Glipizide

Glipizide

Product: Alrestatin

Identifier : DBSNPE001575
Drug : DB01067 (Glipizide)
Interacting Gene/Enzyme : Glucose-6-phosphate 1-dehydrogenase
Gene Name : G6PD
UniProt ID : P11413
Defining Change(s) :

  • 1000_1002delACC

Allele Name : Villeurbanne
Genotype(s) : Not Available
Type(s) : ADR Inferred
Groups : G6PD deficiency
Description : Increased risk of hemolytic anemia.
References :

  1. Eichelbaum M, Evert B: Influence of pharmacogenetics on drug disposition and response. Clin Exp Pharmacol Physiol. 1996 Oct-Nov;23(10-11):983-5. [PubMed:8911746 ]
  2. Glucodivol® (glipizide) tablets[package insert]. New York City, New York: Roerig, Division of Pfizer Inc; 2016. [Link]

PMID: 15670772

Glipizide

Glipizide

Product: Tiratricol

Identifier : DBSNPE001576
Drug : DB01067 (Glipizide)
Interacting Gene/Enzyme : Glucose-6-phosphate 1-dehydrogenase
Gene Name : G6PD
UniProt ID : P11413
Defining Change(s) :

  • 1006A->G

Allele Name : Torun
Genotype(s) : Not Available
Type(s) : ADR Inferred
Groups : G6PD deficiency
Description : Increased risk of hemolytic anemia.
References :

  1. Eichelbaum M, Evert B: Influence of pharmacogenetics on drug disposition and response. Clin Exp Pharmacol Physiol. 1996 Oct-Nov;23(10-11):983-5. [PubMed:8911746 ]
  2. Glucodivol® (glipizide) tablets[package insert]. New York City, New York: Roerig, Division of Pfizer Inc; 2016. [Link]

PMID: 15003717

Glipizide

Glipizide

Product: Pralidoxime (chloride)

Identifier : DBSNPE001577
Drug : DB01067 (Glipizide)
Interacting Gene/Enzyme : Glucose-6-phosphate 1-dehydrogenase
Gene Name : G6PD
UniProt ID : P11413
Defining Change(s) :

  • 105_107delCAT

Allele Name : Sunderland
Genotype(s) : Not Available
Type(s) : ADR Inferred
Groups : G6PD deficiency
Description : Increased risk of hemolytic anemia.
References :

  1. Eichelbaum M, Evert B: Influence of pharmacogenetics on drug disposition and response. Clin Exp Pharmacol Physiol. 1996 Oct-Nov;23(10-11):983-5. [PubMed:8911746 ]
  2. Glucodivol® (glipizide) tablets[package insert]. New York City, New York: Roerig, Division of Pfizer Inc; 2016. [Link]

PMID: 12011470

Glipizide

Glipizide

Product: Nialamide

Identifier : DBSNPE001578
Drug : DB01067 (Glipizide)
Interacting Gene/Enzyme : Glucose-6-phosphate 1-dehydrogenase
Gene Name : G6PD
UniProt ID : P11413
Defining Change(s) :

  • 1081G->A

Allele Name : Iwatsuki
Genotype(s) : Not Available
Type(s) : ADR Inferred
Groups : G6PD deficiency
Description : Increased risk of hemolytic anemia.
References :

  1. Eichelbaum M, Evert B: Influence of pharmacogenetics on drug disposition and response. Clin Exp Pharmacol Physiol. 1996 Oct-Nov;23(10-11):983-5. [PubMed:8911746 ]
  2. Glucodivol® (glipizide) tablets[package insert]. New York City, New York: Roerig, Division of Pfizer Inc; 2016. [Link]

PMID: 19467704

Glipizide

Glipizide

Product: Piperonyl butoxide

Identifier : DBSNPE001579
Drug : DB01067 (Glipizide)
Interacting Gene/Enzyme : Glucose-6-phosphate 1-dehydrogenase
Gene Name : G6PD
UniProt ID : P11413
Defining Change(s) :

  • 1082C->T

Allele Name : Serres
Genotype(s) : Not Available
Type(s) : ADR Inferred
Groups : G6PD deficiency
Description : Increased risk of hemolytic anemia.
References :

  1. Eichelbaum M, Evert B: Influence of pharmacogenetics on drug disposition and response. Clin Exp Pharmacol Physiol. 1996 Oct-Nov;23(10-11):983-5. [PubMed:8911746 ]
  2. Glucodivol® (glipizide) tablets[package insert]. New York City, New York: Roerig, Division of Pfizer Inc; 2016. [Link]

PMID: 16996122

Glipizide

Glipizide

Product: Amcinonide

Identifier : DBSNPE001580
Drug : DB01067 (Glipizide)
Interacting Gene/Enzyme : Glucose-6-phosphate 1-dehydrogenase
Gene Name : G6PD
UniProt ID : P11413
Defining Change(s) :

  • 1084_1101delCTGAACGAGCGCAAGGCC

Allele Name : Tondela
Genotype(s) : Not Available
Type(s) : ADR Inferred
Groups : G6PD deficiency
Description : Increased risk of hemolytic anemia.
References :

  1. Eichelbaum M, Evert B: Influence of pharmacogenetics on drug disposition and response. Clin Exp Pharmacol Physiol. 1996 Oct-Nov;23(10-11):983-5. [PubMed:8911746 ]
  2. Glucodivol® (glipizide) tablets[package insert]. New York City, New York: Roerig, Division of Pfizer Inc; 2016. [Link]

PMID: 26907960

Glipizide

Glipizide

Product: Tiapride (hydrochloride)

Identifier : DBSNPE001581
Drug : DB01067 (Glipizide)
Interacting Gene/Enzyme : Glucose-6-phosphate 1-dehydrogenase
Gene Name : G6PD
UniProt ID : P11413
Defining Change(s) :

  • 1089C->A

Allele Name : Loma Linda
Genotype(s) : Not Available
Type(s) : ADR Inferred
Groups : G6PD deficiency
Description : Increased risk of hemolytic anemia.
References :

  1. Eichelbaum M, Evert B: Influence of pharmacogenetics on drug disposition and response. Clin Exp Pharmacol Physiol. 1996 Oct-Nov;23(10-11):983-5. [PubMed:8911746 ]
  2. Glucodivol® (glipizide) tablets[package insert]. New York City, New York: Roerig, Division of Pfizer Inc; 2016. [Link]

PMID: 24517231

Glipizide

Glipizide

Product: Terfenadine

Identifier : DBSNPE001582
Drug : DB01067 (Glipizide)
Interacting Gene/Enzyme : Glucose-6-phosphate 1-dehydrogenase
Gene Name : G6PD
UniProt ID : P11413
Defining Change(s) :

  • 1089C->G

Allele Name : Aachen
Genotype(s) : Not Available
Type(s) : ADR Inferred
Groups : G6PD deficiency
Description : Increased risk of hemolytic anemia.
References :

  1. Eichelbaum M, Evert B: Influence of pharmacogenetics on drug disposition and response. Clin Exp Pharmacol Physiol. 1996 Oct-Nov;23(10-11):983-5. [PubMed:8911746 ]
  2. Glucodivol® (glipizide) tablets[package insert]. New York City, New York: Roerig, Division of Pfizer Inc; 2016. [Link]

PMID: 24550067

Glipizide

Glipizide

Product: Nanofin

Identifier : DBSNPE001583
Drug : DB01067 (Glipizide)
Interacting Gene/Enzyme : Glucose-6-phosphate 1-dehydrogenase
Gene Name : G6PD
UniProt ID : P11413
Defining Change(s) :

  • 1096A->G

Allele Name : Tenri
Genotype(s) : Not Available
Type(s) : ADR Inferred
Groups : G6PD deficiency
Description : Increased risk of hemolytic anemia.
References :

  1. Eichelbaum M, Evert B: Influence of pharmacogenetics on drug disposition and response. Clin Exp Pharmacol Physiol. 1996 Oct-Nov;23(10-11):983-5. [PubMed:8911746 ]
  2. Glucodivol® (glipizide) tablets[package insert]. New York City, New York: Roerig, Division of Pfizer Inc; 2016. [Link]

PMID: 25917569

Glipizide

Glipizide

Product: Meglutol

Identifier : DBSNPE001584
Drug : DB01067 (Glipizide)
Interacting Gene/Enzyme : Glucose-6-phosphate 1-dehydrogenase
Gene Name : G6PD
UniProt ID : P11413
Defining Change(s) :

  • 1132G>A

Allele Name : Montpellier
Genotype(s) : Not Available
Type(s) : ADR Inferred
Groups : G6PD deficiency
Description : Increased risk of hemolytic anemia.
References :

  1. Eichelbaum M, Evert B: Influence of pharmacogenetics on drug disposition and response. Clin Exp Pharmacol Physiol. 1996 Oct-Nov;23(10-11):983-5. [PubMed:8911746 ]
  2. Glucodivol® (glipizide) tablets[package insert]. New York City, New York: Roerig, Division of Pfizer Inc; 2016. [Link]

PMID: 24900267

Glipizide

Glipizide

Product: Propantheline (bromide)

Identifier : DBSNPE001585
Drug : DB01067 (Glipizide)
Interacting Gene/Enzyme : Glucose-6-phosphate 1-dehydrogenase
Gene Name : G6PD
UniProt ID : P11413
Defining Change(s) :

  • 1138A->G

Allele Name : Calvo Mackenna
Genotype(s) : Not Available
Type(s) : ADR Inferred
Groups : G6PD deficiency
Description : Increased risk of hemolytic anemia.
References :

  1. Eichelbaum M, Evert B: Influence of pharmacogenetics on drug disposition and response. Clin Exp Pharmacol Physiol. 1996 Oct-Nov;23(10-11):983-5. [PubMed:8911746 ]
  2. Glucodivol® (glipizide) tablets[package insert]. New York City, New York: Roerig, Division of Pfizer Inc; 2016. [Link]

PMID: 24952596

Glipizide

Glipizide

Product: Dixanthogen

Identifier : DBSNPE001586
Drug : DB01067 (Glipizide)
Interacting Gene/Enzyme : Glucose-6-phosphate 1-dehydrogenase
Gene Name : G6PD
UniProt ID : P11413
Defining Change(s) :

  • 1139T->C

Allele Name : Riley
Genotype(s) : Not Available
Type(s) : ADR Inferred
Groups : G6PD deficiency
Description : Increased risk of hemolytic anemia.
References :

  1. Eichelbaum M, Evert B: Influence of pharmacogenetics on drug disposition and response. Clin Exp Pharmacol Physiol. 1996 Oct-Nov;23(10-11):983-5. [PubMed:8911746 ]
  2. Glucodivol® (glipizide) tablets[package insert]. New York City, New York: Roerig, Division of Pfizer Inc; 2016. [Link]

PMID: 20064975

Glipizide

Glipizide

Product: Beclamide

Identifier : DBSNPE001587
Drug : DB01067 (Glipizide)
Interacting Gene/Enzyme : Glucose-6-phosphate 1-dehydrogenase
Gene Name : G6PD
UniProt ID : P11413
Defining Change(s) :

  • 1141T->C

Allele Name : Olomouc
Genotype(s) : Not Available
Type(s) : ADR Inferred
Groups : G6PD deficiency
Description : Increased risk of hemolytic anemia.
References :

  1. Eichelbaum M, Evert B: Influence of pharmacogenetics on drug disposition and response. Clin Exp Pharmacol Physiol. 1996 Oct-Nov;23(10-11):983-5. [PubMed:8911746 ]
  2. Glucodivol® (glipizide) tablets[package insert]. New York City, New York: Roerig, Division of Pfizer Inc; 2016. [Link]

PMID: 15959515

Glipizide

Glipizide

Product: Hydrocortisone (acetate)

Identifier : DBSNPE001588
Drug : DB01067 (Glipizide)
Interacting Gene/Enzyme : Glucose-6-phosphate 1-dehydrogenase
Gene Name : G6PD
UniProt ID : P11413
Defining Change(s) :

  • 1153T->C

Allele Name : Tomah
Genotype(s) : Not Available
Type(s) : ADR Inferred
Groups : G6PD deficiency
Description : Increased risk of hemolytic anemia.
References :

  1. Eichelbaum M, Evert B: Influence of pharmacogenetics on drug disposition and response. Clin Exp Pharmacol Physiol. 1996 Oct-Nov;23(10-11):983-5. [PubMed:8911746 ]
  2. Glucodivol® (glipizide) tablets[package insert]. New York City, New York: Roerig, Division of Pfizer Inc; 2016. [Link]

PMID: 25038826

Glipizide

Glipizide

Product: Chromocarb

Identifier : DBSNPE001589
Drug : DB01067 (Glipizide)
Interacting Gene/Enzyme : Glucose-6-phosphate 1-dehydrogenase
Gene Name : G6PD
UniProt ID : P11413
Defining Change(s) :

  • 1154G->T

Allele Name : Lynwood
Genotype(s) : Not Available
Type(s) : ADR Inferred
Groups : G6PD deficiency
Description : Increased risk of hemolytic anemia.
References :

  1. Eichelbaum M, Evert B: Influence of pharmacogenetics on drug disposition and response. Clin Exp Pharmacol Physiol. 1996 Oct-Nov;23(10-11):983-5. [PubMed:8911746 ]
  2. Glucodivol® (glipizide) tablets[package insert]. New York City, New York: Roerig, Division of Pfizer Inc; 2016. [Link]

PMID: 26359804

Glipizide

Glipizide

Product: Hydrastinine (hydrochloride)

Identifier : DBSNPE001591
Drug : DB01067 (Glipizide)
Interacting Gene/Enzyme : Glucose-6-phosphate 1-dehydrogenase
Gene Name : G6PD
UniProt ID : P11413
Defining Change(s) :

  • 1156A->G

Allele Name : Iowa, Walter Reed, Springfield
Genotype(s) : Not Available
Type(s) : ADR Inferred
Groups : G6PD deficiency
Description : Increased risk of hemolytic anemia.
References :

  1. Eichelbaum M, Evert B: Influence of pharmacogenetics on drug disposition and response. Clin Exp Pharmacol Physiol. 1996 Oct-Nov;23(10-11):983-5. [PubMed:8911746 ]
  2. Glucodivol® (glipizide) tablets[package insert]. New York City, New York: Roerig, Division of Pfizer Inc; 2016. [Link]

PMID: 17486314

Glipizide

Glipizide

Product: Vinburnine

Identifier : DBSNPE001592
Drug : DB01067 (Glipizide)
Interacting Gene/Enzyme : Glucose-6-phosphate 1-dehydrogenase
Gene Name : G6PD
UniProt ID : P11413
Defining Change(s) :

  • 1160G->A

Allele Name : Beverly Hills, Genova, Iwate, Niigata, Yamaguchi
Genotype(s) : Not Available
Type(s) : ADR Inferred
Groups : G6PD deficiency
Description : Increased risk of hemolytic anemia.
References :

  1. Eichelbaum M, Evert B: Influence of pharmacogenetics on drug disposition and response. Clin Exp Pharmacol Physiol. 1996 Oct-Nov;23(10-11):983-5. [PubMed:8911746 ]
  2. Glucodivol® (glipizide) tablets[package insert]. New York City, New York: Roerig, Division of Pfizer Inc; 2016. [Link]

PMID: 11820780

Glipizide

Glipizide

Product: Diazinon

Identifier : DBSNPE001593
Drug : DB01067 (Glipizide)
Interacting Gene/Enzyme : Glucose-6-phosphate 1-dehydrogenase
Gene Name : G6PD
UniProt ID : P11413
Defining Change(s) :

  • 1162A->G

Allele Name : Hartford
Genotype(s) : Not Available
Type(s) : ADR Inferred
Groups : G6PD deficiency
Description : Increased risk of hemolytic anemia.
References :

  1. Eichelbaum M, Evert B: Influence of pharmacogenetics on drug disposition and response. Clin Exp Pharmacol Physiol. 1996 Oct-Nov;23(10-11):983-5. [PubMed:8911746 ]
  2. Glucodivol® (glipizide) tablets[package insert]. New York City, New York: Roerig, Division of Pfizer Inc; 2016. [Link]

PMID: 17012620

Glipizide

Glipizide

Product: Centrinone

Identifier : DBSNPE001594
Drug : DB01067 (Glipizide)
Interacting Gene/Enzyme : Glucose-6-phosphate 1-dehydrogenase
Gene Name : G6PD
UniProt ID : P11413
Defining Change(s) :

  • 1166A->G

Allele Name : Praha
Genotype(s) : Not Available
Type(s) : ADR Inferred
Groups : G6PD deficiency
Description : Increased risk of hemolytic anemia.
References :

  1. Eichelbaum M, Evert B: Influence of pharmacogenetics on drug disposition and response. Clin Exp Pharmacol Physiol. 1996 Oct-Nov;23(10-11):983-5. [PubMed:8911746 ]
  2. Glucodivol® (glipizide) tablets[package insert]. New York City, New York: Roerig, Division of Pfizer Inc; 2016. [Link]

