [PubMed:8562390 ]
  2. Glyase® PresTab® micronized glyburide tablets[package insert]. New York City, New York: Pharmacia & Upjohn Co, Division of Pfizer Inc; 2015. [Link]

PMID: 25889381

Glyburide

By

Glyburide

Product: Morantel (tartrate)

Identifier : DBSNPE001849
Drug : DB01016 (Glyburide)
Interacting Gene/Enzyme : Glucose-6-phosphate 1-dehydrogenase
Gene Name : G6PD
UniProt ID : P11413
Defining Change(s) :

  • 185C->A

Allele Name : Amazonia
Genotype(s) : Not Available
Type(s) : ADR Inferred
Groups : G6PD deficiency
Description : Increased risk of hemolytic anemia.
References :

  1. Meloni G, Meloni T: Glyburide-induced acute haemolysis in a G6PD-deficient patient with NIDDM. Br J Haematol. 1996 Jan;92(1):159-60. [PubMed:8562390 ]
  2. Glyase® PresTab® micronized glyburide tablets[package insert]. New York City, New York: Pharmacia & Upjohn Co, Division of Pfizer Inc; 2015. [Link]

PMID: 25505386

Glyburide

By

Glyburide

Product: Molsidomine

Identifier : DBSNPE001850
Drug : DB01016 (Glyburide)
Interacting Gene/Enzyme : Glucose-6-phosphate 1-dehydrogenase
Gene Name : G6PD
UniProt ID : P11413
Defining Change(s) :

  • 196T->A

Allele Name : Songklanagarind
Genotype(s) : Not Available
Type(s) : ADR Inferred
Groups : G6PD deficiency
Description : Increased risk of hemolytic anemia.
References :

  1. Meloni G, Meloni T: Glyburide-induced acute haemolysis in a G6PD-deficient patient with NIDDM. Br J Haematol. 1996 Jan;92(1):159-60. [PubMed:8562390 ]
  2. Glyase® PresTab® micronized glyburide tablets[package insert]. New York City, New York: Pharmacia & Upjohn Co, Division of Pfizer Inc; 2015. [Link]

PMID: 24559655

Glyburide

By

Glyburide

Product: Antazoline (hydrochloride)

Identifier : DBSNPE001852
Drug : DB01016 (Glyburide)
Interacting Gene/Enzyme : Glucose-6-phosphate 1-dehydrogenase
Gene Name : G6PD
UniProt ID : P11413
Defining Change(s) :

  • 208T->C

Allele Name : Namouru
Genotype(s) : Not Available
Type(s) : ADR Inferred
Groups : G6PD deficiency
Description : Increased risk of hemolytic anemia.
References :

  1. Meloni G, Meloni T: Glyburide-induced acute haemolysis in a G6PD-deficient patient with NIDDM. Br J Haematol. 1996 Jan;92(1):159-60. [PubMed:8562390 ]
  2. Glyase® PresTab® micronized glyburide tablets[package insert]. New York City, New York: Pharmacia & Upjohn Co, Division of Pfizer Inc; 2015. [Link]

PMID: 23378895

Glyburide

By

Glyburide

Product: Clindamycin (phosphate)

Identifier : DBSNPE001853
Drug : DB01016 (Glyburide)
Interacting Gene/Enzyme : Glucose-6-phosphate 1-dehydrogenase
Gene Name : G6PD
UniProt ID : P11413
Defining Change(s) :

  • 352T>C

Allele Name : Bao Loc
Genotype(s) : Not Available
Type(s) : ADR Inferred
Groups : G6PD deficiency
Description : Increased risk of hemolytic anemia.
References :

  1. Meloni G, Meloni T: Glyburide-induced acute haemolysis in a G6PD-deficient patient with NIDDM. Br J Haematol. 1996 Jan;92(1):159-60. [PubMed:8562390 ]
  2. Glyase® PresTab® micronized glyburide tablets[package insert]. New York City, New York: Pharmacia & Upjohn Co, Division of Pfizer Inc; 2015. [Link]

PMID: 21628565

Glyburide

By

Glyburide

Product: Terpin (hydrate)

Identifier : DBSNPE001854
Drug : DB01016 (Glyburide)
Interacting Gene/Enzyme : Glucose-6-phosphate 1-dehydrogenase
Gene Name : G6PD
UniProt ID : P11413
Defining Change(s) :

  • 375G->T, 379G->T383T->C384C>T

Allele Name : Crispim
Genotype(s) : Not Available
Type(s) : ADR Inferred
Groups : G6PD deficiency
Description : Increased risk of hemolytic anemia.
References :

  1. Meloni G, Meloni T: Glyburide-induced acute haemolysis in a G6PD-deficient patient with NIDDM. Br J Haematol. 1996 Jan;92(1):159-60. [PubMed:8562390 ]
  2. Glyase® PresTab® micronized glyburide tablets[package insert]. New York City, New York: Pharmacia & Upjohn Co, Division of Pfizer Inc; 2015. [Link]

PMID: 20217053

Glyburide

By

Glyburide

Product: Dexchlorpheniramine (maleate)

Identifier : DBSNPE001855
Drug : DB01016 (Glyburide)
Interacting Gene/Enzyme : Glucose-6-phosphate 1-dehydrogenase
Gene Name : G6PD
UniProt ID : P11413
Defining Change(s) :

  • 376A->G
  • 463C->G

Allele Name : Acrokorinthos
Genotype(s) : Not Available
Type(s) : ADR Inferred
Groups : G6PD deficiency
Description : Increased risk of hemolytic anemia.
References :

  1. Meloni G, Meloni T: Glyburide-induced acute haemolysis in a G6PD-deficient patient with NIDDM. Br J Haematol. 1996 Jan;92(1):159-60. [PubMed:8562390 ]
  2. Glyase® PresTab® micronized glyburide tablets[package insert]. New York City, New York: Pharmacia & Upjohn Co, Division of Pfizer Inc; 2015. [Link]

PMID: 19026992

Glyburide

By

Glyburide

Product: Benfluorex (hydrochloride)

Identifier : DBSNPE001856
Drug : DB01016 (Glyburide)
Interacting Gene/Enzyme : Glucose-6-phosphate 1-dehydrogenase
Gene Name : G6PD
UniProt ID : P11413
Defining Change(s) :

  • 376A->G
  • 542A->T

Allele Name : Santa Maria
Genotype(s) : Not Available
Type(s) : ADR Inferred
Groups : G6PD deficiency
Description : Increased risk of hemolytic anemia.
References :

  1. Meloni G, Meloni T: Glyburide-induced acute haemolysis in a G6PD-deficient patient with NIDDM. Br J Haematol. 1996 Jan;92(1):159-60. [PubMed:8562390 ]
  2. Glyase® PresTab® micronized glyburide tablets[package insert]. New York City, New York: Pharmacia & Upjohn Co, Division of Pfizer Inc; 2015. [Link]

PMID: 19255473

Glyburide

By

Glyburide

Product: Nefopam (hydrochloride)

Identifier : DBSNPE001857
Drug : DB01016 (Glyburide)
Interacting Gene/Enzyme : Glucose-6-phosphate 1-dehydrogenase
Gene Name : G6PD
UniProt ID : P11413
Defining Change(s) :

  • 376A->G
  • 871G->A

Allele Name : Ananindeua
Genotype(s) : Not Available
Type(s) : ADR Inferred
Groups : G6PD deficiency
Description : Increased risk of hemolytic anemia.
References :

  1. Meloni G, Meloni T: Glyburide-induced acute haemolysis in a G6PD-deficient patient with NIDDM. Br J Haematol. 1996 Jan;92(1):159-60. [PubMed:8562390 ]
  2. Glyase® PresTab® micronized glyburide tablets[package insert]. New York City, New York: Pharmacia & Upjohn Co, Division of Pfizer Inc; 2015. [Link]

PMID: 19776267

Glyburide

By

Glyburide

Product: Lofexidine (hydrochloride)