PMID: 21643507

Glipizide

Glipizide

Product: SMER18

Identifier : DBSNPE001595
Drug : DB01067 (Glipizide)
Interacting Gene/Enzyme : Glucose-6-phosphate 1-dehydrogenase
Gene Name : G6PD
UniProt ID : P11413
Defining Change(s) :

  • 1175T>C

Allele Name : Krakow
Genotype(s) : Not Available
Type(s) : ADR Inferred
Groups : G6PD deficiency
Description : Increased risk of hemolytic anemia.
References :

  1. Eichelbaum M, Evert B: Influence of pharmacogenetics on drug disposition and response. Clin Exp Pharmacol Physiol. 1996 Oct-Nov;23(10-11):983-5. [PubMed:8911746 ]
  2. Glucodivol® (glipizide) tablets[package insert]. New York City, New York: Roerig, Division of Pfizer Inc; 2016. [Link]

PMID: 24093330

Glipizide

Glipizide

Product: Efaproxiral (sodium)

Identifier : DBSNPE001596
Drug : DB01067 (Glipizide)
Interacting Gene/Enzyme : Glucose-6-phosphate 1-dehydrogenase
Gene Name : G6PD
UniProt ID : P11413
Defining Change(s) :

  • 1177C->G

Allele Name : Wisconsin
Genotype(s) : Not Available
Type(s) : ADR Inferred
Groups : G6PD deficiency
Description : Increased risk of hemolytic anemia.
References :

  1. Eichelbaum M, Evert B: Influence of pharmacogenetics on drug disposition and response. Clin Exp Pharmacol Physiol. 1996 Oct-Nov;23(10-11):983-5. [PubMed:8911746 ]
  2. Glucodivol® (glipizide) tablets[package insert]. New York City, New York: Roerig, Division of Pfizer Inc; 2016. [Link]

PMID: 22368763

Glipizide

Glipizide

Product: Efaproxiral

Identifier : DBSNPE001597
Drug : DB01067 (Glipizide)
Interacting Gene/Enzyme : Glucose-6-phosphate 1-dehydrogenase
Gene Name : G6PD
UniProt ID : P11413
Defining Change(s) :

  • 1178G->A

Allele Name : Nashville, Anaheim, Portici
Genotype(s) : Not Available
Type(s) : ADR Inferred
Groups : G6PD deficiency
Description : Increased risk of hemolytic anemia.
References :

  1. Eichelbaum M, Evert B: Influence of pharmacogenetics on drug disposition and response. Clin Exp Pharmacol Physiol. 1996 Oct-Nov;23(10-11):983-5. [PubMed:8911746 ]
  2. Glucodivol® (glipizide) tablets[package insert]. New York City, New York: Roerig, Division of Pfizer Inc; 2016. [Link]

PMID: 21329361

Glipizide

Glipizide

Product: MSI-1436

Identifier : DBSNPE001598
Drug : DB01067 (Glipizide)
Interacting Gene/Enzyme : Glucose-6-phosphate 1-dehydrogenase
Gene Name : G6PD
UniProt ID : P11413
Defining Change(s) :

  • 1180G->C

Allele Name : Alhambra
Genotype(s) : Not Available
Type(s) : ADR Inferred
Groups : G6PD deficiency
Description : Increased risk of hemolytic anemia.
References :

  1. Eichelbaum M, Evert B: Influence of pharmacogenetics on drug disposition and response. Clin Exp Pharmacol Physiol. 1996 Oct-Nov;23(10-11):983-5. [PubMed:8911746 ]
  2. Glucodivol® (glipizide) tablets[package insert]. New York City, New York: Roerig, Division of Pfizer Inc; 2016. [Link]

PMID: 20571077

Glipizide

Glipizide

Product: NM107

Identifier : DBSNPE001599
Drug : DB01067 (Glipizide)
Interacting Gene/Enzyme : Glucose-6-phosphate 1-dehydrogenase
Gene Name : G6PD
UniProt ID : P11413
Defining Change(s) :

  • 1187C->T

Allele Name : Bari
Genotype(s) : Not Available
Type(s) : ADR Inferred
Groups : G6PD deficiency
Description : Increased risk of hemolytic anemia.
References :

  1. Eichelbaum M, Evert B: Influence of pharmacogenetics on drug disposition and response. Clin Exp Pharmacol Physiol. 1996 Oct-Nov;23(10-11):983-5. [PubMed:8911746 ]
  2. Glucodivol® (glipizide) tablets[package insert]. New York City, New York: Roerig, Division of Pfizer Inc; 2016. [Link]

PMID: 27641322

Glipizide

Glipizide

Product: ML346

Identifier : DBSNPE001600
Drug : DB01067 (Glipizide)
Interacting Gene/Enzyme : Glucose-6-phosphate 1-dehydrogenase
Gene Name : G6PD
UniProt ID : P11413
Defining Change(s) :

  • 1192G->A

Allele Name : Puerto Limon
Genotype(s) : Not Available
Type(s) : ADR Inferred
Groups : G6PD deficiency
Description : Increased risk of hemolytic anemia.
References :

  1. Eichelbaum M, Evert B: Influence of pharmacogenetics on drug disposition and response. Clin Exp Pharmacol Physiol. 1996 Oct-Nov;23(10-11):983-5. [PubMed:8911746 ]
  2. Glucodivol® (glipizide) tablets[package insert]. New York City, New York: Roerig, Division of Pfizer Inc; 2016. [Link]

PMID: 26013542

Glipizide

Glipizide

Product: LTV-1

Identifier : DBSNPE001601
Drug : DB01067 (Glipizide)
Interacting Gene/Enzyme : Glucose-6-phosphate 1-dehydrogenase
Gene Name : G6PD
UniProt ID : P11413
Defining Change(s) :

  • 1205C>A

Allele Name : Covao do Lobo
Genotype(s) : Not Available
Type(s) : ADR Inferred
Groups : G6PD deficiency
Description : Increased risk of hemolytic anemia.
References :

  1. Eichelbaum M, Evert B: Influence of pharmacogenetics on drug disposition and response. Clin Exp Pharmacol Physiol. 1996 Oct-Nov;23(10-11):983-5. [PubMed:8911746 ]
  2. Glucodivol® (glipizide) tablets[package insert]. New York City, New York: Roerig, Division of Pfizer Inc; 2016. [Link]

PMID: 21596927

Glipizide

Glipizide

Product: D77

Identifier : DBSNPE001602
Drug : DB01067 (Glipizide)
Interacting Gene/Enzyme : Glucose-6-phosphate 1-dehydrogenase
Gene Name : G6PD
UniProt ID : P11413
Defining Change(s) :

  • 1215G->A

Allele Name : Clinic
Genotype(s) : Not Available
Type(s) : ADR Inferred
Groups : G6PD deficiency
Description : Increased risk of hemolytic anemia.
References :

  1. Eichelbaum M, Evert B: Influence of pharmacogenetics on drug disposition and response. Clin Exp Pharmacol Physiol. 1996 Oct-Nov;23(10-11):983-5. [PubMed:8911746 ]
  2. Glucodivol® (glipizide) tablets[package insert]. New York City, New York: Roerig, Division of Pfizer Inc; 2016. [Link]

PMID: 21209212

Glipizide

Glipizide

Product: RQ-00203078

Identifier : DBSNPE001603
Drug : DB01067 (Glipizide)
Interacting Gene/Enzyme : Glucose-6-phosphate 1-dehydrogenase
Gene Name : G6PD
UniProt ID : P11413
Defining Change(s) :

  • 1225C->T

Allele Name : Udivecht
Genotype(s) : Not Available
Type(s) : ADR Inferred
Groups : G6PD deficiency
Description : Increased risk of hemolytic anemia.
References :

  1. Eichelbaum M, Evert B: Influence of pharmacogenetics on drug disposition and response. Clin Exp Pharmacol Physiol. 1996 Oct-Nov;23(10-11):983-5. [PubMed:8911746 ]
  2. Glucodivol® (glipizide) tablets[package insert]. New York City, New York: Roerig, Division of Pfizer Inc; 2016. [Link]

PMID: 18006643

Glipizide

Glipizide

Product: Hetacillin

Identifier : DBSNPE001604
Drug : DB01067 (Glipizide)
Interacting Gene/Enzyme : Glucose-6-phosphate 1-dehydrogenase
Gene Name : G6PD
UniProt ID : P11413
Defining Change(s) :

  • 1226C->G

Allele Name : Suwalki
Genotype(s) : Not Available
Type(s) : ADR Inferred
Groups : G6PD deficiency
Description : Increased risk of hemolytic anemia.
References :

  1. Eichelbaum M, Evert B: Influence of pharmacogenetics on drug disposition and response. Clin Exp Pharmacol Physiol. 1996 Oct-Nov;23(10-11):983-5. [PubMed:8911746 ]
  2. Glucodivol® (glipizide) tablets[package insert]. New York City, New York: Roerig, Division of Pfizer Inc; 2016. [Link]

PMID: 25941381

Glipizide

Glipizide

Product: Hetacillin (potassium)

Identifier : DBSNPE001605
Drug : DB01067 (Glipizide)
Interacting Gene/Enzyme : Glucose-6-phosphate 1-dehydrogenase
Gene Name : G6PD
UniProt ID : P11413
Defining Change(s) :

  • 1228G->T

Allele Name : Riverside
Genotype(s) : Not Available
Type(s) : ADR Inferred
Groups : G6PD deficiency
Description : Increased risk of hemolytic anemia.
References :

  1. Eichelbaum M, Evert B: Influence of pharmacogenetics on drug disposition and response. Clin Exp Pharmacol Physiol. 1996 Oct-Nov;23(10-11):983-5. [PubMed:8911746 ]
  2. Glucodivol® (glipizide) tablets[package insert]. New York City, New York: Roerig, Division of Pfizer Inc; 2016. [Link]

PMID: 24416348

Glipizide

Glipizide

Product: QNZ46

Identifier : DBSNPE001606
Drug : DB01067 (Glipizide)
Interacting Gene/Enzyme : Glucose-6-phosphate 1-dehydrogenase
Gene Name : G6PD
UniProt ID : P11413
Defining Change(s) :

  • 1229G->A

Allele Name : Japan, Shinagawa
Genotype(s) : Not Available
Type(s) : ADR Inferred
Groups : G6PD deficiency
Description : Increased risk of hemolytic anemia.
References :

  1. Eichelbaum M, Evert B: Influence of pharmacogenetics on drug disposition and response. Clin Exp Pharmacol Physiol. 1996 Oct-Nov;23(10-11):983-5. [PubMed:8911746 ]
  2. Glucodivol® (glipizide) tablets[package insert]. New York City, New York: Roerig, Division of Pfizer Inc; 2016. [Link]

PMID: 25404319

Glipizide

Glipizide

Product: BAY 1161909

Identifier : DBSNPE001607
Drug : DB01067 (Glipizide)
Interacting Gene/Enzyme : Glucose-6-phosphate 1-dehydrogenase
Gene Name : G6PD
UniProt ID : P11413
Defining Change(s) :

  • 1229G->C

Allele Name : Kawasaki
Genotype(s) : Not Available
Type(s) : ADR Inferred
Groups : G6PD deficiency
Description : Increased risk of hemolytic anemia.
References :

  1. Eichelbaum M, Evert B: Influence of pharmacogenetics on drug disposition and response. Clin Exp Pharmacol Physiol. 1996 Oct-Nov;23(10-11):983-5. [PubMed:8911746 ]
  2. Glucodivol® (glipizide) tablets[package insert]. New York City, New York: Roerig, Division of Pfizer Inc; 2016. [Link]

PMID: 1379592

Glipizide

Glipizide

Product: IMD-0354

Identifier : DBSNPE001608
Drug : DB01067 (Glipizide)
Interacting Gene/Enzyme : Glucose-6-phosphate 1-dehydrogenase
Gene Name : G6PD
UniProt ID : P11413
Defining Change(s) :

  • 1231A->G

Allele Name : Munich
Genotype(s) : Not Available
Type(s) : ADR Inferred
Groups : G6PD deficiency
Description : Increased risk of hemolytic anemia.
References :

  1. Eichelbaum M, Evert B: Influence of pharmacogenetics on drug disposition and response. Clin Exp Pharmacol Physiol. 1996 Oct-Nov;23(10-11):983-5. [PubMed:8911746 ]
  2. Glucodivol® (glipizide) tablets[package insert]. New York City, New York: Roerig, Division of Pfizer Inc; 2016. [Link]

PMID: 19279269

Glipizide

Glipizide

Product: Pardoprunox (hydrochloride)

Identifier : DBSNPE001609
Drug : DB01067 (Glipizide)
Interacting Gene/Enzyme : Glucose-6-phosphate 1-dehydrogenase
Gene Name : G6PD
UniProt ID : P11413
Defining Change(s) :

  • 1284C->A

Allele Name : Georgia
Genotype(s) : Not Available
Type(s) : ADR Inferred
Groups : G6PD deficiency
Description : Increased risk of hemolytic anemia.
References :

  1. Eichelbaum M, Evert B: Influence of pharmacogenetics on drug disposition and response. Clin Exp Pharmacol Physiol. 1996 Oct-Nov;23(10-11):983-5. [PubMed:8911746 ]
  2. Glucodivol® (glipizide) tablets[package insert]. New York City, New York: Roerig, Division of Pfizer Inc; 2016. [Link]

PMID: 9287322

Glipizide

Glipizide

Product: W-54011

Identifier : DBSNPE001610
Drug : DB01067 (Glipizide)
Interacting Gene/Enzyme : Glucose-6-phosphate 1-dehydrogenase
Gene Name : G6PD
UniProt ID : P11413
Defining Change(s) :

  • 1292T->G

Allele Name : Sumare
Genotype(s) : Not Available
Type(s) : ADR Inferred
Groups : G6PD deficiency
Description : Increased risk of hemolytic anemia.
References :

  1. Eichelbaum M, Evert B: Influence of pharmacogenetics on drug disposition and response. Clin Exp Pharmacol Physiol. 1996 Oct-Nov;23(10-11):983-5. [PubMed:8911746 ]
  2. Glucodivol® (glipizide) tablets[package insert]. New York City, New York: Roerig, Division of Pfizer Inc; 2016. [Link]

PMID: 8119963

Glipizide

Glipizide

Product: Cefotiam (hydrochloride)

Identifier : DBSNPE001611
Drug : DB01067 (Glipizide)
Interacting Gene/Enzyme : Glucose-6-phosphate 1-dehydrogenase
Gene Name : G6PD
UniProt ID : P11413
Defining Change(s) :

  • 1318C->T

Allele Name : Telti/Kobe
Genotype(s) : Not Available
Type(s) : ADR Inferred
Groups : G6PD deficiency
Description : Increased risk of hemolytic anemia.
References :

  1. Eichelbaum M, Evert B: Influence of pharmacogenetics on drug disposition and response. Clin Exp Pharmacol Physiol. 1996 Oct-Nov;23(10-11):983-5. [PubMed:8911746 ]
  2. Glucodivol® (glipizide) tablets[package insert]. New York City, New York: Roerig, Division of Pfizer Inc; 2016. [Link]

PMID: 10725256

Glipizide

Glipizide

Product: Ribostamycin (sulfate)

Identifier : DBSNPE001612
Drug : DB01067 (Glipizide)
Interacting Gene/Enzyme : Glucose-6-phosphate 1-dehydrogenase
Gene Name : G6PD
UniProt ID : P11413
Defining Change(s) :

  • 1339G->A

Allele Name : Santiago de Cuba, Morioka
Genotype(s) : Not Available
Type(s) : ADR Inferred
Groups : G6PD deficiency
Description : Increased risk of hemolytic anemia.
References :

  1. Eichelbaum M, Evert B: Influence of pharmacogenetics on drug disposition and response. Clin Exp Pharmacol Physiol. 1996 Oct-Nov;23(10-11):983-5. [PubMed:8911746 ]
  2. Glucodivol® (glipizide) tablets[package insert]. New York City, New York: Roerig, Division of Pfizer Inc; 2016. [Link]

PMID: 10193905

Glipizide

Glipizide

Product: Protoporphyrin IX

Identifier : DBSNPE001613
Drug : DB01067 (Glipizide)
Interacting Gene/Enzyme : Glucose-6-phosphate 1-dehydrogenase
Gene Name : G6PD
UniProt ID : P11413
Defining Change(s) :

  • 1358T->A

Allele Name : Harima
Genotype(s) : Not Available
Type(s) : ADR Inferred
Groups : G6PD deficiency
Description : Increased risk of hemolytic anemia.
References :

  1. Eichelbaum M, Evert B: Influence of pharmacogenetics on drug disposition and response. Clin Exp Pharmacol Physiol. 1996 Oct-Nov;23(10-11):983-5. [PubMed:8911746 ]
  2. Glucodivol® (glipizide) tablets[package insert]. New York City, New York: Roerig, Division of Pfizer Inc; 2016. [Link]

PMID: 8609887

Glipizide

Glipizide

Product: Cephalothin (sodium)

Identifier : DBSNPE001614
Drug : DB01067 (Glipizide)
Interacting Gene/Enzyme : Glucose-6-phosphate 1-dehydrogenase
Gene Name : G6PD
UniProt ID : P11413
Defining Change(s) :

  • 1366G->C

Allele Name : Figuera da Foz
Genotype(s) : Not Available
Type(s) : ADR Inferred
Groups : G6PD deficiency
Description : Increased risk of hemolytic anemia.
References :

  1. Eichelbaum M, Evert B: Influence of pharmacogenetics on drug disposition and response. Clin Exp Pharmacol Physiol. 1996 Oct-Nov;23(10-11):983-5. [PubMed:8911746 ]
  2. Glucodivol® (glipizide) tablets[package insert]. New York City, New York: Roerig, Division of Pfizer Inc; 2016. [Link]

PMID: 7925607

Glipizide

Glipizide

Product: Mebhydrolin (napadisylate)

Identifier : DBSNPE001615
Drug : DB01067 (Glipizide)
Interacting Gene/Enzyme : Glucose-6-phosphate 1-dehydrogenase
Gene Name : G6PD
UniProt ID : P11413
Defining Change(s) :

  • 1367A>T

Allele Name : Amiens
Genotype(s) : Not Available
Type(s) : ADR Inferred
Groups : G6PD deficiency
Description : Increased risk of hemolytic anemia.
References :

  1. Eichelbaum M, Evert B: Influence of pharmacogenetics on drug disposition and response. Clin Exp Pharmacol Physiol. 1996 Oct-Nov;23(10-11):983-5. [PubMed:8911746 ]
  2. Glucodivol® (glipizide) tablets[package insert]. New York City, New York: Roerig, Division of Pfizer Inc; 2016. [Link]

PMID: 16402041

Glipizide

Glipizide

Product: (-)-Sparteine (sulfate pentahydrate)

Identifier : DBSNPE001616
Drug : DB01067 (Glipizide)
Interacting Gene/Enzyme : Glucose-6-phosphate 1-dehydrogenase
Gene Name : G6PD
UniProt ID : P11413
Defining Change(s) :

  • 1376G->T, 1502T->G

Allele Name : Bangkok Noi
Genotype(s) : Not Available
Type(s) : ADR Inferred
Groups : G6PD deficiency
Description : Increased risk of hemolytic anemia.
References :

  1. Eichelbaum M, Evert B: Influence of pharmacogenetics on drug disposition and response. Clin Exp Pharmacol Physiol. 1996 Oct-Nov;23(10-11):983-5. [PubMed:8911746 ]
  2. Glucodivol® (glipizide) tablets[package insert]. New York City, New York: Roerig, Division of Pfizer Inc; 2016. [Link]

PMID: 15081581

Glipizide

Glipizide

Product: Chlortetracycline (hydrochloride)

Identifier : DBSNPE001617
Drug : DB01067 (Glipizide)
Interacting Gene/Enzyme : Glucose-6-phosphate 1-dehydrogenase
Gene Name : G6PD
UniProt ID : P11413
Defining Change(s) :

  • 1462G->A

Allele Name : Fukaya
Genotype(s) : Not Available
Type(s) : ADR Inferred
Groups : G6PD deficiency
Description : Increased risk of hemolytic anemia.
References :

  1. Eichelbaum M, Evert B: Influence of pharmacogenetics on drug disposition and response. Clin Exp Pharmacol Physiol. 1996 Oct-Nov;23(10-11):983-5. [PubMed:8911746 ]
  2. Glucodivol® (glipizide) tablets[package insert]. New York City, New York: Roerig, Division of Pfizer Inc; 2016. [Link]

PMID: 11125021

Glipizide

Glipizide

Product: Apramycin (sulfate)

Identifier : DBSNPE001618
Drug : DB01067 (Glipizide)
Interacting Gene/Enzyme : Glucose-6-phosphate 1-dehydrogenase
Gene Name : G6PD
UniProt ID : P11413
Defining Change(s) :

  • 1463G->T

Allele Name : Campinas
Genotype(s) : Not Available
Type(s) : ADR Inferred
Groups : G6PD deficiency
Description : Increased risk of hemolytic anemia.
References :

  1. Eichelbaum M, Evert B: Influence of pharmacogenetics on drug disposition and response. Clin Exp Pharmacol Physiol. 1996 Oct-Nov;23(10-11):983-5. [PubMed:8911746 ]
  2. Glucodivol® (glipizide) tablets[package insert]. New York City, New York: Roerig, Division of Pfizer Inc; 2016. [Link]

PMID: 10329678

Glipizide

Glipizide

Product: Cyromazine

Identifier : DBSNPE001619
Drug : DB01067 (Glipizide)
Interacting Gene/Enzyme : Glucose-6-phosphate 1-dehydrogenase
Gene Name : G6PD
UniProt ID : P11413
Defining Change(s) :

  • 1465C>T

Allele Name : Buenos Aires
Genotype(s) : Not Available
Type(s) : ADR Inferred
Groups : G6PD deficiency
Description : Increased risk of hemolytic anemia.
References :

  1. Eichelbaum M, Evert B: Influence of pharmacogenetics on drug disposition and response. Clin Exp Pharmacol Physiol. 1996 Oct-Nov;23(10-11):983-5. [PubMed:8911746 ]
  2. Glucodivol® (glipizide) tablets[package insert]. New York City, New York: Roerig, Division of Pfizer Inc; 2016. [Link]

PMID: 1905730

Glipizide

Glipizide

Product: Choline (chloride)

Identifier : DBSNPE001620
Drug : DB01067 (Glipizide)
Interacting Gene/Enzyme : Glucose-6-phosphate 1-dehydrogenase
Gene Name : G6PD
UniProt ID : P11413
Defining Change(s) :

  • 1466C->T

Allele Name : Arakawa
Genotype(s) : Not Available
Type(s) : ADR Inferred
Groups : G6PD deficiency
Description : Increased risk of hemolytic anemia.
References :

  1. Eichelbaum M, Evert B: Influence of pharmacogenetics on drug disposition and response. Clin Exp Pharmacol Physiol. 1996 Oct-Nov;23(10-11):983-5. [PubMed:8911746 ]
  2. Glucodivol® (glipizide) tablets[package insert]. New York City, New York: Roerig, Division of Pfizer Inc; 2016. [Link]

PMID: 1847132

Glipizide

Glipizide

Product: Lincomycin (hydrochloride hydrate)

Identifier : DBSNPE001621
Drug : DB01067 (Glipizide)
Interacting Gene/Enzyme : Glucose-6-phosphate 1-dehydrogenase
Gene Name : G6PD
UniProt ID : P11413
Defining Change(s) :

  • 1488_1490delGAA

Allele Name : Brighton
Genotype(s) : Not Available
Type(s) : ADR Inferred
Groups : G6PD deficiency
Description : Increased risk of hemolytic anemia.
References :

  1. Eichelbaum M, Evert B: Influence of pharmacogenetics on drug disposition and response. Clin Exp Pharmacol Physiol. 1996 Oct-Nov;23(10-11):983-5. [PubMed:8911746 ]
  2. Glucodivol® (glipizide) tablets[package insert]. New York City, New York: Roerig, Division of Pfizer Inc; 2016. [Link]

PMID: 2122563

Glipizide

Glipizide

Product: Florfenicol

Identifier : DBSNPE001622
Drug : DB01067 (Glipizide)
Interacting Gene/Enzyme : Glucose-6-phosphate 1-dehydrogenase
Gene Name : G6PD
UniProt ID : P11413
Defining Change(s) :

  • 159G->C

Allele Name : Kozukata
Genotype(s) : Not Available
Type(s) : ADR Inferred
Groups : G6PD deficiency
Description : Increased risk of hemolytic anemia.
References :

  1. Eichelbaum M, Evert B: Influence of pharmacogenetics on drug disposition and response. Clin Exp Pharmacol Physiol. 1996 Oct-Nov;23(10-11):983-5. [PubMed:8911746 ]
  2. Glucodivol® (glipizide) tablets[package insert]. New York City, New York: Roerig, Division of Pfizer Inc; 2016. [Link]

PMID: 1321950

Glipizide

Glipizide

Product: Pempidine

Identifier : DBSNPE001623
Drug : DB01067 (Glipizide)
Interacting Gene/Enzyme : Glucose-6-phosphate 1-dehydrogenase
Gene Name : G6PD
UniProt ID : P11413
Defining Change(s) :

  • 180_182delTCT

Allele Name : Amsterdam
Genotype(s) : Not Available
Type(s) : ADR Inferred
Groups : G6PD deficiency
Description : Increased risk of hemolytic anemia.
References :

  1. Eichelbaum M, Evert B: Influence of pharmacogenetics on drug disposition and response. Clin Exp Pharmacol Physiol. 1996 Oct-Nov;23(10-11):983-5. [PubMed:8911746 ]
  2. Glucodivol® (glipizide) tablets[package insert]. New York City, New York: Roerig, Division of Pfizer Inc; 2016. [Link]

PMID: 1665733

Glipizide

Glipizide

Product: Lactitol (monohydrate)

Identifier : DBSNPE001624
Drug : DB01067 (Glipizide)
Interacting Gene/Enzyme : Glucose-6-phosphate 1-dehydrogenase
Gene Name : G6PD
UniProt ID : P11413
Defining Change(s) :

  • 202G->A, 376A->G, 1264C>G

Allele Name : No name
Genotype(s) : Not Available
Type(s) : ADR Inferred
Groups : G6PD deficiency
Description : Increased risk of hemolytic anemia.
References :

  1. Eichelbaum M, Evert B: Influence of pharmacogenetics on drug disposition and response. Clin Exp Pharmacol Physiol. 1996 Oct-Nov;23(10-11):983-5. [PubMed:8911746 ]
  2. Glucodivol® (glipizide) tablets[package insert]. New York City, New York: Roerig, Division of Pfizer Inc; 2016. [Link]

PMID: 4359834

Glipizide

Glipizide

Product: Nefazodone (hydrochloride)

Identifier : DBSNPE001625
Drug : DB01067 (Glipizide)
Interacting Gene/Enzyme : Glucose-6-phosphate 1-dehydrogenase
Gene Name : G6PD
UniProt ID : P11413
Defining Change(s) :

  • 224T->C

Allele Name : Swansea
Genotype(s) : Not Available
Type(s) : ADR Inferred
Groups : G6PD deficiency
Description : Increased risk of hemolytic anemia.
References :

  1. Eichelbaum M, Evert B: Influence of pharmacogenetics on drug disposition and response. Clin Exp Pharmacol Physiol. 1996 Oct-Nov;23(10-11):983-5. [PubMed:8911746 ]
  2. Glucodivol® (glipizide) tablets[package insert]. New York City, New York: Roerig, Division of Pfizer Inc; 2016. [Link]

PMID: 9663445

Glipizide

Glipizide

Product: Acetrizoic acid

Identifier : DBSNPE001626
Drug : DB01067 (Glipizide)
Interacting Gene/Enzyme : Glucose-6-phosphate 1-dehydrogenase
Gene Name : G6PD
UniProt ID : P11413
Defining Change(s) :

  • 281_283delAGA

Allele Name : Urayasu
Genotype(s) : Not Available
Type(s) : ADR Inferred
Groups : G6PD deficiency
Description : Increased risk of hemolytic anemia.
References :

  1. Eichelbaum M, Evert B: Influence of pharmacogenetics on drug disposition and response. Clin Exp Pharmacol Physiol. 1996 Oct-Nov;23(10-11):983-5. [PubMed:8911746 ]
  2. Glucodivol® (glipizide) tablets[package insert]. New York City, New York: Roerig, Division of Pfizer Inc; 2016. [Link]

PMID: 2496748

Glipizide

Glipizide

Product: Phthalylsulfathiazole

Identifier : DBSNPE001627
Drug : DB01067 (Glipizide)
Interacting Gene/Enzyme : Glucose-6-phosphate 1-dehydrogenase
Gene Name : G6PD
UniProt ID : P11413
Defining Change(s) :

  • 317C->G544C->T592C->T

Allele Name : Vancouver
Genotype(s) : Not Available
Type(s) : ADR Inferred
Groups : G6PD deficiency
Description : Increased risk of hemolytic anemia.
References :

  1. Eichelbaum M, Evert B: Influence of pharmacogenetics on drug disposition and response. Clin Exp Pharmacol Physiol. 1996 Oct-Nov;23(10-11):983-5. [PubMed:8911746 ]
  2. Glucodivol® (glipizide) tablets[package insert]. New York City, New York: Roerig, Division of Pfizer Inc; 2016. [Link]

PMID: 3135265

Glipizide

Glipizide

Product: Salicyl alcohol

Identifier : DBSNPE001628
Drug : DB01067 (Glipizide)
Interacting Gene/Enzyme : Glucose-6-phosphate 1-dehydrogenase
Gene Name : G6PD
UniProt ID : P11413
Defining Change(s) :

  • 376A->G, 1159C->T

Allele Name : Mt Sinai
Genotype(s) : Not Available
Type(s) : ADR Inferred
Groups : G6PD deficiency
Description : Increased risk of hemolytic anemia.
References :

  1. Eichelbaum M, Evert B: Influence of pharmacogenetics on drug disposition and response. Clin Exp Pharmacol Physiol. 1996 Oct-Nov;23(10-11):983-5. [PubMed:8911746 ]
  2. Glucodivol® (glipizide) tablets[package insert]. New York City, New York: Roerig, Division of Pfizer Inc; 2016. [Link]

PMID: 6296122

Glipizide

Glipizide

Product: MK-5046

Identifier : DBSNPE001629
Drug : DB01067 (Glipizide)
Interacting Gene/Enzyme : Glucose-6-phosphate 1-dehydrogenase
Gene Name : G6PD
UniProt ID : P11413
Defining Change(s) :

  • 488G->A

Allele Name : Plymouth
Genotype(s) : Not Available
Type(s) : ADR Inferred
Groups : G6PD deficiency
Description : Increased risk of hemolytic anemia.
References :

  1. Eichelbaum M, Evert B: Influence of pharmacogenetics on drug disposition and response. Clin Exp Pharmacol Physiol. 1996 Oct-Nov;23(10-11):983-5. [PubMed:8911746 ]
  2. Glucodivol® (glipizide) tablets[package insert]. New York City, New York: Roerig, Division of Pfizer Inc; 2016. [Link]

PMID: 25990016

Glipizide

Glipizide

Product: Isoalantolactone

Identifier : DBSNPE001630
Drug : DB01067 (Glipizide)
Interacting Gene/Enzyme : Glucose-6-phosphate 1-dehydrogenase
Gene Name : G6PD
UniProt ID : P11413
Defining Change(s) :

  • 514C->T

Allele Name : Volendam
Genotype(s) : Not Available
Type(s) : ADR Inferred
Groups : G6PD deficiency
Description : Increased risk of hemolytic anemia.
References :

  1. Eichelbaum M, Evert B: Influence of pharmacogenetics on drug disposition and response. Clin Exp Pharmacol Physiol. 1996 Oct-Nov;23(10-11):983-5. [PubMed:8911746 ]
  2. Glucodivol® (glipizide) tablets[package insert]. New York City, New York: Roerig, Division of Pfizer Inc; 2016. [Link]

PMID: 26398933

Glipizide

Glipizide

Product: Isocorynoxeine

Identifier : DBSNPE001631
Drug : DB01067 (Glipizide)
Interacting Gene/Enzyme : Glucose-6-phosphate 1-dehydrogenase
Gene Name : G6PD
UniProt ID : P11413
Defining Change(s) :

  • 527A->G

Allele Name : Shinshu
Genotype(s) : Not Available
Type(s) : ADR Inferred
Groups : G6PD deficiency
Description : Increased risk of hemolytic anemia.
References :

  1. Eichelbaum M, Evert B: Influence of pharmacogenetics on drug disposition and response. Clin Exp Pharmacol Physiol. 1996 Oct-Nov;23(10-11):983-5. [PubMed:8911746 ]
  2. Glucodivol® (glipizide) tablets[package insert]. New York City, New York: Roerig, Division of Pfizer Inc; 2016. [Link]

PMID: 24740509

Glipizide

Glipizide

Product: Isomangiferin

Identifier : DBSNPE001632
Drug : DB01067 (Glipizide)
Interacting Gene/Enzyme : Glucose-6-phosphate 1-dehydrogenase
Gene Name : G6PD
UniProt ID : P11413
Defining Change(s) :

  • 535A->T

Allele Name : Chikugo
Genotype(s) : Not Available
Type(s) : ADR Inferred
Groups : G6PD deficiency
Description : Increased risk of hemolytic anemia.
References :