Identifier : DBSNPE001858
Drug : DB01016 (Glyburide)
Interacting Gene/Enzyme : Glucose-6-phosphate 1-dehydrogenase
Gene Name : G6PD
UniProt ID : P11413
Defining Change(s) :

  • 383T->C

Allele Name : Vanua Lava
Genotype(s) : Not Available
Type(s) : ADR Inferred
Groups : G6PD deficiency
Description : Increased risk of hemolytic anemia.
References :

  1. Meloni G, Meloni T: Glyburide-induced acute haemolysis in a G6PD-deficient patient with NIDDM. Br J Haematol. 1996 Jan;92(1):159-60. [PubMed:8562390 ]
  2. Glyase® PresTab® micronized glyburide tablets[package insert]. New York City, New York: Pharmacia & Upjohn Co, Division of Pfizer Inc; 2015. [Link]

PMID: 17728701

Glyburide

By

Glyburide

Product: Gemifloxacin (mesylate)

Identifier : DBSNPE001859
Drug : DB01016 (Glyburide)
Interacting Gene/Enzyme : Glucose-6-phosphate 1-dehydrogenase
Gene Name : G6PD
UniProt ID : P11413
Defining Change(s) :

  • 406C->T

Allele Name : Valladolid
Genotype(s) : Not Available
Type(s) : ADR Inferred
Groups : G6PD deficiency
Description : Increased risk of hemolytic anemia.
References :

  1. Meloni G, Meloni T: Glyburide-induced acute haemolysis in a G6PD-deficient patient with NIDDM. Br J Haematol. 1996 Jan;92(1):159-60. [PubMed:8562390 ]
  2. Glyase® PresTab® micronized glyburide tablets[package insert]. New York City, New York: Pharmacia & Upjohn Co, Division of Pfizer Inc; 2015. [Link]

PMID: 18305255

Glyburide

By

Glyburide

Product: Chlorazanil (hydrochloride)

Identifier : DBSNPE001860
Drug : DB01016 (Glyburide)
Interacting Gene/Enzyme : Glucose-6-phosphate 1-dehydrogenase
Gene Name : G6PD
UniProt ID : P11413
Defining Change(s) :

  • 409C->T

Allele Name : Belem
Genotype(s) : Not Available
Type(s) : ADR Inferred
Groups : G6PD deficiency
Description : Increased risk of hemolytic anemia.
References :

  1. Meloni G, Meloni T: Glyburide-induced acute haemolysis in a G6PD-deficient patient with NIDDM. Br J Haematol. 1996 Jan;92(1):159-60. [PubMed:8562390 ]
  2. Glyase® PresTab® micronized glyburide tablets[package insert]. New York City, New York: Pharmacia & Upjohn Co, Division of Pfizer Inc; 2015. [Link]

PMID: 17597589

Glyburide

By

Glyburide

Product: Oxolamine (citrate)

Identifier : DBSNPE001861
Drug : DB01016 (Glyburide)
Interacting Gene/Enzyme : Glucose-6-phosphate 1-dehydrogenase
Gene Name : G6PD
UniProt ID : P11413
Defining Change(s) :

  • 442G->A

Allele Name : Liuzhou
Genotype(s) : Not Available
Type(s) : ADR Inferred
Groups : G6PD deficiency
Description : Increased risk of hemolytic anemia.
References :

  1. Meloni G, Meloni T: Glyburide-induced acute haemolysis in a G6PD-deficient patient with NIDDM. Br J Haematol. 1996 Jan;92(1):159-60. [PubMed:8562390 ]
  2. Glyase® PresTab® micronized glyburide tablets[package insert]. New York City, New York: Pharmacia & Upjohn Co, Division of Pfizer Inc; 2015. [Link]

PMID: 8864697

Glyburide

By

Glyburide

Product: Aminoguanidine (hydrochloride)

Identifier : DBSNPE001862
Drug : DB01016 (Glyburide)
Interacting Gene/Enzyme : Glucose-6-phosphate 1-dehydrogenase
Gene Name : G6PD
UniProt ID : P11413
Defining Change(s) :

  • 473G>A

Allele Name : Shenzen
Genotype(s) : Not Available
Type(s) : ADR Inferred
Groups : G6PD deficiency
Description : Increased risk of hemolytic anemia.
References :

  1. Meloni G, Meloni T: Glyburide-induced acute haemolysis in a G6PD-deficient patient with NIDDM. Br J Haematol. 1996 Jan;92(1):159-60. [PubMed:8562390 ]
  2. Glyase® PresTab® micronized glyburide tablets[package insert]. New York City, New York: Pharmacia & Upjohn Co, Division of Pfizer Inc; 2015. [Link]

PMID: 8730745

Glyburide

By

Glyburide

Product: Levobunolol (hydrochloride)

Identifier : DBSNPE001863
Drug : DB01016 (Glyburide)
Interacting Gene/Enzyme : Glucose-6-phosphate 1-dehydrogenase
Gene Name : G6PD
UniProt ID : P11413
Defining Change(s) :

  • 493A->G

Allele Name : Taipei “Chinese- 3”
Genotype(s) : Not Available
Type(s) : ADR Inferred
Groups : G6PD deficiency
Description : Increased risk of hemolytic anemia.
References :

  1. Meloni G, Meloni T: Glyburide-induced acute haemolysis in a G6PD-deficient patient with NIDDM. Br J Haematol. 1996 Jan;92(1):159-60. [PubMed:8562390 ]
  2. Glyase® PresTab® micronized glyburide tablets[package insert]. New York City, New York: Pharmacia & Upjohn Co, Division of Pfizer Inc; 2015. [Link]

PMID: 7753406

Glyburide

By

Glyburide

Product: DL-Panthenol

Identifier : DBSNPE001864
Drug : DB01016 (Glyburide)
Interacting Gene/Enzyme : Glucose-6-phosphate 1-dehydrogenase
Gene Name : G6PD
UniProt ID : P11413
Defining Change(s) :

  • 496C>T

Allele Name : Toledo
Genotype(s) : Not Available
Type(s) : ADR Inferred
Groups : G6PD deficiency
Description : Increased risk of hemolytic anemia.
References :

  1. Meloni G, Meloni T: Glyburide-induced acute haemolysis in a G6PD-deficient patient with NIDDM. Br J Haematol. 1996 Jan;92(1):159-60. [PubMed:8562390 ]
  2. Glyase® PresTab® micronized glyburide tablets[package insert]. New York City, New York: Pharmacia & Upjohn Co, Division of Pfizer Inc; 2015. [Link]

PMID: 7921606

Glyburide

By

Glyburide

Product: Phenelzine (sulfate)

Identifier : DBSNPE001865
Drug : DB01016 (Glyburide)
Interacting Gene/Enzyme : Glucose-6-phosphate 1-dehydrogenase
Gene Name : G6PD
UniProt ID : P11413
Defining Change(s) :

  • 497G->A

Allele Name : Naone
Genotype(s) : Not Available
Type(s) : ADR Inferred
Groups : G6PD deficiency
Description : Increased risk of hemolytic anemia.
References :

  1. Meloni G, Meloni T: Glyburide-induced acute haemolysis in a G6PD-deficient patient with NIDDM. Br J Haematol. 1996 Jan;92(1):159-60. [PubMed:8562390 ]
  2. Glyase® PresTab® micronized glyburide tablets[package insert]. New York City, New York: Pharmacia & Upjohn Co, Division of Pfizer Inc; 2015. [Link]

PMID: 17609420

Glyburide

By

Glyburide

Product: Etosalamide

Identifier : DBSNPE001866
Drug : DB01016 (Glyburide)
Interacting Gene/Enzyme : Glucose-6-phosphate 1-dehydrogenase
Gene Name : G6PD
UniProt ID : P11413
Defining Change(s) :

  • 517T->C

Allele Name : Nankang
Genotype(s) : Not Available
Type(s) : ADR Inferred
Groups : G6PD deficiency
Description : Increased risk of hemolytic anemia.
References :

  1. Meloni G, Meloni T: Glyburide-induced acute haemolysis in a G6PD-deficient patient with NIDDM. Br J Haematol. 1996 Jan;92(1):159-60. [PubMed:8562390 ]
  2. Glyase® PresTab® micronized glyburide tablets[package insert]. New York City, New York: Pharmacia & Upjohn Co, Division of Pfizer Inc; 2015. [Link]

PMID: 8864696

Glyburide

By

Glyburide

Product: Ethylenediaminetetraacetic acid (trisodium salt)

Identifier : DBSNPE001867
Drug : DB01016 (Glyburide)
Interacting Gene/Enzyme : Glucose-6-phosphate 1-dehydrogenase
Gene Name : G6PD
UniProt ID : P11413
Defining Change(s) :

  • 519C->G

Allele Name : Miaoli
Genotype(s) : Not Available
Type(s) : ADR Inferred
Groups : G6PD deficiency
Description : Increased risk of hemolytic anemia.
References :

  1. Meloni G, Meloni T: Glyburide-induced acute haemolysis in a G6PD-deficient patient with NIDDM. Br J Haematol. 1996 Jan;92(1):159-60. [PubMed:8562390 ]
  2. Glyase® PresTab® micronized glyburide tablets[package insert]. New York City, New York: Pharmacia & Upjohn Co, Division of Pfizer Inc; 2015. [Link]

PMID: 8730739

Glyburide

By

Glyburide

Product: Hydroquinidine

Identifier : DBSNPE001868
Drug : DB01016 (Glyburide)
Interacting Gene/Enzyme : Glucose-6-phosphate 1-dehydrogenase
Gene Name : G6PD
UniProt ID : P11413
Defining Change(s) :

  • 563C->T

Allele Name : Mediterranean, Dallas, Panama‚ Sassari, Cagliari, Birmingham
Genotype(s) : Not Available
Type(s) : ADR Inferred
Groups : G6PD deficiency
Description : Increased risk of hemolytic anemia.
References :

  1. Meloni G, Meloni T: Glyburide-induced acute haemolysis in a G6PD-deficient patient with NIDDM. Br J Haematol. 1996 Jan;92(1):159-60. [PubMed:8562390 ]
  2. Glyase® PresTab® micronized glyburide tablets[package insert]. New York City, New York: Pharmacia & Upjohn Co, Division of Pfizer Inc; 2015. [Link]

PMID: 8734494

Glyburide

By

Glyburide

Product: 4,5-Dicaffeoylquinic acid

Identifier : DBSNPE001869
Drug : DB01016 (Glyburide)
Interacting Gene/Enzyme : Glucose-6-phosphate 1-dehydrogenase
Gene Name : G6PD
UniProt ID : P11413
Defining Change(s) :

  • 592C->T

Allele Name : Coimbra Shunde
Genotype(s) : Not Available
Type(s) : ADR Inferred
Groups : G6PD deficiency
Description : Increased risk of hemolytic anemia.
References :

  1. Meloni G, Meloni T: Glyburide-induced acute haemolysis in a G6PD-deficient patient with NIDDM. Br J Haematol. 1996 Jan;92(1):159-60. [PubMed:8562390 ]
  2. Glyase® PresTab® micronized glyburide tablets[package insert]. New York City, New York: Pharmacia & Upjohn Co, Division of Pfizer Inc; 2015. [Link]

PMID: 8532166

Glyburide

By

Glyburide

Product: Cryptochlorogenic acid

Identifier : DBSNPE001870
Drug : DB01016 (Glyburide)
Interacting Gene/Enzyme : Glucose-6-phosphate 1-dehydrogenase
Gene Name : G6PD
UniProt ID : P11413
Defining Change(s) :

  • 593G>A

Allele Name : Nilgiri
Genotype(s) : Not Available
Type(s) : ADR Inferred
Groups : G6PD deficiency
Description : Increased risk of hemolytic anemia.
References :

  1. Meloni G, Meloni T: Glyburide-induced acute haemolysis in a G6PD-deficient patient with NIDDM. Br J Haematol. 1996 Jan;92(1):159-60. [PubMed:8562390 ]
  2. Glyase® PresTab® micronized glyburide tablets[package insert]. New York City, New York: Pharmacia & Upjohn Co, Division of Pfizer Inc; 2015. [Link]

PMID: 8887973

Glyburide

By

Glyburide

Product: Ginkgolic Acid (C13:0)

Identifier : DBSNPE001871
Drug : DB01016 (Glyburide)
Interacting Gene/Enzyme : Glucose-6-phosphate 1-dehydrogenase
Gene Name : G6PD
UniProt ID : P11413
Defining Change(s) :

  • 679C->T

Allele Name : Radlowo
Genotype(s) : Not Available
Type(s) : ADR Inferred
Groups : G6PD deficiency
Description : Increased risk of hemolytic anemia.
References :

  1. Meloni G, Meloni T: Glyburide-induced acute haemolysis in a G6PD-deficient patient with NIDDM. Br J Haematol. 1996 Jan;92(1):159-60. [PubMed:8562390 ]
  2. Glyase® PresTab® micronized glyburide tablets[package insert]. New York City, New York: Pharmacia & Upjohn Co, Division of Pfizer Inc; 2015. [Link]

PMID: 25866824

Glyburide

By

Glyburide

Product: Ginkgolide C

Identifier : DBSNPE001872
Drug : DB01016 (Glyburide)
Interacting Gene/Enzyme : Glucose-6-phosphate 1-dehydrogenase
Gene Name : G6PD
UniProt ID : P11413
Defining Change(s) :

  • 811G>C

Allele Name : Roubaix
Genotype(s) : Not Available
Type(s) : ADR Inferred
Groups : G6PD deficiency
Description : Increased risk of hemolytic anemia.
References :

  1. Meloni G, Meloni T: Glyburide-induced acute haemolysis in a G6PD-deficient patient with NIDDM. Br J Haematol. 1996 Jan;92(1):159-60. [PubMed:8562390 ]
  2. Glyase® PresTab® micronized glyburide tablets[package insert]. New York City, New York: Pharmacia & Upjohn Co, Division of Pfizer Inc; 2015. [Link]

PMID: 16825311

Glyburide

By

Glyburide

Product: Ginkgolide B

Identifier : DBSNPE001873
Drug : DB01016 (Glyburide)
Interacting Gene/Enzyme : Glucose-6-phosphate 1-dehydrogenase
Gene Name : G6PD
UniProt ID : P11413
Defining Change(s) :

  • 835A->G

Allele Name : Haikou
Genotype(s) : Not Available
Type(s) : ADR Inferred
Groups : G6PD deficiency
Description : Increased risk of hemolytic anemia.
References :

  1. Meloni G, Meloni T: Glyburide-induced acute haemolysis in a G6PD-deficient patient with NIDDM. Br J Haematol. 1996 Jan;92(1):159-60. [PubMed:8562390 ]
  2. Glyase® PresTab® micronized glyburide tablets[package insert]. New York City, New York: Pharmacia & Upjohn Co, Division of Pfizer Inc; 2015. [Link]

PMID: 12922940

Glyburide

By

Glyburide

Product: Lappaconitine (hydrobromide)

Identifier : DBSNPE001874
Drug : DB01016 (Glyburide)
Interacting Gene/Enzyme : Glucose-6-phosphate 1-dehydrogenase
Gene Name : G6PD
UniProt ID : P11413
Defining Change(s) :

  • 835A->T

Allele Name : Chinese-1
Genotype(s) : Not Available
Type(s) : ADR Inferred
Groups : G6PD deficiency
Description : Increased risk of hemolytic anemia.
References :

  1. Meloni G, Meloni T: Glyburide-induced acute haemolysis in a G6PD-deficient patient with NIDDM. Br J Haematol. 1996 Jan;92(1):159-60. [PubMed:8562390 ]
  2. Glyase® PresTab® micronized glyburide tablets[package insert]. New York City, New York: Pharmacia & Upjohn Co, Division of Pfizer Inc; 2015. [Link]