  1. Eichelbaum M, Evert B: Influence of pharmacogenetics on drug disposition and response. Clin Exp Pharmacol Physiol. 1996 Oct-Nov;23(10-11):983-5. [PubMed:8911746 ]
  2. Glucodivol® (glipizide) tablets[package insert]. New York City, New York: Roerig, Division of Pfizer Inc; 2016. [Link]

PMID: 25474349

Glipizide

Glipizide

Product: Isorhynchophylline

Identifier : DBSNPE001633
Drug : DB01067 (Glipizide)
Interacting Gene/Enzyme : Glucose-6-phosphate 1-dehydrogenase
Gene Name : G6PD
UniProt ID : P11413
Defining Change(s) :

  • 561_563delCTC

Allele Name : Tsukui
Genotype(s) : Not Available
Type(s) : ADR Inferred
Groups : G6PD deficiency
Description : Increased risk of hemolytic anemia.
References :

  1. Eichelbaum M, Evert B: Influence of pharmacogenetics on drug disposition and response. Clin Exp Pharmacol Physiol. 1996 Oct-Nov;23(10-11):983-5. [PubMed:8911746 ]
  2. Glucodivol® (glipizide) tablets[package insert]. New York City, New York: Roerig, Division of Pfizer Inc; 2016. [Link]

PMID: 23236146

Glipizide

Glipizide

Product: Angelicin

Identifier : DBSNPE001634
Drug : DB01067 (Glipizide)
Interacting Gene/Enzyme : Glucose-6-phosphate 1-dehydrogenase
Gene Name : G6PD
UniProt ID : P11413
Defining Change(s) :

  • 573C>G

Allele Name : Pedoplis-Ckaro
Genotype(s) : Not Available
Type(s) : ADR Inferred
Groups : G6PD deficiency
Description : Increased risk of hemolytic anemia.
References :

  1. Eichelbaum M, Evert B: Influence of pharmacogenetics on drug disposition and response. Clin Exp Pharmacol Physiol. 1996 Oct-Nov;23(10-11):983-5. [PubMed:8911746 ]
  2. Glucodivol® (glipizide) tablets[package insert]. New York City, New York: Roerig, Division of Pfizer Inc; 2016. [Link]

PMID: 22171045

Glipizide

Glipizide

Product: Oxypaeoniflorin

Identifier : DBSNPE001635
Drug : DB01067 (Glipizide)
Interacting Gene/Enzyme : Glucose-6-phosphate 1-dehydrogenase
Gene Name : G6PD
UniProt ID : P11413
Defining Change(s) :

  • 593G->C

Allele Name : Santiago
Genotype(s) : Not Available
Type(s) : ADR Inferred
Groups : G6PD deficiency
Description : Increased risk of hemolytic anemia.
References :

  1. Eichelbaum M, Evert B: Influence of pharmacogenetics on drug disposition and response. Clin Exp Pharmacol Physiol. 1996 Oct-Nov;23(10-11):983-5. [PubMed:8911746 ]
  2. Glucodivol® (glipizide) tablets[package insert]. New York City, New York: Roerig, Division of Pfizer Inc; 2016. [Link]

PMID: 21804608

Glipizide

Glipizide

Product: Bremelanotide (Acetate)

Identifier : DBSNPE001636
Drug : DB01067 (Glipizide)
Interacting Gene/Enzyme : Glucose-6-phosphate 1-dehydrogenase
Gene Name : G6PD
UniProt ID : P11413
Defining Change(s) :

  • 637G->T

Allele Name : Minnesota, Marion, Gastonia, LeJeune
Genotype(s) : Not Available
Type(s) : ADR Inferred
Groups : G6PD deficiency
Description : Increased risk of hemolytic anemia.
References :

  1. Eichelbaum M, Evert B: Influence of pharmacogenetics on drug disposition and response. Clin Exp Pharmacol Physiol. 1996 Oct-Nov;23(10-11):983-5. [PubMed:8911746 ]
  2. Glucodivol® (glipizide) tablets[package insert]. New York City, New York: Roerig, Division of Pfizer Inc; 2016. [Link]

PMID: 20836251

Glipizide

Glipizide

Product: GSK-5959

Identifier : DBSNPE001637
Drug : DB01067 (Glipizide)
Interacting Gene/Enzyme : Glucose-6-phosphate 1-dehydrogenase
Gene Name : G6PD
UniProt ID : P11413
Defining Change(s) :

  • 637G->T, 1037A->T

Allele Name : Cincinnati
Genotype(s) : Not Available
Type(s) : ADR Inferred
Groups : G6PD deficiency
Description : Increased risk of hemolytic anemia.
References :

  1. Eichelbaum M, Evert B: Influence of pharmacogenetics on drug disposition and response. Clin Exp Pharmacol Physiol. 1996 Oct-Nov;23(10-11):983-5. [PubMed:8911746 ]
  2. Glucodivol® (glipizide) tablets[package insert]. New York City, New York: Roerig, Division of Pfizer Inc; 2016. [Link]

PMID: 11483998

Glipizide

Glipizide

Product: PFI-4

Identifier : DBSNPE001638
Drug : DB01067 (Glipizide)
Interacting Gene/Enzyme : Glucose-6-phosphate 1-dehydrogenase
Gene Name : G6PD
UniProt ID : P11413
Defining Change(s) :

  • 648T->G

Allele Name : Harilaou
Genotype(s) : Not Available
Type(s) : ADR Inferred
Groups : G6PD deficiency
Description : Increased risk of hemolytic anemia.
References :

  1. Eichelbaum M, Evert B: Influence of pharmacogenetics on drug disposition and response. Clin Exp Pharmacol Physiol. 1996 Oct-Nov;23(10-11):983-5. [PubMed:8911746 ]
  2. Glucodivol® (glipizide) tablets[package insert]. New York City, New York: Roerig, Division of Pfizer Inc; 2016. [Link]

PMID: 11174017

Glipizide

Glipizide

Product: TEPP-46

Identifier : DBSNPE001639
Drug : DB01067 (Glipizide)
Interacting Gene/Enzyme : Glucose-6-phosphate 1-dehydrogenase
Gene Name : G6PD
UniProt ID : P11413
Defining Change(s) :

  • 683_685delACA

Allele Name : North Dallas
Genotype(s) : Not Available
Type(s) : ADR Inferred
Groups : G6PD deficiency
Description : Increased risk of hemolytic anemia.
References :

  1. Eichelbaum M, Evert B: Influence of pharmacogenetics on drug disposition and response. Clin Exp Pharmacol Physiol. 1996 Oct-Nov;23(10-11):983-5. [PubMed:8911746 ]
  2. Glucodivol® (glipizide) tablets[package insert]. New York City, New York: Roerig, Division of Pfizer Inc; 2016. [Link]

PMID: 10604470

Glipizide

Glipizide

Product: Tetramisole (hydrochloride)

Identifier : DBSNPE001640
Drug : DB01067 (Glipizide)
Interacting Gene/Enzyme : Glucose-6-phosphate 1-dehydrogenase
Gene Name : G6PD
UniProt ID : P11413
Defining Change(s) :

  • 695G->A

Allele Name : Asahikawa
Genotype(s) : Not Available
Type(s) : ADR Inferred
Groups : G6PD deficiency
Description : Increased risk of hemolytic anemia.
References :

  1. Eichelbaum M, Evert B: Influence of pharmacogenetics on drug disposition and response. Clin Exp Pharmacol Physiol. 1996 Oct-Nov;23(10-11):983-5. [PubMed:8911746 ]
  2. Glucodivol® (glipizide) tablets[package insert]. New York City, New York: Roerig, Division of Pfizer Inc; 2016. [Link]

PMID: 19238155

Glipizide

Glipizide

Product: 7-Aminocephalosporanic acid

Identifier : DBSNPE001642
Drug : DB01067 (Glipizide)
Interacting Gene/Enzyme : Glucose-6-phosphate 1-dehydrogenase
Gene Name : G6PD
UniProt ID : P11413
Defining Change(s) :

  • 724_729delGGCACT

Allele Name : Stonybrook
Genotype(s) : Not Available
Type(s) : ADR Inferred
Groups : G6PD deficiency
Description : Increased risk of hemolytic anemia.
References :

  1. Eichelbaum M, Evert B: Influence of pharmacogenetics on drug disposition and response. Clin Exp Pharmacol Physiol. 1996 Oct-Nov;23(10-11):983-5. [PubMed:8911746 ]
  2. Glucodivol® (glipizide) tablets[package insert]. New York City, New York: Roerig, Division of Pfizer Inc; 2016. [Link]

PMID: 27574503

Glipizide

Glipizide

Product: Butylparaben

Identifier : DBSNPE001643
Drug : DB01067 (Glipizide)
Interacting Gene/Enzyme : Glucose-6-phosphate 1-dehydrogenase
Gene Name : G6PD
UniProt ID : P11413
Defining Change(s) :

  • 769C->G

Allele Name : Wayne
Genotype(s) : Not Available
Type(s) : ADR Inferred
Groups : G6PD deficiency
Description : Increased risk of hemolytic anemia.
References :

  1. Eichelbaum M, Evert B: Influence of pharmacogenetics on drug disposition and response. Clin Exp Pharmacol Physiol. 1996 Oct-Nov;23(10-11):983-5. [PubMed:8911746 ]
  2. Glucodivol® (glipizide) tablets[package insert]. New York City, New York: Roerig, Division of Pfizer Inc; 2016. [Link]

PMID: 26236657

Glipizide

Glipizide

Product: Butamben

Identifier : DBSNPE001644
Drug : DB01067 (Glipizide)
Interacting Gene/Enzyme : Glucose-6-phosphate 1-dehydrogenase
Gene Name : G6PD
UniProt ID : P11413
Defining Change(s) :

  • 806G->A

Allele Name : Aveiro
Genotype(s) : Not Available
Type(s) : ADR Inferred
Groups : G6PD deficiency
Description : Increased risk of hemolytic anemia.
References :

  1. Eichelbaum M, Evert B: Influence of pharmacogenetics on drug disposition and response. Clin Exp Pharmacol Physiol. 1996 Oct-Nov;23(10-11):983-5. [PubMed:8911746 ]
  2. Glucodivol® (glipizide) tablets[package insert]. New York City, New York: Roerig, Division of Pfizer Inc; 2016. [Link]

PMID: 26504752

Glipizide

Glipizide

Product: i-Inositol

Identifier : DBSNPE001645
Drug : DB01067 (Glipizide)
Interacting Gene/Enzyme : Glucose-6-phosphate 1-dehydrogenase
Gene Name : G6PD
UniProt ID : P11413
Defining Change(s) :

  • 820G->A

Allele Name : Cleveland Corum
Genotype(s) : Not Available
Type(s) : ADR Inferred
Groups : G6PD deficiency
Description : Increased risk of hemolytic anemia.
References :

  1. Eichelbaum M, Evert B: Influence of pharmacogenetics on drug disposition and response. Clin Exp Pharmacol Physiol. 1996 Oct-Nov;23(10-11):983-5. [PubMed:8911746 ]
  2. Glucodivol® (glipizide) tablets[package insert]. New York City, New York: Roerig, Division of Pfizer Inc; 2016. [Link]

PMID: 26183405

Glipizide

Glipizide

Product: Sulfamethoxypyridazine

Identifier : DBSNPE001646
Drug : DB01067 (Glipizide)
Interacting Gene/Enzyme : Glucose-6-phosphate 1-dehydrogenase
Gene Name : G6PD
UniProt ID : P11413
Defining Change(s) :

  • 821A>T

Allele Name : Lille
Genotype(s) : Not Available
Type(s) : ADR Inferred
Groups : G6PD deficiency
Description : Increased risk of hemolytic anemia.
References :

  1. Eichelbaum M, Evert B: Influence of pharmacogenetics on drug disposition and response. Clin Exp Pharmacol Physiol. 1996 Oct-Nov;23(10-11):983-5. [PubMed:8911746 ]
  2. Glucodivol® (glipizide) tablets[package insert]. New York City, New York: Roerig, Division of Pfizer Inc; 2016. [Link]

PMID: 25999997

Glipizide

Glipizide

Product: Cefixime

Identifier : DBSNPE001647
Drug : DB01067 (Glipizide)
Interacting Gene/Enzyme : Glucose-6-phosphate 1-dehydrogenase
Gene Name : G6PD
UniProt ID : P11413
Defining Change(s) :

  • 825G>C

Allele Name : Bangkok
Genotype(s) : Not Available
Type(s) : ADR Inferred
Groups : G6PD deficiency
Description : Increased risk of hemolytic anemia.
References :

  1. Eichelbaum M, Evert B: Influence of pharmacogenetics on drug disposition and response. Clin Exp Pharmacol Physiol. 1996 Oct-Nov;23(10-11):983-5. [PubMed:8911746 ]
  2. Glucodivol® (glipizide) tablets[package insert]. New York City, New York: Roerig, Division of Pfizer Inc; 2016. [Link]

PMID: 25352998

Glipizide

Glipizide

Product: Estropipate

Identifier : DBSNPE001648
Drug : DB01067 (Glipizide)
Interacting Gene/Enzyme : Glucose-6-phosphate 1-dehydrogenase
Gene Name : G6PD
UniProt ID : P11413
Defining Change(s) :

  • 826C->T

Allele Name : Sugao
Genotype(s) : Not Available
Type(s) : ADR Inferred
Groups : G6PD deficiency
Description : Increased risk of hemolytic anemia.
References :

  1. Eichelbaum M, Evert B: Influence of pharmacogenetics on drug disposition and response. Clin Exp Pharmacol Physiol. 1996 Oct-Nov;23(10-11):983-5. [PubMed:8911746 ]
  2. Glucodivol® (glipizide) tablets[package insert]. New York City, New York: Roerig, Division of Pfizer Inc; 2016. [Link]

PMID: 25068823

Glipizide

Glipizide

Product: L-Ornithine

Identifier : DBSNPE001649
Drug : DB01067 (Glipizide)
Interacting Gene/Enzyme : Glucose-6-phosphate 1-dehydrogenase
Gene Name : G6PD
UniProt ID : P11413
Defining Change(s) :

  • 832T->C

Allele Name : La Jolla
Genotype(s) : Not Available
Type(s) : ADR Inferred
Groups : G6PD deficiency
Description : Increased risk of hemolytic anemia.
References :

  1. Eichelbaum M, Evert B: Influence of pharmacogenetics on drug disposition and response. Clin Exp Pharmacol Physiol. 1996 Oct-Nov;23(10-11):983-5. [PubMed:8911746 ]
  2. Glucodivol® (glipizide) tablets[package insert]. New York City, New York: Roerig, Division of Pfizer Inc; 2016. [Link]

PMID: 22456226

Glipizide

Glipizide

Product: 4-Aminohippuric acid

Identifier : DBSNPE001650
Drug : DB01067 (Glipizide)
Interacting Gene/Enzyme : Glucose-6-phosphate 1-dehydrogenase
Gene Name : G6PD
UniProt ID : P11413
Defining Change(s) :

  • 833C->T

Allele Name : Wexham
Genotype(s) : Not Available
Type(s) : ADR Inferred
Groups : G6PD deficiency
Description : Increased risk of hemolytic anemia.
References :

  1. Eichelbaum M, Evert B: Influence of pharmacogenetics on drug disposition and response. Clin Exp Pharmacol Physiol. 1996 Oct-Nov;23(10-11):983-5. [PubMed:8911746 ]
  2. Glucodivol® (glipizide) tablets[package insert]. New York City, New York: Roerig, Division of Pfizer Inc; 2016. [Link]

PMID: 14551228

Glipizide

Glipizide

Product: Citric acid (trilithium salt tetrahydrate)

Identifier : DBSNPE001651
Drug : DB01067 (Glipizide)
Interacting Gene/Enzyme : Glucose-6-phosphate 1-dehydrogenase
Gene Name : G6PD
UniProt ID : P11413
Defining Change(s) :

  • 851T>C

Allele Name : Piodivkow
Genotype(s) : Not Available
Type(s) : ADR Inferred
Groups : G6PD deficiency
Description : Increased risk of hemolytic anemia.
References :

  1. Eichelbaum M, Evert B: Influence of pharmacogenetics on drug disposition and response. Clin Exp Pharmacol Physiol. 1996 Oct-Nov;23(10-11):983-5. [PubMed:8911746 ]
  2. Glucodivol® (glipizide) tablets[package insert]. New York City, New York: Roerig, Division of Pfizer Inc; 2016. [Link]

PMID: 15381634

Glipizide

Glipizide

Product: Cetylpyridinium (chloride monohydrate)

Identifier : DBSNPE001652
Drug : DB01067 (Glipizide)
Interacting Gene/Enzyme : Glucose-6-phosphate 1-dehydrogenase
Gene Name : G6PD
UniProt ID : P11413
Defining Change(s) :