PMID: 11277518

Glyburide

By

Glyburide

Product: Indaconitine

Identifier : DBSNPE001875
Drug : DB01016 (Glyburide)
Interacting Gene/Enzyme : Glucose-6-phosphate 1-dehydrogenase
Gene Name : G6PD
UniProt ID : P11413
Defining Change(s) :

  • 848A>G

Allele Name : Mizushima
Genotype(s) : Not Available
Type(s) : ADR Inferred
Groups : G6PD deficiency
Description : Increased risk of hemolytic anemia.
References :

  1. Meloni G, Meloni T: Glyburide-induced acute haemolysis in a G6PD-deficient patient with NIDDM. Br J Haematol. 1996 Jan;92(1):159-60. [PubMed:8562390 ]
  2. Glyase® PresTab® micronized glyburide tablets[package insert]. New York City, New York: Pharmacia & Upjohn Co, Division of Pfizer Inc; 2015. [Link]

PMID: 24596089

Glyburide

By

Glyburide

Product: C-7280948

Identifier : DBSNPE001876
Drug : DB01016 (Glyburide)
Interacting Gene/Enzyme : Glucose-6-phosphate 1-dehydrogenase
Gene Name : G6PD
UniProt ID : P11413
Defining Change(s) :

  • 853C->T

Allele Name : Osaka
Genotype(s) : Not Available
Type(s) : ADR Inferred
Groups : G6PD deficiency
Description : Increased risk of hemolytic anemia.
References :

  1. Meloni G, Meloni T: Glyburide-induced acute haemolysis in a G6PD-deficient patient with NIDDM. Br J Haematol. 1996 Jan;92(1):159-60. [PubMed:8562390 ]
  2. Glyase® PresTab® micronized glyburide tablets[package insert]. New York City, New York: Pharmacia & Upjohn Co, Division of Pfizer Inc; 2015. [Link]

PMID: 27199672

Glyburide

By

Glyburide

Product: Sulfaguanidine

Identifier : DBSNPE001877
Drug : DB01016 (Glyburide)
Interacting Gene/Enzyme : Glucose-6-phosphate 1-dehydrogenase
Gene Name : G6PD
UniProt ID : P11413
Defining Change(s) :

  • 871G->A

Allele Name : Viangchan, Jammu
Genotype(s) : Not Available
Type(s) : ADR Inferred
Groups : G6PD deficiency
Description : Increased risk of hemolytic anemia.
References :

  1. Meloni G, Meloni T: Glyburide-induced acute haemolysis in a G6PD-deficient patient with NIDDM. Br J Haematol. 1996 Jan;92(1):159-60. [PubMed:8562390 ]
  2. Glyase® PresTab® micronized glyburide tablets[package insert]. New York City, New York: Pharmacia & Upjohn Co, Division of Pfizer Inc; 2015. [Link]

PMID: 25972184

Glyburide

By

Glyburide

Product: Climbazole

Identifier : DBSNPE001878
Drug : DB01016 (Glyburide)
Interacting Gene/Enzyme : Glucose-6-phosphate 1-dehydrogenase
Gene Name : G6PD
UniProt ID : P11413
Defining Change(s) :

  • 916G->A

Allele Name : Seoul
Genotype(s) : Not Available
Type(s) : ADR Inferred
Groups : G6PD deficiency
Description : Increased risk of hemolytic anemia.
References :

  1. Meloni G, Meloni T: Glyburide-induced acute haemolysis in a G6PD-deficient patient with NIDDM. Br J Haematol. 1996 Jan;92(1):159-60. [PubMed:8562390 ]
  2. Glyase® PresTab® micronized glyburide tablets[package insert]. New York City, New York: Pharmacia & Upjohn Co, Division of Pfizer Inc; 2015. [Link]

PMID: 21382421

Glyburide

By

Glyburide

Product: Betamipron

Identifier : DBSNPE001879
Drug : DB01016 (Glyburide)
Interacting Gene/Enzyme : Glucose-6-phosphate 1-dehydrogenase
Gene Name : G6PD
UniProt ID : P11413
Defining Change(s) :

  • 929G->A

Allele Name : Ludhiana
Genotype(s) : Not Available
Type(s) : ADR Inferred
Groups : G6PD deficiency
Description : Increased risk of hemolytic anemia.
References :

  1. Meloni G, Meloni T: Glyburide-induced acute haemolysis in a G6PD-deficient patient with NIDDM. Br J Haematol. 1996 Jan;92(1):159-60. [PubMed:8562390 ]
  2. Glyase® PresTab® micronized glyburide tablets[package insert]. New York City, New York: Pharmacia & Upjohn Co, Division of Pfizer Inc; 2015. [Link]

PMID: 20385173

Glyburide

By

Glyburide

Product: Flibanserin

Identifier : DBSNPE001880
Drug : DB01016 (Glyburide)
Interacting Gene/Enzyme : Glucose-6-phosphate 1-dehydrogenase
Gene Name : G6PD
UniProt ID : P11413
Defining Change(s) :

  • 977C->A

Allele Name : Farroupilha
Genotype(s) : Not Available
Type(s) : ADR Inferred
Groups : G6PD deficiency
Description : Increased risk of hemolytic anemia.
References :

  1. Meloni G, Meloni T: Glyburide-induced acute haemolysis in a G6PD-deficient patient with NIDDM. Br J Haematol. 1996 Jan;92(1):159-60. [PubMed:8562390 ]
  2. Glyase® PresTab® micronized glyburide tablets[package insert]. New York City, New York: Pharmacia & Upjohn Co, Division of Pfizer Inc; 2015. [Link]

PMID: 10530811

Glyburide

By

Glyburide

Product: RAD140

Identifier : DBSNPE001881
Drug : DB01016 (Glyburide)
Interacting Gene/Enzyme : Glucose-6-phosphate 1-dehydrogenase
Gene Name : G6PD
UniProt ID : P11413
Defining Change(s) :

  • 1024C->T

Allele Name : Chinese-5
Genotype(s) : Not Available
Type(s) : ADR Inferred
Groups : G6PD deficiency
Description : Increased risk of hemolytic anemia.
References :

  1. Meloni G, Meloni T: Glyburide-induced acute haemolysis in a G6PD-deficient patient with NIDDM. Br J Haematol. 1996 Jan;92(1):159-60. [PubMed:8562390 ]
  2. Glyase® PresTab® micronized glyburide tablets[package insert]. New York City, New York: Pharmacia & Upjohn Co, Division of Pfizer Inc; 2015. [Link]

PMID: 10455248

Glyburide

By

Glyburide

Product: SR9009

Identifier : DBSNPE001882
Drug : DB01016 (Glyburide)
Interacting Gene/Enzyme : Glucose-6-phosphate 1-dehydrogenase
Gene Name : G6PD
UniProt ID : P11413
Defining Change(s) :

  • 130G>A

Allele Name : Rignano
Genotype(s) : Not Available
Type(s) : ADR Inferred
Groups : G6PD deficiency
Description : Increased risk of hemolytic anemia.
References :

  1. Meloni G, Meloni T: Glyburide-induced acute haemolysis in a G6PD-deficient patient with NIDDM. Br J Haematol. 1996 Jan;92(1):159-60. [PubMed:8562390 ]
  2. Glyase® PresTab® micronized glyburide tablets[package insert]. New York City, New York: Pharmacia & Upjohn Co, Division of Pfizer Inc; 2015. [Link]

PMID: 25885370

Glyburide

By

Glyburide

Product: SR9011

Identifier : DBSNPE001883
Drug : DB01016 (Glyburide)
Interacting Gene/Enzyme : Glucose-6-phosphate 1-dehydrogenase
Gene Name : G6PD
UniProt ID : P11413
Defining Change(s) :

  • 131C->G

Allele Name : Orissa
Genotype(s) : Not Available
Type(s) : ADR Inferred
Groups : G6PD deficiency
Description : Increased risk of hemolytic anemia.
References :

  1. Meloni G, Meloni T: Glyburide-induced acute haemolysis in a G6PD-deficient patient with NIDDM. Br J Haematol. 1996 Jan;92(1):159-60. [PubMed:8562390 ]
  2. Glyase® PresTab® micronized glyburide tablets[package insert]. New York City, New York: Pharmacia & Upjohn Co, Division of Pfizer Inc; 2015. [Link]

PMID: 25739080

Glyburide

By

Glyburide

Product: Tyloxapol

Identifier : DBSNPE001884
Drug : DB01016 (Glyburide)
Interacting Gene/Enzyme : Glucose-6-phosphate 1-dehydrogenase
Gene Name : G6PD
UniProt ID : P11413
Defining Change(s) :

  • 1380G>C

Allele Name : G6PDNice
Genotype(s) : Not Available
Type(s) : ADR Inferred
Groups : G6PD deficiency
Description : Increased risk of hemolytic anemia.
References :

  1. Meloni G, Meloni T: Glyburide-induced acute haemolysis in a G6PD-deficient patient with NIDDM. Br J Haematol. 1996 Jan;92(1):159-60. [PubMed:8562390 ]
  2. Glyase® PresTab® micronized glyburide tablets[package insert]. New York City, New York: Pharmacia & Upjohn Co, Division of Pfizer Inc; 2015. [Link]

PMID: 25241804

Glyburide

By

Glyburide

Product: Aceglutamide

Identifier : DBSNPE001885
Drug : DB01016 (Glyburide)
Interacting Gene/Enzyme : Glucose-6-phosphate 1-dehydrogenase
Gene Name : G6PD
UniProt ID : P11413
Defining Change(s) :

  • 1387C->T

Allele Name : Kamiube, Keelung
Genotype(s) : Not Available
Type(s) : ADR Inferred
Groups : G6PD deficiency
Description : Increased risk of hemolytic anemia.
References :

  1. Meloni G, Meloni T: Glyburide-induced acute haemolysis in a G6PD-deficient patient with NIDDM. Br J Haematol. 1996 Jan;92(1):159-60. [PubMed:8562390 ]
  2. Glyase® PresTab® micronized glyburide tablets[package insert]. New York City, New York: Pharmacia & Upjohn Co, Division of Pfizer Inc; 2015. [Link]

PMID: 24279870

Glyburide

By

Glyburide

Product: Sulisobenzone

Identifier : DBSNPE001886
Drug : DB01016 (Glyburide)
Interacting Gene/Enzyme : Glucose-6-phosphate 1-dehydrogenase
Gene Name : G6PD
UniProt ID : P11413
Defining Change(s) :

  • 1400C->G

Allele Name : Neapolis
Genotype(s) : Not Available
Type(s) : ADR Inferred
Groups : G6PD deficiency
Description : Increased risk of hemolytic anemia.
References :

  1. Meloni G, Meloni T: Glyburide-induced acute haemolysis in a G6PD-deficient patient with NIDDM. Br J Haematol. 1996 Jan;92(1):159-60. [PubMed:8562390 ]
  2. Glyase® PresTab® micronized glyburide tablets[package insert]. New York City, New York: Pharmacia & Upjohn Co, Division of Pfizer Inc; 2015. [Link]

PMID: 24236200

Glyburide

By

Glyburide

Product: Imidazolidinyl urea

Identifier : DBSNPE001887
Drug : DB01016 (Glyburide)
Interacting Gene/Enzyme : Glucose-6-phosphate 1-dehydrogenase
Gene Name : G6PD
UniProt ID : P11413
Defining Change(s) :

  • 143T->C

Allele Name : Aures
Genotype(s) : Not Available
Type(s) : ADR Inferred
Groups : G6PD deficiency
Description : Increased risk of hemolytic anemia.
References :

  1. Meloni G, Meloni T: Glyburide-induced acute haemolysis in a G6PD-deficient patient with NIDDM. Br J Haematol. 1996 Jan;92(1):159-60. [PubMed:8562390 ]
  2. Glyase® PresTab® micronized glyburide tablets[package insert]. New York City, New York: Pharmacia & Upjohn Co, Division of Pfizer Inc; 2015. [Link]

PMID: 23199080

Glyburide

By

Glyburide

Product: Cefradine

Identifier : DBSNPE001888
Drug : DB01016 (Glyburide)
Interacting Gene/Enzyme : Glucose-6-phosphate 1-dehydrogenase
Gene Name : G6PD
UniProt ID : P11413
Defining Change(s) :

  • 1442C->G

Allele Name : Split
Genotype(s) : Not Available
Type(s) : ADR Inferred
Groups : G6PD deficiency
Description : Increased risk of hemolytic anemia.
References :

  1. Meloni G, Meloni T: Glyburide-induced acute haemolysis in a G6PD-deficient patient with NIDDM. Br J Haematol. 1996 Jan;92(1):159-60. [PubMed:8562390 ]
  2. Glyase® PresTab® micronized glyburide tablets[package insert]. New York City, New York: Pharmacia & Upjohn Co, Division of Pfizer Inc; 2015. [Link]

PMID: 23951097

Glyburide

By

Glyburide

Product: pGlu-Pro-Arg-MNA (monoacetate)

Identifier : DBSNPE001889
Drug : DB01016 (Glyburide)
Interacting Gene/Enzyme : Glucose-6-phosphate 1-dehydrogenase
Gene Name : G6PD
UniProt ID : P11413
Defining Change(s) :

  • 148C->T

Allele Name : Kambos
Genotype(s) : Not Available
Type(s) : ADR Inferred
Groups : G6PD deficiency
Description : Increased risk of hemolytic anemia.
References :

  1. Meloni G, Meloni T: Glyburide-induced acute haemolysis in a G6PD-deficient patient with NIDDM. Br J Haematol. 1996 Jan;92(1):159-60. [PubMed:8562390 ]
  2. Glyase® PresTab® micronized glyburide tablets[package insert]. New York City, New York: Pharmacia & Upjohn Co, Division of Pfizer Inc; 2015. [Link]

PMID: 22900020

Glyburide

By

Glyburide

Product: Tos-Gly-Pro-Arg-ANBA-IPA (acetate)

Identifier : DBSNPE001890
Drug : DB01016 (Glyburide)
Interacting Gene/Enzyme : Glucose-6-phosphate 1-dehydrogenase
Gene Name : G6PD
UniProt ID : P11413
Defining Change(s) :

  • 170G>A

Allele Name : Palesdivina
Genotype(s) : Not Available
Type(s) : ADR Inferred
Groups : G6PD deficiency
Description : Increased risk of hemolytic anemia.
References :

  1. Meloni G, Meloni T: Glyburide-induced acute haemolysis in a G6PD-deficient patient with NIDDM. Br J Haematol. 1996 Jan;92(1):159-60. [PubMed:8562390 ]
  2. Glyase® PresTab® micronized glyburide tablets[package insert]. New York City, New York: Pharmacia & Upjohn Co, Division of Pfizer Inc; 2015. [Link]

PMID: 23055491

Glyburide

By

Glyburide

Product: D-Lys(Z)-Pro-Arg-pNA (diacetate)

Identifier : DBSNPE001891
Drug : DB01016 (Glyburide)
Interacting Gene/Enzyme : Glucose-6-phosphate 1-dehydrogenase
Gene Name : G6PD
UniProt ID : P11413
Defining Change(s) :

  • 172G->A

Allele Name : Metaponto
Genotype(s) : Not Available
Type(s) : ADR Inferred
Groups : G6PD deficiency
Description : Increased risk of hemolytic anemia.
References :

  1. Meloni G, Meloni T: Glyburide-induced acute haemolysis in a G6PD-deficient patient with NIDDM. Br J Haematol. 1996 Jan;92(1):159-60. [PubMed:8562390 ]
  2. Glyase® PresTab® micronized glyburide tablets[package insert]. New York City, New York: Pharmacia & Upjohn Co, Division of Pfizer Inc; 2015. [Link]