  • 910G->T

Allele Name : West Virginia
Genotype(s) : Not Available
Type(s) : ADR Inferred
Groups : G6PD deficiency
Description : Increased risk of hemolytic anemia.
References :

  1. Eichelbaum M, Evert B: Influence of pharmacogenetics on drug disposition and response. Clin Exp Pharmacol Physiol. 1996 Oct-Nov;23(10-11):983-5. [PubMed:8911746 ]
  2. Glucodivol® (glipizide) tablets[package insert]. New York City, New York: Roerig, Division of Pfizer Inc; 2016. [Link]

PMID: 12475374

Glipizide

Glipizide

Product: Citalopram (hydrobromide)

Identifier : DBSNPE001653
Drug : DB01067 (Glipizide)
Interacting Gene/Enzyme : Glucose-6-phosphate 1-dehydrogenase
Gene Name : G6PD
UniProt ID : P11413
Defining Change(s) :

  • 921G->C

Allele Name : Omiya
Genotype(s) : Not Available
Type(s) : ADR Inferred
Groups : G6PD deficiency
Description : Increased risk of hemolytic anemia.
References :

  1. Eichelbaum M, Evert B: Influence of pharmacogenetics on drug disposition and response. Clin Exp Pharmacol Physiol. 1996 Oct-Nov;23(10-11):983-5. [PubMed:8911746 ]
  2. Glucodivol® (glipizide) tablets[package insert]. New York City, New York: Roerig, Division of Pfizer Inc; 2016. [Link]

PMID: 7830002

Glipizide

Glipizide

Product: Trihexyphenidyl (hydrochloride)

Identifier : DBSNPE001654
Drug : DB01067 (Glipizide)
Interacting Gene/Enzyme : Glucose-6-phosphate 1-dehydrogenase
Gene Name : G6PD
UniProt ID : P11413
Defining Change(s) :

  • 953_976delCCACCAAAGGGTACCTGGAC GACC

Allele Name : Nara
Genotype(s) : Not Available
Type(s) : ADR Inferred
Groups : G6PD deficiency
Description : Increased risk of hemolytic anemia.
References :

  1. Eichelbaum M, Evert B: Influence of pharmacogenetics on drug disposition and response. Clin Exp Pharmacol Physiol. 1996 Oct-Nov;23(10-11):983-5. [PubMed:8911746 ]
  2. Glucodivol® (glipizide) tablets[package insert]. New York City, New York: Roerig, Division of Pfizer Inc; 2016. [Link]

PMID: 19625579

Glipizide

Glipizide

Product: Docusate (Sodium)

Identifier : DBSNPE001655
Drug : DB01067 (Glipizide)
Interacting Gene/Enzyme : Glucose-6-phosphate 1-dehydrogenase
Gene Name : G6PD
UniProt ID : P11413
Defining Change(s) :

  • 962G->A

Allele Name : Manhattan
Genotype(s) : Not Available
Type(s) : ADR Inferred
Groups : G6PD deficiency
Description : Increased risk of hemolytic anemia.
References :

  1. Eichelbaum M, Evert B: Influence of pharmacogenetics on drug disposition and response. Clin Exp Pharmacol Physiol. 1996 Oct-Nov;23(10-11):983-5. [PubMed:8911746 ]
  2. Glucodivol® (glipizide) tablets[package insert]. New York City, New York: Roerig, Division of Pfizer Inc; 2016. [Link]

PMID: 15363972

Glipizide

Glipizide

Product: 6-Acetamidohexanoic acid

Identifier : DBSNPE001656
Drug : DB01067 (Glipizide)
Interacting Gene/Enzyme : Glucose-6-phosphate 1-dehydrogenase
Gene Name : G6PD
UniProt ID : P11413
Defining Change(s) :

  • 964T->C

Allele Name : Rehevot
Genotype(s) : Not Available
Type(s) : ADR Inferred
Groups : G6PD deficiency
Description : Increased risk of hemolytic anemia.
References :

  1. Eichelbaum M, Evert B: Influence of pharmacogenetics on drug disposition and response. Clin Exp Pharmacol Physiol. 1996 Oct-Nov;23(10-11):983-5. [PubMed:8911746 ]
  2. Glucodivol® (glipizide) tablets[package insert]. New York City, New York: Roerig, Division of Pfizer Inc; 2016. [Link]

PMID: 7624358

Glipizide

Glipizide

Product: Cefuroxime (sodium)

Identifier : DBSNPE001657
Drug : DB01067 (Glipizide)
Interacting Gene/Enzyme : Glucose-6-phosphate 1-dehydrogenase
Gene Name : G6PD
UniProt ID : P11413
Defining Change(s) :

  • 99A->G
  • 1360C->T

Allele Name : Honiara
Genotype(s) : Not Available
Type(s) : ADR Inferred
Groups : G6PD deficiency
Description : Increased risk of hemolytic anemia.
References :

  1. Eichelbaum M, Evert B: Influence of pharmacogenetics on drug disposition and response. Clin Exp Pharmacol Physiol. 1996 Oct-Nov;23(10-11):983-5. [PubMed:8911746 ]
  2. Glucodivol® (glipizide) tablets[package insert]. New York City, New York: Roerig, Division of Pfizer Inc; 2016. [Link]

PMID: 27819353

Glipizide

Glipizide

Product: Octinoxate

Identifier : DBSNPE001658
Drug : DB01067 (Glipizide)
Interacting Gene/Enzyme : Glucose-6-phosphate 1-dehydrogenase
Gene Name : G6PD
UniProt ID : P11413
Defining Change(s) :

  • 1246G->A

Allele Name : Tokyo, Fukushima
Genotype(s) : Not Available
Type(s) : ADR Inferred
Groups : G6PD deficiency
Description : Increased risk of hemolytic anemia.
References :

  1. Eichelbaum M, Evert B: Influence of pharmacogenetics on drug disposition and response. Clin Exp Pharmacol Physiol. 1996 Oct-Nov;23(10-11):983-5. [PubMed:8911746 ]
  2. Glucodivol® (glipizide) tablets[package insert]. New York City, New York: Roerig, Division of Pfizer Inc; 2016. [Link]

PMID: 10427162

Glipizide

Glipizide

Product: Anethole (trithione)

Identifier : DBSNPE001659
Drug : DB01067 (Glipizide)
Interacting Gene/Enzyme : Glucose-6-phosphate 1-dehydrogenase
Gene Name : G6PD
UniProt ID : P11413
Defining Change(s) :

  • 1003G->A

Allele Name : Chatham
Genotype(s) : Not Available
Type(s) : ADR Inferred
Groups : G6PD deficiency
Description : Increased risk of hemolytic anemia.
References :

  1. Eichelbaum M, Evert B: Influence of pharmacogenetics on drug disposition and response. Clin Exp Pharmacol Physiol. 1996 Oct-Nov;23(10-11):983-5. [PubMed:8911746 ]
  2. Glucodivol® (glipizide) tablets[package insert]. New York City, New York: Roerig, Division of Pfizer Inc; 2016. [Link]

PMID: 12624529

Glipizide

Glipizide

Product: Flufenamic acid

Identifier : DBSNPE001660
Drug : DB01067 (Glipizide)
Interacting Gene/Enzyme : Glucose-6-phosphate 1-dehydrogenase
Gene Name : G6PD
UniProt ID : P11413
Defining Change(s) :

  • 1004C->A

Allele Name : Fushan
Genotype(s) : Not Available
Type(s) : ADR Inferred
Groups : G6PD deficiency
Description : Increased risk of hemolytic anemia.
References :

  1. Eichelbaum M, Evert B: Influence of pharmacogenetics on drug disposition and response. Clin Exp Pharmacol Physiol. 1996 Oct-Nov;23(10-11):983-5. [PubMed:8911746 ]
  2. Glucodivol® (glipizide) tablets[package insert]. New York City, New York: Roerig, Division of Pfizer Inc; 2016. [Link]

PMID: 12121496

Glipizide

Glipizide

Product: Dehydroacetic acid

Identifier : DBSNPE001661
Drug : DB01067 (Glipizide)
Interacting Gene/Enzyme : Glucose-6-phosphate 1-dehydrogenase
Gene Name : G6PD
UniProt ID : P11413
Defining Change(s) :

  • 1052G->T

Allele Name : Partenope
Genotype(s) : Not Available
Type(s) : ADR Inferred
Groups : G6PD deficiency
Description : Increased risk of hemolytic anemia.
References :

  1. Eichelbaum M, Evert B: Influence of pharmacogenetics on drug disposition and response. Clin Exp Pharmacol Physiol. 1996 Oct-Nov;23(10-11):983-5. [PubMed:8911746 ]
  2. Glucodivol® (glipizide) tablets[package insert]. New York City, New York: Roerig, Division of Pfizer Inc; 2016. [Link]

PMID: 9574823

Glipizide

Glipizide

Product: Urethane

Identifier : DBSNPE001663
Drug : DB01067 (Glipizide)
Interacting Gene/Enzyme : Glucose-6-phosphate 1-dehydrogenase
Gene Name : G6PD
UniProt ID : P11413
Defining Change(s) :

  • 1193A->G

Allele Name : Anadia
Genotype(s) : Not Available
Type(s) : ADR Inferred
Groups : G6PD deficiency
Description : Increased risk of hemolytic anemia.
References :

  1. Eichelbaum M, Evert B: Influence of pharmacogenetics on drug disposition and response. Clin Exp Pharmacol Physiol. 1996 Oct-Nov;23(10-11):983-5. [PubMed:8911746 ]
  2. Glucodivol® (glipizide) tablets[package insert]. New York City, New York: Roerig, Division of Pfizer Inc; 2016. [Link]

PMID: 25257292

Glipizide

Glipizide

Product: Estradiol (benzoate)

Identifier : DBSNPE001664
Drug : DB01067 (Glipizide)
Interacting Gene/Enzyme : Glucose-6-phosphate 1-dehydrogenase
Gene Name : G6PD
UniProt ID : P11413
Defining Change(s) :

  • 1220A->C

Allele Name : Abeno
Genotype(s) : Not Available
Type(s) : ADR Inferred
Groups : G6PD deficiency
Description : Increased risk of hemolytic anemia.
References :

  1. Eichelbaum M, Evert B: Influence of pharmacogenetics on drug disposition and response. Clin Exp Pharmacol Physiol. 1996 Oct-Nov;23(10-11):983-5. [PubMed:8911746 ]
  2. Glucodivol® (glipizide) tablets[package insert]. New York City, New York: Roerig, Division of Pfizer Inc; 2016. [Link]

PMID: 21220707

Glipizide

Glipizide

Product: Cotinine

Identifier : DBSNPE001665
Drug : DB01067 (Glipizide)
Interacting Gene/Enzyme : Glucose-6-phosphate 1-dehydrogenase
Gene Name : G6PD
UniProt ID : P11413
Defining Change(s) :

  • 1291G->A

Allele Name : Surabaya
Genotype(s) : Not Available
Type(s) : ADR Inferred
Groups : G6PD deficiency
Description : Increased risk of hemolytic anemia.
References :

  1. Eichelbaum M, Evert B: Influence of pharmacogenetics on drug disposition and response. Clin Exp Pharmacol Physiol. 1996 Oct-Nov;23(10-11):983-5. [PubMed:8911746 ]
  2. Glucodivol® (glipizide) tablets[package insert]. New York City, New York: Roerig, Division of Pfizer Inc; 2016. [Link]

PMID: 26363071

Glipizide

Glipizide

Product: Crotamiton

Identifier : DBSNPE001666
Drug : DB01067 (Glipizide)
Interacting Gene/Enzyme : Glucose-6-phosphate 1-dehydrogenase
Gene Name : G6PD
UniProt ID : P11413
Defining Change(s) :

  • 1316G->C

Allele Name : Pawnee
Genotype(s) : Not Available
Type(s) : ADR Inferred
Groups : G6PD deficiency
Description : Increased risk of hemolytic anemia.
References :

  1. Eichelbaum M, Evert B: Influence of pharmacogenetics on drug disposition and response. Clin Exp Pharmacol Physiol. 1996 Oct-Nov;23(10-11):983-5. [PubMed:8911746 ]
  2. Glucodivol® (glipizide) tablets[package insert]. New York City, New York: Roerig, Division of Pfizer Inc; 2016. [Link]

PMID: 22920150

Glipizide

Glipizide

Product: Equilin

Identifier : DBSNPE001667
Drug : DB01067 (Glipizide)
Interacting Gene/Enzyme : Glucose-6-phosphate 1-dehydrogenase
Gene Name : G6PD
UniProt ID : P11413
Defining Change(s) :

  • 1342A->G

Allele Name : S. Antioco
Genotype(s) : Not Available
Type(s) : ADR Inferred
Groups : G6PD deficiency
Description : Increased risk of hemolytic anemia.
References :

  1. Eichelbaum M, Evert B: Influence of pharmacogenetics on drug disposition and response. Clin Exp Pharmacol Physiol. 1996 Oct-Nov;23(10-11):983-5. [PubMed:8911746 ]
  2. Glucodivol® (glipizide) tablets[package insert]. New York City, New York: Roerig, Division of Pfizer Inc; 2016. [Link]

PMID: 12907757

Glipizide

Glipizide

Product: Ticarcillin (disodium)

Identifier : DBSNPE001668
Drug : DB01067 (Glipizide)
Interacting Gene/Enzyme : Glucose-6-phosphate 1-dehydrogenase
Gene Name : G6PD
UniProt ID : P11413
Defining Change(s) :

  • 1347G->C

Allele Name : Cassano
Genotype(s) : Not Available
Type(s) : ADR Inferred
Groups : G6PD deficiency
Description : Increased risk of hemolytic anemia.
References :

  1. Eichelbaum M, Evert B: Influence of pharmacogenetics on drug disposition and response. Clin Exp Pharmacol Physiol. 1996 Oct-Nov;23(10-11):983-5. [PubMed:8911746 ]
  2. Glucodivol® (glipizide) tablets[package insert]. New York City, New York: Roerig, Division of Pfizer Inc; 2016. [Link]

PMID: 9446627

Glipizide

Glipizide

Product: Bekanamycin

Identifier : DBSNPE001669
Drug : DB01067 (Glipizide)
Interacting Gene/Enzyme : Glucose-6-phosphate 1-dehydrogenase
Gene Name : G6PD
UniProt ID : P11413
Defining Change(s) :

  • 1347G->C
  • 1360C->T

Allele Name : Hermoupolis
Genotype(s) : Not Available
Type(s) : ADR Inferred
Groups : G6PD deficiency
Description : Increased risk of hemolytic anemia.
References :

  1. Eichelbaum M, Evert B: Influence of pharmacogenetics on drug disposition and response. Clin Exp Pharmacol Physiol. 1996 Oct-Nov;23(10-11):983-5. [PubMed:8911746 ]
  2. Glucodivol® (glipizide) tablets[package insert]. New York City, New York: Roerig, Division of Pfizer Inc; 2016. [Link]

PMID: 7511895

Glipizide

Glipizide

Product: (+)-Camphor

Identifier : DBSNPE001670
Drug : DB01067 (Glipizide)
Interacting Gene/Enzyme : Glucose-6-phosphate 1-dehydrogenase
Gene Name : G6PD
UniProt ID : P11413
Defining Change(s) :

  • 1360C->T

Allele Name : Union,Maewo, Chinese-2, Kalo
Genotype(s) : Not Available
Type(s) : ADR Inferred
Groups : G6PD deficiency
Description : Increased risk of hemolytic anemia.
References :

  1. Eichelbaum M, Evert B: Influence of pharmacogenetics on drug disposition and response. Clin Exp Pharmacol Physiol. 1996 Oct-Nov;23(10-11):983-5. [PubMed:8911746 ]
  2. Glucodivol® (glipizide) tablets[package insert]. New York City, New York: Roerig, Division of Pfizer Inc; 2016. [Link]

PMID: 19372201

Glipizide

Glipizide

Product: Lactulose

Identifier : DBSNPE001671
Drug : DB01067 (Glipizide)
Interacting Gene/Enzyme : Glucose-6-phosphate 1-dehydrogenase
Gene Name : G6PD
UniProt ID : P11413
Defining Change(s) :

  • 1361G->A

Allele Name : Andalus
Genotype(s) : Not Available
Type(s) : ADR Inferred
Groups : G6PD deficiency
Description : Increased risk of hemolytic anemia.
References :

  1. Eichelbaum M, Evert B: Influence of pharmacogenetics on drug disposition and response. Clin Exp Pharmacol Physiol. 1996 Oct-Nov;23(10-11):983-5. [PubMed:8911746 ]
  2. Glucodivol® (glipizide) tablets[package insert]. New York City, New York: Roerig, Division of Pfizer Inc; 2016. [Link]