PMID: 22186670

Glyburide

By

Glyburide

Product: Carbetapentane (citrate)

Identifier : DBSNPE001892
Drug : DB01016 (Glyburide)
Interacting Gene/Enzyme : Glucose-6-phosphate 1-dehydrogenase
Gene Name : G6PD
UniProt ID : P11413
Defining Change(s) :

  • 185C->T

Allele Name : Musashino
Genotype(s) : Not Available
Type(s) : ADR Inferred
Groups : G6PD deficiency
Description : Increased risk of hemolytic anemia.
References :

  1. Meloni G, Meloni T: Glyburide-induced acute haemolysis in a G6PD-deficient patient with NIDDM. Br J Haematol. 1996 Jan;92(1):159-60. [PubMed:8562390 ]
  2. Glyase® PresTab® micronized glyburide tablets[package insert]. New York City, New York: Pharmacia & Upjohn Co, Division of Pfizer Inc; 2015. [Link]

PMID: 22114157

Glyburide

By

Glyburide

Product: Iotalamic acid

Identifier : DBSNPE001893
Drug : DB01016 (Glyburide)
Interacting Gene/Enzyme : Glucose-6-phosphate 1-dehydrogenase
Gene Name : G6PD
UniProt ID : P11413
Defining Change(s) :

  • 202G->A

Allele Name : Asahi
Genotype(s) : Not Available
Type(s) : ADR Inferred
Groups : G6PD deficiency
Description : Increased risk of hemolytic anemia.
References :

  1. Meloni G, Meloni T: Glyburide-induced acute haemolysis in a G6PD-deficient patient with NIDDM. Br J Haematol. 1996 Jan;92(1):159-60. [PubMed:8562390 ]
  2. Glyase® PresTab® micronized glyburide tablets[package insert]. New York City, New York: Pharmacia & Upjohn Co, Division of Pfizer Inc; 2015. [Link]

PMID: 21153406

Glyburide

By

Glyburide

Product: Flumethasone

Identifier : DBSNPE001894
Drug : DB01016 (Glyburide)
Interacting Gene/Enzyme : Glucose-6-phosphate 1-dehydrogenase
Gene Name : G6PD
UniProt ID : P11413
Defining Change(s) :

  • 202G->A
  • 376A->G

Allele Name : A- (202), Ferrara I
Genotype(s) : Not Available
Type(s) : ADR Inferred
Groups : G6PD deficiency
Description : Increased risk of hemolytic anemia.
References :

  1. Meloni G, Meloni T: Glyburide-induced acute haemolysis in a G6PD-deficient patient with NIDDM. Br J Haematol. 1996 Jan;92(1):159-60. [PubMed:8562390 ]
  2. Glyase® PresTab® micronized glyburide tablets[package insert]. New York City, New York: Pharmacia & Upjohn Co, Division of Pfizer Inc; 2015. [Link]

PMID: 21103359

Glyburide

By

Glyburide

Product: Digoxin

Identifier : DBSNPE001895
Drug : DB01016 (Glyburide)
Interacting Gene/Enzyme : Glucose-6-phosphate 1-dehydrogenase
Gene Name : G6PD
UniProt ID : P11413
Defining Change(s) :

  • 209A->G

Allele Name : Murcia Oristano
Genotype(s) : Not Available
Type(s) : ADR Inferred
Groups : G6PD deficiency
Description : Increased risk of hemolytic anemia.
References :

  1. Meloni G, Meloni T: Glyburide-induced acute haemolysis in a G6PD-deficient patient with NIDDM. Br J Haematol. 1996 Jan;92(1):159-60. [PubMed:8562390 ]
  2. Glyase® PresTab® micronized glyburide tablets[package insert]. New York City, New York: Pharmacia & Upjohn Co, Division of Pfizer Inc; 2015. [Link]

PMID: 21075228

Glyburide

By

Glyburide

Product: Pasiniazid

Identifier : DBSNPE001896
Drug : DB01016 (Glyburide)
Interacting Gene/Enzyme : Glucose-6-phosphate 1-dehydrogenase
Gene Name : G6PD
UniProt ID : P11413
Defining Change(s) :

  • 241C->T

Allele Name : Ube Konan
Genotype(s) : Not Available
Type(s) : ADR Inferred
Groups : G6PD deficiency
Description : Increased risk of hemolytic anemia.
References :

  1. Meloni G, Meloni T: Glyburide-induced acute haemolysis in a G6PD-deficient patient with NIDDM. Br J Haematol. 1996 Jan;92(1):159-60. [PubMed:8562390 ]
  2. Glyase® PresTab® micronized glyburide tablets[package insert]. New York City, New York: Pharmacia & Upjohn Co, Division of Pfizer Inc; 2015. [Link]

PMID: 19277215

Glyburide

By

Glyburide

Product: Carsalam

Identifier : DBSNPE001897
Drug : DB01016 (Glyburide)
Interacting Gene/Enzyme : Glucose-6-phosphate 1-dehydrogenase
Gene Name : G6PD
UniProt ID : P11413
Defining Change(s) :

  • 242G->A

Allele Name : Lagosanto
Genotype(s) : Not Available
Type(s) : ADR Inferred
Groups : G6PD deficiency
Description : Increased risk of hemolytic anemia.
References :

  1. Meloni G, Meloni T: Glyburide-induced acute haemolysis in a G6PD-deficient patient with NIDDM. Br J Haematol. 1996 Jan;92(1):159-60. [PubMed:8562390 ]
  2. Glyase® PresTab® micronized glyburide tablets[package insert]. New York City, New York: Pharmacia & Upjohn Co, Division of Pfizer Inc; 2015. [Link]

PMID: 18364018

Glyburide

By

Glyburide

Product: Piromidic acid

Identifier : DBSNPE001898
Drug : DB01016 (Glyburide)
Interacting Gene/Enzyme : Glucose-6-phosphate 1-dehydrogenase
Gene Name : G6PD
UniProt ID : P11413
Defining Change(s) :

  • 274C->T

Allele Name : Guangzhou
Genotype(s) : Not Available
Type(s) : ADR Inferred
Groups : G6PD deficiency
Description : Increased risk of hemolytic anemia.
References :

  1. Meloni G, Meloni T: Glyburide-induced acute haemolysis in a G6PD-deficient patient with NIDDM. Br J Haematol. 1996 Jan;92(1):159-60. [PubMed:8562390 ]
  2. Glyase® PresTab® micronized glyburide tablets[package insert]. New York City, New York: Pharmacia & Upjohn Co, Division of Pfizer Inc; 2015. [Link]

PMID: 18923032

Glyburide

By

Glyburide

Product: Decoquinate

Identifier : DBSNPE001899
Drug : DB01016 (Glyburide)
Interacting Gene/Enzyme : Glucose-6-phosphate 1-dehydrogenase
Gene Name : G6PD
UniProt ID : P11413
Defining Change(s) :

  • 323T->A

Allele Name : Hammersmith
Genotype(s) : Not Available
Type(s) : ADR Inferred
Groups : G6PD deficiency
Description : Increased risk of hemolytic anemia.
References :

  1. Meloni G, Meloni T: Glyburide-induced acute haemolysis in a G6PD-deficient patient with NIDDM. Br J Haematol. 1996 Jan;92(1):159-60. [PubMed:8562390 ]
  2. Glyase® PresTab® micronized glyburide tablets[package insert]. New York City, New York: Pharmacia & Upjohn Co, Division of Pfizer Inc; 2015. [Link]

PMID: 16855085

Glyburide

By

Glyburide

Product: Vanitiolide

Identifier : DBSNPE001900
Drug : DB01016 (Glyburide)
Interacting Gene/Enzyme : Glucose-6-phosphate 1-dehydrogenase
Gene Name : G6PD
UniProt ID : P11413
Defining Change(s) :