PMID: 17656463

Glipizide

Glipizide

Product: Cyclandelate

Identifier : DBSNPE001672
Drug : DB01067 (Glipizide)
Interacting Gene/Enzyme : Glucose-6-phosphate 1-dehydrogenase
Gene Name : G6PD
UniProt ID : P11413
Defining Change(s) :

  • 1376G->C

Allele Name : Cosenza
Genotype(s) : Not Available
Type(s) : ADR Inferred
Groups : G6PD deficiency
Description : Increased risk of hemolytic anemia.
References :

  1. Eichelbaum M, Evert B: Influence of pharmacogenetics on drug disposition and response. Clin Exp Pharmacol Physiol. 1996 Oct-Nov;23(10-11):983-5. [PubMed:8911746 ]
  2. Glucodivol® (glipizide) tablets[package insert]. New York City, New York: Roerig, Division of Pfizer Inc; 2016. [Link]

PMID: 11227737

Glipizide

Glipizide

Product: Ajmaline

Identifier : DBSNPE001673
Drug : DB01067 (Glipizide)
Interacting Gene/Enzyme : Glucose-6-phosphate 1-dehydrogenase
Gene Name : G6PD
UniProt ID : P11413
Defining Change(s) :

  • 1376G->T

Allele Name : Canton, Taiwan- Hakka, Gifu-like, Agrigento-like
Genotype(s) : Not Available
Type(s) : ADR Inferred
Groups : G6PD deficiency
Description : Increased risk of hemolytic anemia.
References :

  1. Eichelbaum M, Evert B: Influence of pharmacogenetics on drug disposition and response. Clin Exp Pharmacol Physiol. 1996 Oct-Nov;23(10-11):983-5. [PubMed:8911746 ]
  2. Glucodivol® (glipizide) tablets[package insert]. New York City, New York: Roerig, Division of Pfizer Inc; 2016. [Link]

PMID: 14763915

Glipizide

Glipizide

Product: Cefamandole (nafate)

Identifier : DBSNPE001674
Drug : DB01067 (Glipizide)
Interacting Gene/Enzyme : Glucose-6-phosphate 1-dehydrogenase
Gene Name : G6PD
UniProt ID : P11413
Defining Change(s) :

  • 1387C->A

Allele Name : Flores
Genotype(s) : Not Available
Type(s) : ADR Inferred
Groups : G6PD deficiency
Description : Increased risk of hemolytic anemia.
References :

  1. Eichelbaum M, Evert B: Influence of pharmacogenetics on drug disposition and response. Clin Exp Pharmacol Physiol. 1996 Oct-Nov;23(10-11):983-5. [PubMed:8911746 ]
  2. Glucodivol® (glipizide) tablets[package insert]. New York City, New York: Roerig, Division of Pfizer Inc; 2016. [Link]

PMID: 12969753

Glipizide

Glipizide

Product: Cyproheptadine (hydrochloride sesquihydrate)

Identifier : DBSNPE001675
Drug : DB01067 (Glipizide)
Interacting Gene/Enzyme : Glucose-6-phosphate 1-dehydrogenase
Gene Name : G6PD
UniProt ID : P11413
Defining Change(s) :

  • 1388G->A

Allele Name : Kaiping, Anant, Dhon, Sapporo-like, Wosera
Genotype(s) : Not Available
Type(s) : ADR Inferred
Groups : G6PD deficiency
Description : Increased risk of hemolytic anemia.
References :

  1. Eichelbaum M, Evert B: Influence of pharmacogenetics on drug disposition and response. Clin Exp Pharmacol Physiol. 1996 Oct-Nov;23(10-11):983-5. [PubMed:8911746 ]
  2. Glucodivol® (glipizide) tablets[package insert]. New York City, New York: Roerig, Division of Pfizer Inc; 2016. [Link]

PMID: 26319159

Glipizide

Glipizide

Product: Bromopride

Identifier : DBSNPE001676
Drug : DB01067 (Glipizide)
Interacting Gene/Enzyme : Glucose-6-phosphate 1-dehydrogenase
Gene Name : G6PD
UniProt ID : P11413
Defining Change(s) :

  • 169C->T

Allele Name : Kamogawa
Genotype(s) : Not Available
Type(s) : ADR Inferred
Groups : G6PD deficiency
Description : Increased risk of hemolytic anemia.
References :

  1. Eichelbaum M, Evert B: Influence of pharmacogenetics on drug disposition and response. Clin Exp Pharmacol Physiol. 1996 Oct-Nov;23(10-11):983-5. [PubMed:8911746 ]
  2. Glucodivol® (glipizide) tablets[package insert]. New York City, New York: Roerig, Division of Pfizer Inc; 2016. [Link]

PMID: 10801861

Glipizide

Glipizide

Product: Fluroxene

Identifier : DBSNPE001677
Drug : DB01067 (Glipizide)
Interacting Gene/Enzyme : Glucose-6-phosphate 1-dehydrogenase
Gene Name : G6PD
UniProt ID : P11413
Defining Change(s) :

  • 179T>C

Allele Name : Costanzo
Genotype(s) : Not Available
Type(s) : ADR Inferred
Groups : G6PD deficiency
Description : Increased risk of hemolytic anemia.
References :

  1. Eichelbaum M, Evert B: Influence of pharmacogenetics on drug disposition and response. Clin Exp Pharmacol Physiol. 1996 Oct-Nov;23(10-11):983-5. [PubMed:8911746 ]
  2. Glucodivol® (glipizide) tablets[package insert]. New York City, New York: Roerig, Division of Pfizer Inc; 2016. [Link]

PMID: 12486113

Glipizide

Glipizide

Product: Methoprene

Identifier : DBSNPE001678
Drug : DB01067 (Glipizide)
Interacting Gene/Enzyme : Glucose-6-phosphate 1-dehydrogenase
Gene Name : G6PD
UniProt ID : P11413
Defining Change(s) :

  • 185C->A

Allele Name : Amazonia
Genotype(s) : Not Available
Type(s) : ADR Inferred
Groups : G6PD deficiency
Description : Increased risk of hemolytic anemia.
References :

  1. Eichelbaum M, Evert B: Influence of pharmacogenetics on drug disposition and response. Clin Exp Pharmacol Physiol. 1996 Oct-Nov;23(10-11):983-5. [PubMed:8911746 ]
  2. Glucodivol® (glipizide) tablets[package insert]. New York City, New York: Roerig, Division of Pfizer Inc; 2016. [Link]

PMID: 12183643

Glipizide

Glipizide

Product: Nitroxoline

Identifier : DBSNPE001679
Drug : DB01067 (Glipizide)
Interacting Gene/Enzyme : Glucose-6-phosphate 1-dehydrogenase
Gene Name : G6PD
UniProt ID : P11413
Defining Change(s) :

  • 196T->A

Allele Name : Songklanagarind
Genotype(s) : Not Available
Type(s) : ADR Inferred
Groups : G6PD deficiency
Description : Increased risk of hemolytic anemia.
References :

  1. Eichelbaum M, Evert B: Influence of pharmacogenetics on drug disposition and response. Clin Exp Pharmacol Physiol. 1996 Oct-Nov;23(10-11):983-5. [PubMed:8911746 ]
  2. Glucodivol® (glipizide) tablets[package insert]. New York City, New York: Roerig, Division of Pfizer Inc; 2016. [Link]

PMID: 8396143

Glipizide

Glipizide

Product: Trioxsalen

Identifier : DBSNPE001680
Drug : DB01067 (Glipizide)
Interacting Gene/Enzyme : Glucose-6-phosphate 1-dehydrogenase
Gene Name : G6PD
UniProt ID : P11413
Defining Change(s) :

  • 202G->A
  • 871G->A

Allele Name : Hechi
Genotype(s) : Not Available
Type(s) : ADR Inferred
Groups : G6PD deficiency
Description : Increased risk of hemolytic anemia.
References :

  1. Eichelbaum M, Evert B: Influence of pharmacogenetics on drug disposition and response. Clin Exp Pharmacol Physiol. 1996 Oct-Nov;23(10-11):983-5. [PubMed:8911746 ]
  2. Glucodivol® (glipizide) tablets[package insert]. New York City, New York: Roerig, Division of Pfizer Inc; 2016. [Link]

PMID: 8405712

Glipizide

Glipizide

Product: Hydrocortisone (phosphate)

Identifier : DBSNPE001681
Drug : DB01067 (Glipizide)
Interacting Gene/Enzyme : Glucose-6-phosphate 1-dehydrogenase
Gene Name : G6PD
UniProt ID : P11413
Defining Change(s) :

  • 208T->C

Allele Name : Namouru
Genotype(s) : Not Available
Type(s) : ADR Inferred
Groups : G6PD deficiency
Description : Increased risk of hemolytic anemia.
References :

  1. Eichelbaum M, Evert B: Influence of pharmacogenetics on drug disposition and response. Clin Exp Pharmacol Physiol. 1996 Oct-Nov;23(10-11):983-5. [PubMed:8911746 ]
  2. Glucodivol® (glipizide) tablets[package insert]. New York City, New York: Roerig, Division of Pfizer Inc; 2016. [Link]

PMID: 1313797

Glipizide

Glipizide

Product: Penbutolol (sulfate)

Identifier : DBSNPE001682
Drug : DB01067 (Glipizide)
Interacting Gene/Enzyme : Glucose-6-phosphate 1-dehydrogenase
Gene Name : G6PD
UniProt ID : P11413
Defining Change(s) :

  • 352T>C

Allele Name : Bao Loc
Genotype(s) : Not Available
Type(s) : ADR Inferred
Groups : G6PD deficiency
Description : Increased risk of hemolytic anemia.
References :

  1. Eichelbaum M, Evert B: Influence of pharmacogenetics on drug disposition and response. Clin Exp Pharmacol Physiol. 1996 Oct-Nov;23(10-11):983-5. [PubMed:8911746 ]
  2. Glucodivol® (glipizide) tablets[package insert]. New York City, New York: Roerig, Division of Pfizer Inc; 2016. [Link]

PMID: 23940571

Glipizide

Glipizide

Product: Glafenine

Identifier : DBSNPE001683
Drug : DB01067 (Glipizide)
Interacting Gene/Enzyme : Glucose-6-phosphate 1-dehydrogenase
Gene Name : G6PD
UniProt ID : P11413
Defining Change(s) :

  • 375G->T, 379G->T383T->C384C>T

Allele Name : Crispim
Genotype(s) : Not Available
Type(s) : ADR Inferred
Groups : G6PD deficiency
Description : Increased risk of hemolytic anemia.
References :

  1. Eichelbaum M, Evert B: Influence of pharmacogenetics on drug disposition and response. Clin Exp Pharmacol Physiol. 1996 Oct-Nov;23(10-11):983-5. [PubMed:8911746 ]
  2. Glucodivol® (glipizide) tablets[package insert]. New York City, New York: Roerig, Division of Pfizer Inc; 2016. [Link]

PMID: 23364453

Glipizide

Glipizide

Product: Piperacetazine

Identifier : DBSNPE001684
Drug : DB01067 (Glipizide)
Interacting Gene/Enzyme : Glucose-6-phosphate 1-dehydrogenase
Gene Name : G6PD
UniProt ID : P11413
Defining Change(s) :

  • 376A->G
  • 463C->G

Allele Name : Acrokorinthos
Genotype(s) : Not Available
Type(s) : ADR Inferred
Groups : G6PD deficiency
Description : Increased risk of hemolytic anemia.
References :

  1. Eichelbaum M, Evert B: Influence of pharmacogenetics on drug disposition and response. Clin Exp Pharmacol Physiol. 1996 Oct-Nov;23(10-11):983-5. [PubMed:8911746 ]
  2. Glucodivol® (glipizide) tablets[package insert]. New York City, New York: Roerig, Division of Pfizer Inc; 2016. [Link]

PMID: 22134200

Glipizide

Glipizide

Product: Clofoctol

Identifier : DBSNPE001685
Drug : DB01067 (Glipizide)
Interacting Gene/Enzyme : Glucose-6-phosphate 1-dehydrogenase
Gene Name : G6PD
UniProt ID : P11413
Defining Change(s) :

  • 376A->G
  • 542A->T

Allele Name : Santa Maria
Genotype(s) : Not Available
Type(s) : ADR Inferred
Groups : G6PD deficiency
Description : Increased risk of hemolytic anemia.
References :

  1. Eichelbaum M, Evert B: Influence of pharmacogenetics on drug disposition and response. Clin Exp Pharmacol Physiol. 1996 Oct-Nov;23(10-11):983-5. [PubMed:8911746 ]
  2. Glucodivol® (glipizide) tablets[package insert]. New York City, New York: Roerig, Division of Pfizer Inc; 2016. [Link]

PMID: 22965295

Glipizide

Glipizide

Product: Bacampicillin (hydrochloride)

Identifier : DBSNPE001686
Drug : DB01067 (Glipizide)
Interacting Gene/Enzyme : Glucose-6-phosphate 1-dehydrogenase
Gene Name : G6PD
UniProt ID : P11413
Defining Change(s) :

  • 376A->G
  • 871G->A

Allele Name : Ananindeua
Genotype(s) : Not Available
Type(s) : ADR Inferred
Groups : G6PD deficiency
Description : Increased risk of hemolytic anemia.
References :

  1. Eichelbaum M, Evert B: Influence of pharmacogenetics on drug disposition and response. Clin Exp Pharmacol Physiol. 1996 Oct-Nov;23(10-11):983-5. [PubMed:8911746 ]
  2. Glucodivol® (glipizide) tablets[package insert]. New York City, New York: Roerig, Division of Pfizer Inc; 2016. [Link]

PMID: 20172966

Glipizide

Glipizide

Product: Bacampicillin

Identifier : DBSNPE001687
Drug : DB01067 (Glipizide)
Interacting Gene/Enzyme : Glucose-6-phosphate 1-dehydrogenase
Gene Name : G6PD
UniProt ID : P11413
Defining Change(s) :

  • 383T->C

Allele Name : Vanua Lava
Genotype(s) : Not Available
Type(s) : ADR Inferred
Groups : G6PD deficiency
Description : Increased risk of hemolytic anemia.
References :

  1. Eichelbaum M, Evert B: Influence of pharmacogenetics on drug disposition and response. Clin Exp Pharmacol Physiol. 1996 Oct-Nov;23(10-11):983-5. [PubMed:8911746 ]
  2. Glucodivol® (glipizide) tablets[package insert]. New York City, New York: Roerig, Division of Pfizer Inc; 2016. [Link]

PMID: 8863504

Glipizide

Glipizide

Product: Furaltadone (hydrochloride)

Identifier : DBSNPE001688
Drug : DB01067 (Glipizide)
Interacting Gene/Enzyme : Glucose-6-phosphate 1-dehydrogenase
Gene Name : G6PD
UniProt ID : P11413
Defining Change(s) :

  • 406C->T

Allele Name : Valladolid
Genotype(s) : Not Available
Type(s) : ADR Inferred
Groups : G6PD deficiency
Description : Increased risk of hemolytic anemia.
References :

  1. Eichelbaum M, Evert B: Influence of pharmacogenetics on drug disposition and response. Clin Exp Pharmacol Physiol. 1996 Oct-Nov;23(10-11):983-5. [PubMed:8911746 ]
  2. Glucodivol® (glipizide) tablets[package insert]. New York City, New York: Roerig, Division of Pfizer Inc; 2016. [Link]

PMID: 6877358

Glipizide

Glipizide

Product: Diloxanide furoate

Identifier : DBSNPE001689
Drug : DB01067 (Glipizide)
Interacting Gene/Enzyme : Glucose-6-phosphate 1-dehydrogenase
Gene Name : G6PD
UniProt ID : P11413
Defining Change(s) :

  • 409C->T

Allele Name : Belem
Genotype(s) : Not Available
Type(s) : ADR Inferred
Groups : G6PD deficiency
Description : Increased risk of hemolytic anemia.
References :

  1. Eichelbaum M, Evert B: Influence of pharmacogenetics on drug disposition and response. Clin Exp Pharmacol Physiol. 1996 Oct-Nov;23(10-11):983-5. [PubMed:8911746 ]
  2. Glucodivol® (glipizide) tablets[package insert]. New York City, New York: Roerig, Division of Pfizer Inc; 2016. [Link]

PMID: 11124853

Glipizide

Glipizide

Product: Denatonium (benzoate)

Identifier : DBSNPE001690
Drug : DB01067 (Glipizide)
Interacting Gene/Enzyme : Glucose-6-phosphate 1-dehydrogenase
Gene Name : G6PD
UniProt ID : P11413
Defining Change(s) :

  • 442G->A

Allele Name : Liuzhou
Genotype(s) : Not Available
Type(s) : ADR Inferred
Groups : G6PD deficiency
Description : Increased risk of hemolytic anemia.
References :