  • 34G->T

Allele Name : Sinnai
Genotype(s) : Not Available
Type(s) : ADR Inferred
Groups : G6PD deficiency
Description : Increased risk of hemolytic anemia.
References :

  1. Meloni G, Meloni T: Glyburide-induced acute haemolysis in a G6PD-deficient patient with NIDDM. Br J Haematol. 1996 Jan;92(1):159-60. [PubMed:8562390 ]
  2. Glyase® PresTab® micronized glyburide tablets[package insert]. New York City, New York: Pharmacia & Upjohn Co, Division of Pfizer Inc; 2015. [Link]

PMID: 15958386

Glyburide

By

Glyburide

Product: Metergoline

Identifier : DBSNPE001901
Drug : DB01016 (Glyburide)
Interacting Gene/Enzyme : Glucose-6-phosphate 1-dehydrogenase
Gene Name : G6PD
UniProt ID : P11413
Defining Change(s) :

  • 376A->G
  • 680G->T

Allele Name : A- (680)
Genotype(s) : Not Available
Type(s) : ADR Inferred
Groups : G6PD deficiency
Description : Increased risk of hemolytic anemia.
References :

  1. Meloni G, Meloni T: Glyburide-induced acute haemolysis in a G6PD-deficient patient with NIDDM. Br J Haematol. 1996 Jan;92(1):159-60. [PubMed:8562390 ]
  2. Glyase® PresTab® micronized glyburide tablets[package insert]. New York City, New York: Pharmacia & Upjohn Co, Division of Pfizer Inc; 2015. [Link]

PMID: 16051747

Glyburide

By

Glyburide

Product: Lanatoside C

Identifier : DBSNPE001902
Drug : DB01016 (Glyburide)
Interacting Gene/Enzyme : Glucose-6-phosphate 1-dehydrogenase
Gene Name : G6PD
UniProt ID : P11413
Defining Change(s) :

  • 376A->G
  • 968T->C

Allele Name : A- (968), Betica,Selma, Guantanamo
Genotype(s) : Not Available
Type(s) : ADR Inferred
Groups : G6PD deficiency
Description : Increased risk of hemolytic anemia.
References :

  1. Meloni G, Meloni T: Glyburide-induced acute haemolysis in a G6PD-deficient patient with NIDDM. Br J Haematol. 1996 Jan;92(1):159-60. [PubMed:8562390 ]
  2. Glyase® PresTab® micronized glyburide tablets[package insert]. New York City, New York: Pharmacia & Upjohn Co, Division of Pfizer Inc; 2015. [Link]

PMID: 18575586

Glyburide

By

Glyburide

Product: Danazol

Identifier : DBSNPE001903
Drug : DB01016 (Glyburide)
Interacting Gene/Enzyme : Glucose-6-phosphate 1-dehydrogenase
Gene Name : G6PD
UniProt ID : P11413
Defining Change(s) :

  • 383T>G

Allele Name : Salerno Pyrgos
Genotype(s) : Not Available
Type(s) : ADR Inferred
Groups : G6PD deficiency
Description : Increased risk of hemolytic anemia.
References :

  1. Meloni G, Meloni T: Glyburide-induced acute haemolysis in a G6PD-deficient patient with NIDDM. Br J Haematol. 1996 Jan;92(1):159-60. [PubMed:8562390 ]
  2. Glyase® PresTab® micronized glyburide tablets[package insert]. New York City, New York: Pharmacia & Upjohn Co, Division of Pfizer Inc; 2015. [Link]

PMID: 10854901

Glyburide

By

Glyburide

Product: BI605906

Identifier : DBSNPE001904
Drug : DB01016 (Glyburide)
Interacting Gene/Enzyme : Glucose-6-phosphate 1-dehydrogenase
Gene Name : G6PD
UniProt ID : P11413
Defining Change(s) :

  • 392G->T

Allele Name : Quing Yan
Genotype(s) : Not Available
Type(s) : ADR Inferred
Groups : G6PD deficiency
Description : Increased risk of hemolytic anemia.
References :

  1. Meloni G, Meloni T: Glyburide-induced acute haemolysis in a G6PD-deficient patient with NIDDM. Br J Haematol. 1996 Jan;92(1):159-60. [PubMed:8562390 ]
  2. Glyase® PresTab® micronized glyburide tablets[package insert]. New York City, New York: Pharmacia & Upjohn Co, Division of Pfizer Inc; 2015. [Link]

PMID: 10381773

Glyburide

By

Glyburide

Product: LGD-4033

Identifier : DBSNPE001905
Drug : DB01016 (Glyburide)
Interacting Gene/Enzyme : Glucose-6-phosphate 1-dehydrogenase
Gene Name : G6PD
UniProt ID : P11413
Defining Change(s) :

  • 40G->A

Allele Name : Lages
Genotype(s) : Not Available
Type(s) : ADR Inferred
Groups : G6PD deficiency
Description : Increased risk of hemolytic anemia.
References :

  1. Meloni G, Meloni T: Glyburide-induced acute haemolysis in a G6PD-deficient patient with NIDDM. Br J Haematol. 1996 Jan;92(1):159-60. [PubMed:8562390 ]
  2. Glyase® PresTab® micronized glyburide tablets[package insert]. New York City, New York: Pharmacia & Upjohn Co, Division of Pfizer Inc; 2015. [Link]

PMID: 21688779

Glyburide

By

Glyburide

Product: Acetylleucine

Identifier : DBSNPE001906
Drug : DB01016 (Glyburide)
Interacting Gene/Enzyme : Glucose-6-phosphate 1-dehydrogenase
Gene Name : G6PD
UniProt ID : P11413
Defining Change(s) :

  • 466G->A

Allele Name : Ilesha
Genotype(s) : Not Available
Type(s) : ADR Inferred
Groups : G6PD deficiency
Description : Increased risk of hemolytic anemia.
References :

  1. Meloni G, Meloni T: Glyburide-induced acute haemolysis in a G6PD-deficient patient with NIDDM. Br J Haematol. 1996 Jan;92(1):159-60. [PubMed:8562390 ]
  2. Glyase® PresTab® micronized glyburide tablets[package insert]. New York City, New York: Pharmacia & Upjohn Co, Division of Pfizer Inc; 2015. [Link]

PMID: 20638279

Glyburide

By

Glyburide

Product: Medrysone

Identifier : DBSNPE001907
Drug : DB01016 (Glyburide)
Interacting Gene/Enzyme : Glucose-6-phosphate 1-dehydrogenase
Gene Name : G6PD
UniProt ID : P11413
Defining Change(s) :

  • 487G->A

Allele Name : Mahidol
Genotype(s) : Not Available
Type(s) : ADR Inferred
Groups : G6PD deficiency
Description : Increased risk of hemolytic anemia.
References :

  1. Meloni G, Meloni T: Glyburide-induced acute haemolysis in a G6PD-deficient patient with NIDDM. Br J Haematol. 1996 Jan;92(1):159-60. [PubMed:8562390 ]
  2. Glyase® PresTab® micronized glyburide tablets[package insert]. New York City, New York: Pharmacia & Upjohn Co, Division of Pfizer Inc; 2015. [Link]

PMID: 27055390

Glyburide

By

Glyburide

Product: Fosfomycin (calcium)

Identifier : DBSNPE001908
Drug : DB01016 (Glyburide)
Interacting Gene/Enzyme : Glucose-6-phosphate 1-dehydrogenase
Gene Name : G6PD
UniProt ID : P11413
Defining Change(s) :

  • 542A->T

Allele Name : Malaga
Genotype(s) : Not Available
Type(s) : ADR Inferred
Groups : G6PD deficiency
Description : Increased risk of hemolytic anemia.
References :

  1. Meloni G, Meloni T: Glyburide-induced acute haemolysis in a G6PD-deficient patient with NIDDM. Br J Haematol. 1996 Jan;92(1):159-60. [PubMed:8562390 ]
  2. Glyase® PresTab® micronized glyburide tablets[package insert]. New York City, New York: Pharmacia & Upjohn Co, Division of Pfizer Inc; 2015. [Link]