  1. Eichelbaum M, Evert B: Influence of pharmacogenetics on drug disposition and response. Clin Exp Pharmacol Physiol. 1996 Oct-Nov;23(10-11):983-5. [PubMed:8911746 ]
  2. Glucodivol® (glipizide) tablets[package insert]. New York City, New York: Roerig, Division of Pfizer Inc; 2016. [Link]

PMID: 8538742

Glipizide

Glipizide

Product: Chlorhexidine (dihydrochloride)

Identifier : DBSNPE001691
Drug : DB01067 (Glipizide)
Interacting Gene/Enzyme : Glucose-6-phosphate 1-dehydrogenase
Gene Name : G6PD
UniProt ID : P11413
Defining Change(s) :

  • 473G>A

Allele Name : Shenzen
Genotype(s) : Not Available
Type(s) : ADR Inferred
Groups : G6PD deficiency
Description : Increased risk of hemolytic anemia.
References :

  1. Eichelbaum M, Evert B: Influence of pharmacogenetics on drug disposition and response. Clin Exp Pharmacol Physiol. 1996 Oct-Nov;23(10-11):983-5. [PubMed:8911746 ]
  2. Glucodivol® (glipizide) tablets[package insert]. New York City, New York: Roerig, Division of Pfizer Inc; 2016. [Link]

PMID: 2832504

Glipizide

Glipizide

Product: 10-Undecenoic acid (zinc salt)

Identifier : DBSNPE001692
Drug : DB01067 (Glipizide)
Interacting Gene/Enzyme : Glucose-6-phosphate 1-dehydrogenase
Gene Name : G6PD
UniProt ID : P11413
Defining Change(s) :

  • 493A->G

Allele Name : Taipei “Chinese- 3”
Genotype(s) : Not Available
Type(s) : ADR Inferred
Groups : G6PD deficiency
Description : Increased risk of hemolytic anemia.
References :

  1. Eichelbaum M, Evert B: Influence of pharmacogenetics on drug disposition and response. Clin Exp Pharmacol Physiol. 1996 Oct-Nov;23(10-11):983-5. [PubMed:8911746 ]
  2. Glucodivol® (glipizide) tablets[package insert]. New York City, New York: Roerig, Division of Pfizer Inc; 2016. [Link]

PMID: 1704369

Glipizide

Glipizide

Product: Xylose

Identifier : DBSNPE001693
Drug : DB01067 (Glipizide)
Interacting Gene/Enzyme : Glucose-6-phosphate 1-dehydrogenase
Gene Name : G6PD
UniProt ID : P11413
Defining Change(s) :

  • 496C>T

Allele Name : Toledo
Genotype(s) : Not Available
Type(s) : ADR Inferred
Groups : G6PD deficiency
Description : Increased risk of hemolytic anemia.
References :

  1. Eichelbaum M, Evert B: Influence of pharmacogenetics on drug disposition and response. Clin Exp Pharmacol Physiol. 1996 Oct-Nov;23(10-11):983-5. [PubMed:8911746 ]
  2. Glucodivol® (glipizide) tablets[package insert]. New York City, New York: Roerig, Division of Pfizer Inc; 2016. [Link]

PMID: 26224855

Glipizide

Glipizide

Product: alpha-Boswellic acid

Identifier : DBSNPE001695
Drug : DB01067 (Glipizide)
Interacting Gene/Enzyme : Glucose-6-phosphate 1-dehydrogenase
Gene Name : G6PD
UniProt ID : P11413
Defining Change(s) :

  • 517T->C

Allele Name : Nankang
Genotype(s) : Not Available
Type(s) : ADR Inferred
Groups : G6PD deficiency
Description : Increased risk of hemolytic anemia.
References :

  1. Eichelbaum M, Evert B: Influence of pharmacogenetics on drug disposition and response. Clin Exp Pharmacol Physiol. 1996 Oct-Nov;23(10-11):983-5. [PubMed:8911746 ]
  2. Glucodivol® (glipizide) tablets[package insert]. New York City, New York: Roerig, Division of Pfizer Inc; 2016. [Link]

PMID: 22929182

Glipizide

Glipizide

Product: Ginsenoside Ro

Identifier : DBSNPE001696
Drug : DB01067 (Glipizide)
Interacting Gene/Enzyme : Glucose-6-phosphate 1-dehydrogenase
Gene Name : G6PD
UniProt ID : P11413
Defining Change(s) :

  • 519C->G

Allele Name : Miaoli
Genotype(s) : Not Available
Type(s) : ADR Inferred
Groups : G6PD deficiency
Description : Increased risk of hemolytic anemia.
References :

  1. Eichelbaum M, Evert B: Influence of pharmacogenetics on drug disposition and response. Clin Exp Pharmacol Physiol. 1996 Oct-Nov;23(10-11):983-5. [PubMed:8911746 ]
  2. Glucodivol® (glipizide) tablets[package insert]. New York City, New York: Roerig, Division of Pfizer Inc; 2016. [Link]

PMID: 18421270

Glipizide

Glipizide

Product: Ginsenoside Rh3

Identifier : DBSNPE001697
Drug : DB01067 (Glipizide)
Interacting Gene/Enzyme : Glucose-6-phosphate 1-dehydrogenase
Gene Name : G6PD
UniProt ID : P11413
Defining Change(s) :

  • 563C->T

Allele Name : Mediterranean, Dallas, Panama‚ Sassari, Cagliari, Birmingham
Genotype(s) : Not Available
Type(s) : ADR Inferred
Groups : G6PD deficiency
Description : Increased risk of hemolytic anemia.
References :

  1. Eichelbaum M, Evert B: Influence of pharmacogenetics on drug disposition and response. Clin Exp Pharmacol Physiol. 1996 Oct-Nov;23(10-11):983-5. [PubMed:8911746 ]
  2. Glucodivol® (glipizide) tablets[package insert]. New York City, New York: Roerig, Division of Pfizer Inc; 2016. [Link]

PMID: 9016935

Glipizide

Glipizide

Product: Ginsenoside Rh2

Identifier : DBSNPE001698
Drug : DB01067 (Glipizide)
Interacting Gene/Enzyme : Glucose-6-phosphate 1-dehydrogenase
Gene Name : G6PD
UniProt ID : P11413
Defining Change(s) :

  • 592C->T

Allele Name : Coimbra Shunde
Genotype(s) : Not Available
Type(s) : ADR Inferred
Groups : G6PD deficiency
Description : Increased risk of hemolytic anemia.
References :

  1. Eichelbaum M, Evert B: Influence of pharmacogenetics on drug disposition and response. Clin Exp Pharmacol Physiol. 1996 Oct-Nov;23(10-11):983-5. [PubMed:8911746 ]
  2. Glucodivol® (glipizide) tablets[package insert]. New York City, New York: Roerig, Division of Pfizer Inc; 2016. [Link]

PMID: 22177947

Glipizide

Glipizide

Product: Ginsenoside Rh1

Identifier : DBSNPE001699
Drug : DB01067 (Glipizide)
Interacting Gene/Enzyme : Glucose-6-phosphate 1-dehydrogenase
Gene Name : G6PD
UniProt ID : P11413
Defining Change(s) :

  • 593G>A

Allele Name : Nilgiri
Genotype(s) : Not Available
Type(s) : ADR Inferred
Groups : G6PD deficiency
Description : Increased risk of hemolytic anemia.
References :

  1. Eichelbaum M, Evert B: Influence of pharmacogenetics on drug disposition and response. Clin Exp Pharmacol Physiol. 1996 Oct-Nov;23(10-11):983-5. [PubMed:8911746 ]
  2. Glucodivol® (glipizide) tablets[package insert]. New York City, New York: Roerig, Division of Pfizer Inc; 2016. [Link]

PMID: 22930710

Glipizide

Glipizide

Product: Ginsenoside Rg2

Identifier : DBSNPE001700
Drug : DB01067 (Glipizide)
Interacting Gene/Enzyme : Glucose-6-phosphate 1-dehydrogenase
Gene Name : G6PD
UniProt ID : P11413
Defining Change(s) :

  • 679C->T

Allele Name : Radlowo
Genotype(s) : Not Available
Type(s) : ADR Inferred
Groups : G6PD deficiency
Description : Increased risk of hemolytic anemia.
References :

  1. Eichelbaum M, Evert B: Influence of pharmacogenetics on drug disposition and response. Clin Exp Pharmacol Physiol. 1996 Oct-Nov;23(10-11):983-5. [PubMed:8911746 ]
  2. Glucodivol® (glipizide) tablets[package insert]. New York City, New York: Roerig, Division of Pfizer Inc; 2016. [Link]

PMID: 20823098

Glipizide

Glipizide

Product: Ginsenoside Rf

Identifier : DBSNPE001701
Drug : DB01067 (Glipizide)
Interacting Gene/Enzyme : Glucose-6-phosphate 1-dehydrogenase
Gene Name : G6PD
UniProt ID : P11413
Defining Change(s) :

  • 811G>C

Allele Name : Roubaix
Genotype(s) : Not Available
Type(s) : ADR Inferred
Groups : G6PD deficiency
Description : Increased risk of hemolytic anemia.
References :

  1. Eichelbaum M, Evert B: Influence of pharmacogenetics on drug disposition and response. Clin Exp Pharmacol Physiol. 1996 Oct-Nov;23(10-11):983-5. [PubMed:8911746 ]
  2. Glucodivol® (glipizide) tablets[package insert]. New York City, New York: Roerig, Division of Pfizer Inc; 2016. [Link]

PMID: 9237694

Glipizide

Glipizide

Product: Ginsenoside F1

Identifier : DBSNPE001702
Drug : DB01067 (Glipizide)
Interacting Gene/Enzyme : Glucose-6-phosphate 1-dehydrogenase
Gene Name : G6PD
UniProt ID : P11413
Defining Change(s) :

  • 835A->G

Allele Name : Haikou
Genotype(s) : Not Available
Type(s) : ADR Inferred
Groups : G6PD deficiency
Description : Increased risk of hemolytic anemia.
References :

  1. Eichelbaum M, Evert B: Influence of pharmacogenetics on drug disposition and response. Clin Exp Pharmacol Physiol. 1996 Oct-Nov;23(10-11):983-5. [PubMed:8911746 ]
  2. Glucodivol® (glipizide) tablets[package insert]. New York City, New York: Roerig, Division of Pfizer Inc; 2016. [Link]

PMID: 4018272

Glipizide

Glipizide

Product: Panaxatriol

Identifier : DBSNPE001703
Drug : DB01067 (Glipizide)
Interacting Gene/Enzyme : Glucose-6-phosphate 1-dehydrogenase
Gene Name : G6PD
UniProt ID : P11413
Defining Change(s) :

  • 835A->T

Allele Name : Chinese-1
Genotype(s) : Not Available
Type(s) : ADR Inferred
Groups : G6PD deficiency
Description : Increased risk of hemolytic anemia.
References :

  1. Eichelbaum M, Evert B: Influence of pharmacogenetics on drug disposition and response. Clin Exp Pharmacol Physiol. 1996 Oct-Nov;23(10-11):983-5. [PubMed:8911746 ]
  2. Glucodivol® (glipizide) tablets[package insert]. New York City, New York: Roerig, Division of Pfizer Inc; 2016. [Link]

PMID: 6283496

Glipizide

Glipizide

Product: Panaxadiol

Identifier : DBSNPE001704
Drug : DB01067 (Glipizide)
Interacting Gene/Enzyme : Glucose-6-phosphate 1-dehydrogenase
Gene Name : G6PD
UniProt ID : P11413
Defining Change(s) :

  • 848A>G

Allele Name : Mizushima
Genotype(s) : Not Available
Type(s) : ADR Inferred
Groups : G6PD deficiency
Description : Increased risk of hemolytic anemia.
References :

  1. Eichelbaum M, Evert B: Influence of pharmacogenetics on drug disposition and response. Clin Exp Pharmacol Physiol. 1996 Oct-Nov;23(10-11):983-5. [PubMed:8911746 ]
  2. Glucodivol® (glipizide) tablets[package insert]. New York City, New York: Roerig, Division of Pfizer Inc; 2016. [Link]

PMID: 15313368

Glipizide

Glipizide

Product: Genistin

Identifier : DBSNPE001705
Drug : DB01067 (Glipizide)
Interacting Gene/Enzyme : Glucose-6-phosphate 1-dehydrogenase
Gene Name : G6PD
UniProt ID : P11413
Defining Change(s) :

  • 853C->T

Allele Name : Osaka
Genotype(s) : Not Available
Type(s) : ADR Inferred
Groups : G6PD deficiency
Description : Increased risk of hemolytic anemia.
References :

  1. Eichelbaum M, Evert B: Influence of pharmacogenetics on drug disposition and response. Clin Exp Pharmacol Physiol. 1996 Oct-Nov;23(10-11):983-5. [PubMed:8911746 ]
  2. Glucodivol® (glipizide) tablets[package insert]. New York City, New York: Roerig, Division of Pfizer Inc; 2016. [Link]

PMID: 19628655

Glipizide

Glipizide

Product: Dehydrocostus Lactone

Identifier : DBSNPE001706
Drug : DB01067 (Glipizide)
Interacting Gene/Enzyme : Glucose-6-phosphate 1-dehydrogenase
Gene Name : G6PD
UniProt ID : P11413
Defining Change(s) :

  • 871G->A

Allele Name : Viangchan, Jammu
Genotype(s) : Not Available
Type(s) : ADR Inferred
Groups : G6PD deficiency
Description : Increased risk of hemolytic anemia.
References :

  1. Eichelbaum M, Evert B: Influence of pharmacogenetics on drug disposition and response. Clin Exp Pharmacol Physiol. 1996 Oct-Nov;23(10-11):983-5. [PubMed:8911746 ]
  2. Glucodivol® (glipizide) tablets[package insert]. New York City, New York: Roerig, Division of Pfizer Inc; 2016. [Link]

PMID: 10990079

Glipizide

Glipizide

Product: Gypenoside XVII

Identifier : DBSNPE001707
Drug : DB01067 (Glipizide)
Interacting Gene/Enzyme : Glucose-6-phosphate 1-dehydrogenase
Gene Name : G6PD
UniProt ID : P11413
Defining Change(s) :

  • 916G->A

Allele Name : Seoul
Genotype(s) : Not Available
Type(s) : ADR Inferred
Groups : G6PD deficiency
Description : Increased risk of hemolytic anemia.
References :

  1. Eichelbaum M, Evert B: Influence of pharmacogenetics on drug disposition and response. Clin Exp Pharmacol Physiol. 1996 Oct-Nov;23(10-11):983-5. [PubMed:8911746 ]
  2. Glucodivol® (glipizide) tablets[package insert]. New York City, New York: Roerig, Division of Pfizer Inc; 2016. [Link]

PMID: 2560175

Glipizide

Glipizide

Product: Pseudoginsenoside F11

Identifier : DBSNPE001708
Drug : DB01067 (Glipizide)
Interacting Gene/Enzyme : Glucose-6-phosphate 1-dehydrogenase
Gene Name : G6PD
UniProt ID : P11413
Defining Change(s) :

  • 929G->A

Allele Name : Ludhiana
Genotype(s) : Not Available
Type(s) : ADR Inferred
Groups : G6PD deficiency
Description : Increased risk of hemolytic anemia.
References :

  1. Eichelbaum M, Evert B: Influence of pharmacogenetics on drug disposition and response. Clin Exp Pharmacol Physiol. 1996 Oct-Nov;23(10-11):983-5. [PubMed:8911746 ]
  2. Glucodivol® (glipizide) tablets[package insert]. New York City, New York: Roerig, Division of Pfizer Inc; 2016. [Link]

PMID: 26198634

Glipizide

Glipizide

Product: Rosmarinic acid

Identifier : DBSNPE001709
Drug : DB01067 (Glipizide)
Interacting Gene/Enzyme : Glucose-6-phosphate 1-dehydrogenase
Gene Name : G6PD
UniProt ID : P11413
Defining Change(s) :

  • 977C->A

Allele Name : Farroupilha
Genotype(s) : Not Available
Type(s) : ADR Inferred
Groups : G6PD deficiency
Description : Increased risk of hemolytic anemia.
References :

  1. Eichelbaum M, Evert B: Influence of pharmacogenetics on drug disposition and response. Clin Exp Pharmacol Physiol. 1996 Oct-Nov;23(10-11):983-5. [PubMed:8911746 ]
  2. Glucodivol® (glipizide) tablets[package insert]. New York City, New York: Roerig, Division of Pfizer Inc; 2016. [Link]

PMID: 10085108

Glipizide

Glipizide

Product: Sanguinarine (chloride)

Identifier : DBSNPE001710
Drug : DB01067 (Glipizide)
Interacting Gene/Enzyme : Glucose-6-phosphate 1-dehydrogenase
Gene Name : G6PD
UniProt ID : P11413
Defining Change(s) :

  • 1024C->T

Allele Name : Chinese-5
Genotype(s) : Not Available
Type(s) : ADR Inferred
Groups : G6PD deficiency
Description : Increased risk of hemolytic anemia.
References :