PMID: 21247167

Glyburide

By

Glyburide

Product: Ethamsylate

Identifier : DBSNPE001909
Drug : DB01016 (Glyburide)
Interacting Gene/Enzyme : Glucose-6-phosphate 1-dehydrogenase
Gene Name : G6PD
UniProt ID : P11413
Defining Change(s) :

  • 634A->G

Allele Name : Sibari
Genotype(s) : Not Available
Type(s) : ADR Inferred
Groups : G6PD deficiency
Description : Increased risk of hemolytic anemia.
References :

  1. Meloni G, Meloni T: Glyburide-induced acute haemolysis in a G6PD-deficient patient with NIDDM. Br J Haematol. 1996 Jan;92(1):159-60. [PubMed:8562390 ]
  2. Glyase® PresTab® micronized glyburide tablets[package insert]. New York City, New York: Pharmacia & Upjohn Co, Division of Pfizer Inc; 2015. [Link]

PMID: 19469556

Glyburide

By

Glyburide

Product: Phenothrin

Identifier : DBSNPE001910
Drug : DB01016 (Glyburide)
Interacting Gene/Enzyme : Glucose-6-phosphate 1-dehydrogenase
Gene Name : G6PD
UniProt ID : P11413
Defining Change(s) :

  • 680G->A

Allele Name : Mexico City
Genotype(s) : Not Available
Type(s) : ADR Inferred
Groups : G6PD deficiency
Description : Increased risk of hemolytic anemia.
References :

  1. Meloni G, Meloni T: Glyburide-induced acute haemolysis in a G6PD-deficient patient with NIDDM. Br J Haematol. 1996 Jan;92(1):159-60. [PubMed:8562390 ]
  2. Glyase® PresTab® micronized glyburide tablets[package insert]. New York City, New York: Pharmacia & Upjohn Co, Division of Pfizer Inc; 2015. [Link]

PMID: 20667732

Glyburide

By

Glyburide

Product: Lasalocid

Identifier : DBSNPE001911
Drug : DB01016 (Glyburide)
Interacting Gene/Enzyme : Glucose-6-phosphate 1-dehydrogenase
Gene Name : G6PD
UniProt ID : P11413
Defining Change(s) :

  • 703C->T

Allele Name : Nanning
Genotype(s) : Not Available
Type(s) : ADR Inferred
Groups : G6PD deficiency
Description : Increased risk of hemolytic anemia.
References :

  1. Meloni G, Meloni T: Glyburide-induced acute haemolysis in a G6PD-deficient patient with NIDDM. Br J Haematol. 1996 Jan;92(1):159-60. [PubMed:8562390 ]
  2. Glyase® PresTab® micronized glyburide tablets[package insert]. New York City, New York: Pharmacia & Upjohn Co, Division of Pfizer Inc; 2015. [Link]

PMID: 22088953

Glyburide

By

Glyburide

Product: Levosulpiride

Identifier : DBSNPE001912
Drug : DB01016 (Glyburide)
Interacting Gene/Enzyme : Glucose-6-phosphate 1-dehydrogenase
Gene Name : G6PD
UniProt ID : P11413
Defining Change(s) :

  • 844G->C

Allele Name : Seattle, Lodi, Modena, Ferrara II, Athens-like
Genotype(s) : Not Available
Type(s) : ADR Inferred
Groups : G6PD deficiency
Description : Increased risk of hemolytic anemia.
References :

  1. Meloni G, Meloni T: Glyburide-induced acute haemolysis in a G6PD-deficient patient with NIDDM. Br J Haematol. 1996 Jan;92(1):159-60. [PubMed:8562390 ]
  2. Glyase® PresTab® micronized glyburide tablets[package insert]. New York City, New York: Pharmacia & Upjohn Co, Division of Pfizer Inc; 2015. [Link]

PMID: 25225882

Glyburide

By

Glyburide

Product: Dropropizine

Identifier : DBSNPE001913
Drug : DB01016 (Glyburide)
Interacting Gene/Enzyme : Glucose-6-phosphate 1-dehydrogenase
Gene Name : G6PD
UniProt ID : P11413
Defining Change(s) :

  • 844G->T

Allele Name : Bajo Maumere
Genotype(s) : Not Available
Type(s) : ADR Inferred
Groups : G6PD deficiency
Description : Increased risk of hemolytic anemia.
References :

  1. Meloni G, Meloni T: Glyburide-induced acute haemolysis in a G6PD-deficient patient with NIDDM. Br J Haematol. 1996 Jan;92(1):159-60. [PubMed:8562390 ]
  2. Glyase® PresTab® micronized glyburide tablets[package insert]. New York City, New York: Pharmacia & Upjohn Co, Division of Pfizer Inc; 2015. [Link]

PMID: 12070529

Glyburide

By

Glyburide

Product: Pantethine

Identifier : DBSNPE001914
Drug : DB01016 (Glyburide)
Interacting Gene/Enzyme : Glucose-6-phosphate 1-dehydrogenase
Gene Name : G6PD
UniProt ID : P11413
Defining Change(s) :

  • 854G->A

Allele Name : Montalbano
Genotype(s) : Not Available
Type(s) : ADR Inferred
Groups : G6PD deficiency
Description : Increased risk of hemolytic anemia.
References :

  1. Meloni G, Meloni T: Glyburide-induced acute haemolysis in a G6PD-deficient patient with NIDDM. Br J Haematol. 1996 Jan;92(1):159-60. [PubMed:8562390 ]
  2. Glyase® PresTab® micronized glyburide tablets[package insert]. New York City, New York: Pharmacia & Upjohn Co, Division of Pfizer Inc; 2015. [Link]

PMID: 8035201

Glyburide

By

Glyburide

Product: Adelmidrol

Identifier : DBSNPE001915
Drug : DB01016 (Glyburide)
Interacting Gene/Enzyme : Glucose-6-phosphate 1-dehydrogenase
Gene Name : G6PD
UniProt ID : P11413
Defining Change(s) :

  • 949G->A

Allele Name : Kalyan-Kerala, Jamnaga, Rohini
Genotype(s) : Not Available
Type(s) : ADR Inferred
Groups : G6PD deficiency
Description : Increased risk of hemolytic anemia.
References :

  1. Meloni G, Meloni T: Glyburide-induced acute haemolysis in a G6PD-deficient patient with NIDDM. Br J Haematol. 1996 Jan;92(1):159-60. [PubMed:8562390 ]
  2. Glyase® PresTab® micronized glyburide tablets[package insert]. New York City, New York: Pharmacia & Upjohn Co, Division of Pfizer Inc; 2015. [Link]

PMID: 26245973

Glyburide

By

Glyburide

Product: Mexenone

Identifier : DBSNPE001916
Drug : DB01016 (Glyburide)
Interacting Gene/Enzyme : Glucose-6-phosphate 1-dehydrogenase
Gene Name : G6PD
UniProt ID : P11413
Defining Change(s) :

  • 95A->G

Allele Name : Gaohe
Genotype(s) : Not Available
Type(s) : ADR Inferred
Groups : G6PD deficiency
Description : Increased risk of hemolytic anemia.
References :

  1. Meloni G, Meloni T: Glyburide-induced acute haemolysis in a G6PD-deficient patient with NIDDM. Br J Haematol. 1996 Jan;92(1):159-60. [PubMed:8562390 ]
  2. Glyase® PresTab® micronized glyburide tablets[package insert]. New York City, New York: Pharmacia & Upjohn Co, Division of Pfizer Inc; 2015. [Link]

PMID: 26451944

By

Related Post

You Missed

Uncategorized

COMM domain containing 4

Uncategorized

SHBG Monoclonal Antibody (OTI1A6), TrueMAB™

Uncategorized

CCR4-NOT transcription complex, subunit 3

Uncategorized

SGSM2 Polyclonal Antibody