  1. Eichelbaum M, Evert B: Influence of pharmacogenetics on drug disposition and response. Clin Exp Pharmacol Physiol. 1996 Oct-Nov;23(10-11):983-5. [PubMed:8911746 ]
  2. Glucodivol® (glipizide) tablets[package insert]. New York City, New York: Roerig, Division of Pfizer Inc; 2016. [Link]

PMID: 10201821

Glipizide

Glipizide

Product: Notoginsenoside R1

Identifier : DBSNPE001711
Drug : DB01067 (Glipizide)
Interacting Gene/Enzyme : Glucose-6-phosphate 1-dehydrogenase
Gene Name : G6PD
UniProt ID : P11413
Defining Change(s) :

  • 130G>A

Allele Name : Rignano
Genotype(s) : Not Available
Type(s) : ADR Inferred
Groups : G6PD deficiency
Description : Increased risk of hemolytic anemia.
References :

  1. Eichelbaum M, Evert B: Influence of pharmacogenetics on drug disposition and response. Clin Exp Pharmacol Physiol. 1996 Oct-Nov;23(10-11):983-5. [PubMed:8911746 ]
  2. Glucodivol® (glipizide) tablets[package insert]. New York City, New York: Roerig, Division of Pfizer Inc; 2016. [Link]

PMID: 22803826

Glipizide

Glipizide

Product: Mulberroside A

Identifier : DBSNPE001712
Drug : DB01067 (Glipizide)
Interacting Gene/Enzyme : Glucose-6-phosphate 1-dehydrogenase
Gene Name : G6PD
UniProt ID : P11413
Defining Change(s) :

  • 131C->G

Allele Name : Orissa
Genotype(s) : Not Available
Type(s) : ADR Inferred
Groups : G6PD deficiency
Description : Increased risk of hemolytic anemia.
References :

  1. Eichelbaum M, Evert B: Influence of pharmacogenetics on drug disposition and response. Clin Exp Pharmacol Physiol. 1996 Oct-Nov;23(10-11):983-5. [PubMed:8911746 ]
  2. Glucodivol® (glipizide) tablets[package insert]. New York City, New York: Roerig, Division of Pfizer Inc; 2016. [Link]

PMID: 11040338

Glipizide

Glipizide

Product: Prim-O-glucosylcimifugin

Identifier : DBSNPE001713
Drug : DB01067 (Glipizide)
Interacting Gene/Enzyme : Glucose-6-phosphate 1-dehydrogenase
Gene Name : G6PD
UniProt ID : P11413
Defining Change(s) :

  • 1380G>C

Allele Name : G6PDNice
Genotype(s) : Not Available
Type(s) : ADR Inferred
Groups : G6PD deficiency
Description : Increased risk of hemolytic anemia.
References :

  1. Eichelbaum M, Evert B: Influence of pharmacogenetics on drug disposition and response. Clin Exp Pharmacol Physiol. 1996 Oct-Nov;23(10-11):983-5. [PubMed:8911746 ]
  2. Glucodivol® (glipizide) tablets[package insert]. New York City, New York: Roerig, Division of Pfizer Inc; 2016. [Link]

PMID: 7604948

Glipizide

Glipizide

Product: D-Pantothenic acid (hemicalcium salt)

Identifier : DBSNPE001714
Drug : DB01067 (Glipizide)
Interacting Gene/Enzyme : Glucose-6-phosphate 1-dehydrogenase
Gene Name : G6PD
UniProt ID : P11413
Defining Change(s) :

  • 1387C->T

Allele Name : Kamiube, Keelung
Genotype(s) : Not Available
Type(s) : ADR Inferred
Groups : G6PD deficiency
Description : Increased risk of hemolytic anemia.
References :

  1. Eichelbaum M, Evert B: Influence of pharmacogenetics on drug disposition and response. Clin Exp Pharmacol Physiol. 1996 Oct-Nov;23(10-11):983-5. [PubMed:8911746 ]
  2. Glucodivol® (glipizide) tablets[package insert]. New York City, New York: Roerig, Division of Pfizer Inc; 2016. [Link]

PMID: 20469868

Glipizide

Glipizide

Product: Schisantherin B

Identifier : DBSNPE001715
Drug : DB01067 (Glipizide)
Interacting Gene/Enzyme : Glucose-6-phosphate 1-dehydrogenase
Gene Name : G6PD
UniProt ID : P11413
Defining Change(s) :

  • 1400C->G

Allele Name : Neapolis
Genotype(s) : Not Available
Type(s) : ADR Inferred
Groups : G6PD deficiency
Description : Increased risk of hemolytic anemia.
References :

  1. Eichelbaum M, Evert B: Influence of pharmacogenetics on drug disposition and response. Clin Exp Pharmacol Physiol. 1996 Oct-Nov;23(10-11):983-5. [PubMed:8911746 ]
  2. Glucodivol® (glipizide) tablets[package insert]. New York City, New York: Roerig, Division of Pfizer Inc; 2016. [Link]

PMID: 19874229

Glipizide

Glipizide

Product: Sipeimine

Identifier : DBSNPE001716
Drug : DB01067 (Glipizide)
Interacting Gene/Enzyme : Glucose-6-phosphate 1-dehydrogenase
Gene Name : G6PD
UniProt ID : P11413
Defining Change(s) :

  • 143T->C

Allele Name : Aures
Genotype(s) : Not Available
Type(s) : ADR Inferred
Groups : G6PD deficiency
Description : Increased risk of hemolytic anemia.
References :

  1. Eichelbaum M, Evert B: Influence of pharmacogenetics on drug disposition and response. Clin Exp Pharmacol Physiol. 1996 Oct-Nov;23(10-11):983-5. [PubMed:8911746 ]
  2. Glucodivol® (glipizide) tablets[package insert]. New York City, New York: Roerig, Division of Pfizer Inc; 2016. [Link]

PMID: 12503693

Glipizide

Glipizide

Product: Neobavaisoflavone

Identifier : DBSNPE001717
Drug : DB01067 (Glipizide)
Interacting Gene/Enzyme : Glucose-6-phosphate 1-dehydrogenase
Gene Name : G6PD
UniProt ID : P11413
Defining Change(s) :

  • 1442C->G

Allele Name : Split
Genotype(s) : Not Available
Type(s) : ADR Inferred
Groups : G6PD deficiency
Description : Increased risk of hemolytic anemia.
References :

  1. Eichelbaum M, Evert B: Influence of pharmacogenetics on drug disposition and response. Clin Exp Pharmacol Physiol. 1996 Oct-Nov;23(10-11):983-5. [PubMed:8911746 ]
  2. Glucodivol® (glipizide) tablets[package insert]. New York City, New York: Roerig, Division of Pfizer Inc; 2016. [Link]

PMID: 1614417

Glipizide

Glipizide

Product: Neoandrographolide

Identifier : DBSNPE001718
Drug : DB01067 (Glipizide)
Interacting Gene/Enzyme : Glucose-6-phosphate 1-dehydrogenase
Gene Name : G6PD
UniProt ID : P11413
Defining Change(s) :

  • 148C->T

Allele Name : Kambos
Genotype(s) : Not Available
Type(s) : ADR Inferred
Groups : G6PD deficiency
Description : Increased risk of hemolytic anemia.
References :

  1. Eichelbaum M, Evert B: Influence of pharmacogenetics on drug disposition and response. Clin Exp Pharmacol Physiol. 1996 Oct-Nov;23(10-11):983-5. [PubMed:8911746 ]
  2. Glucodivol® (glipizide) tablets[package insert]. New York City, New York: Roerig, Division of Pfizer Inc; 2016. [Link]

PMID: 2864478

Glipizide

Glipizide

Product: Neochlorogenic acid

Identifier : DBSNPE001719
Drug : DB01067 (Glipizide)
Interacting Gene/Enzyme : Glucose-6-phosphate 1-dehydrogenase
Gene Name : G6PD
UniProt ID : P11413
Defining Change(s) :

  • 170G>A

Allele Name : Palesdivina
Genotype(s) : Not Available
Type(s) : ADR Inferred
Groups : G6PD deficiency
Description : Increased risk of hemolytic anemia.
References :

  1. Eichelbaum M, Evert B: Influence of pharmacogenetics on drug disposition and response. Clin Exp Pharmacol Physiol. 1996 Oct-Nov;23(10-11):983-5. [PubMed:8911746 ]
  2. Glucodivol® (glipizide) tablets[package insert]. New York City, New York: Roerig, Division of Pfizer Inc; 2016. [Link]

PMID: 6627946

Glipizide

Glipizide

Product: Eprodisate (disodium)

Identifier : DBSNPE001720
Drug : DB01067 (Glipizide)
Interacting Gene/Enzyme : Glucose-6-phosphate 1-dehydrogenase
Gene Name : G6PD
UniProt ID : P11413
Defining Change(s) :

  • 172G->A

Allele Name : Metaponto
Genotype(s) : Not Available
Type(s) : ADR Inferred
Groups : G6PD deficiency
Description : Increased risk of hemolytic anemia.
References :

  1. Eichelbaum M, Evert B: Influence of pharmacogenetics on drug disposition and response. Clin Exp Pharmacol Physiol. 1996 Oct-Nov;23(10-11):983-5. [PubMed:8911746 ]
  2. Glucodivol® (glipizide) tablets[package insert]. New York City, New York: Roerig, Division of Pfizer Inc; 2016. [Link]

PMID: 25908840

Glipizide

Glipizide

Product: Diazoxide

Identifier : DBSNPE001721
Drug : DB01067 (Glipizide)
Interacting Gene/Enzyme : Glucose-6-phosphate 1-dehydrogenase
Gene Name : G6PD
UniProt ID : P11413
Defining Change(s) :

  • 185C->T

Allele Name : Musashino
Genotype(s) : Not Available
Type(s) : ADR Inferred
Groups : G6PD deficiency
Description : Increased risk of hemolytic anemia.
References :

  1. Eichelbaum M, Evert B: Influence of pharmacogenetics on drug disposition and response. Clin Exp Pharmacol Physiol. 1996 Oct-Nov;23(10-11):983-5. [PubMed:8911746 ]
  2. Glucodivol® (glipizide) tablets[package insert]. New York City, New York: Roerig, Division of Pfizer Inc; 2016. [Link]

PMID: 25730905

Glipizide

Glipizide

Product: Tolperisone (hydrochloride)

Identifier : DBSNPE001722
Drug : DB01067 (Glipizide)
Interacting Gene/Enzyme : Glucose-6-phosphate 1-dehydrogenase
Gene Name : G6PD
UniProt ID : P11413
Defining Change(s) :

  • 202G->A

Allele Name : Asahi
Genotype(s) : Not Available
Type(s) : ADR Inferred
Groups : G6PD deficiency
Description : Increased risk of hemolytic anemia.
References :

  1. Eichelbaum M, Evert B: Influence of pharmacogenetics on drug disposition and response. Clin Exp Pharmacol Physiol. 1996 Oct-Nov;23(10-11):983-5. [PubMed:8911746 ]
  2. Glucodivol® (glipizide) tablets[package insert]. New York City, New York: Roerig, Division of Pfizer Inc; 2016. [Link]

PMID: 23401645

Glipizide

Glipizide

Product: Fenbufen

Identifier : DBSNPE001723
Drug : DB01067 (Glipizide)
Interacting Gene/Enzyme : Glucose-6-phosphate 1-dehydrogenase
Gene Name : G6PD
UniProt ID : P11413
Defining Change(s) :

  • 202G->A
  • 376A->G

Allele Name : A- (202), Ferrara I
Genotype(s) : Not Available
Type(s) : ADR Inferred
Groups : G6PD deficiency
Description : Increased risk of hemolytic anemia.
References :

  1. Eichelbaum M, Evert B: Influence of pharmacogenetics on drug disposition and response. Clin Exp Pharmacol Physiol. 1996 Oct-Nov;23(10-11):983-5. [PubMed:8911746 ]
  2. Glucodivol® (glipizide) tablets[package insert]. New York City, New York: Roerig, Division of Pfizer Inc; 2016. [Link]

PMID: 21968811

Glipizide

Glipizide

Product: Ramifenazone

Identifier : DBSNPE001724
Drug : DB01067 (Glipizide)
Interacting Gene/Enzyme : Glucose-6-phosphate 1-dehydrogenase
Gene Name : G6PD
UniProt ID : P11413
Defining Change(s) :

  • 209A->G

Allele Name : Murcia Oristano
Genotype(s) : Not Available
Type(s) : ADR Inferred
Groups : G6PD deficiency
Description : Increased risk of hemolytic anemia.
References :

  1. Eichelbaum M, Evert B: Influence of pharmacogenetics on drug disposition and response. Clin Exp Pharmacol Physiol. 1996 Oct-Nov;23(10-11):983-5. [PubMed:8911746 ]
  2. Glucodivol® (glipizide) tablets[package insert]. New York City, New York: Roerig, Division of Pfizer Inc; 2016. [Link]

PMID: 22032926

Glipizide

Glipizide

Product: Menbutone

Identifier : DBSNPE001725
Drug : DB01067 (Glipizide)
Interacting Gene/Enzyme : Glucose-6-phosphate 1-dehydrogenase
Gene Name : G6PD
UniProt ID : P11413
Defining Change(s) :

  • 241C->T

Allele Name : Ube Konan
Genotype(s) : Not Available
Type(s) : ADR Inferred
Groups : G6PD deficiency
Description : Increased risk of hemolytic anemia.
References :

  1. Eichelbaum M, Evert B: Influence of pharmacogenetics on drug disposition and response. Clin Exp Pharmacol Physiol. 1996 Oct-Nov;23(10-11):983-5. [PubMed:8911746 ]
  2. Glucodivol® (glipizide) tablets[package insert]. New York City, New York: Roerig, Division of Pfizer Inc; 2016. [Link]

PMID: 8586030

Glipizide

Glipizide

Product: Benzbromarone

Identifier : DBSNPE001726
Drug : DB01067 (Glipizide)
Interacting Gene/Enzyme : Glucose-6-phosphate 1-dehydrogenase
Gene Name : G6PD
UniProt ID : P11413
Defining Change(s) :

  • 242G->A

Allele Name : Lagosanto
Genotype(s) : Not Available
Type(s) : ADR Inferred
Groups : G6PD deficiency
Description : Increased risk of hemolytic anemia.
References :

  1. Eichelbaum M, Evert B: Influence of pharmacogenetics on drug disposition and response. Clin Exp Pharmacol Physiol. 1996 Oct-Nov;23(10-11):983-5. [PubMed:8911746 ]
  2. Glucodivol® (glipizide) tablets[package insert]. New York City, New York: Roerig, Division of Pfizer Inc; 2016. [Link]

PMID: 27355192

Glipizide

Glipizide

Product: Imazalil

Identifier : DBSNPE001727
Drug : DB01067 (Glipizide)
Interacting Gene/Enzyme : Glucose-6-phosphate 1-dehydrogenase
Gene Name : G6PD
UniProt ID : P11413
Defining Change(s) :

  • 274C->T

Allele Name : Guangzhou
Genotype(s) : Not Available
Type(s) : ADR Inferred
Groups : G6PD deficiency
Description : Increased risk of hemolytic anemia.
References :

  1. Eichelbaum M, Evert B: Influence of pharmacogenetics on drug disposition and response. Clin Exp Pharmacol Physiol. 1996 Oct-Nov;23(10-11):983-5. [PubMed:8911746 ]
  2. Glucodivol® (glipizide) tablets[package insert]. New York City, New York: Roerig, Division of Pfizer Inc; 2016. [Link]

PMID: 11724664

Glipizide

Glipizide

Product: Sulbentine

Identifier : DBSNPE001728
Drug : DB01067 (Glipizide)
Interacting Gene/Enzyme : Glucose-6-phosphate 1-dehydrogenase
Gene Name : G6PD
UniProt ID : P11413
Defining Change(s) :

  • 323T->A

Allele Name : Hammersmith
Genotype(s) : Not Available
Type(s) : ADR Inferred
Groups : G6PD deficiency
Description : Increased risk of hemolytic anemia.
References :

  1. Eichelbaum M, Evert B: Influence of pharmacogenetics on drug disposition and response. Clin Exp Pharmacol Physiol. 1996 Oct-Nov;23(10-11):983-5. [PubMed:8911746 ]
  2. Glucodivol® (glipizide) tablets[package insert]. New York City, New York: Roerig, Division of Pfizer Inc; 2016. [Link]

PMID: 28042452

Glipizide

Glipizide

Product: Clidinium (bromide)

Identifier : DBSNPE001729
Drug : DB01067 (Glipizide)
Interacting Gene/Enzyme : Glucose-6-phosphate 1-dehydrogenase
Gene Name : G6PD
UniProt ID : P11413
Defining Change(s) :

  • 34G->T

Allele Name : Sinnai
Genotype(s) : Not Available
Type(s) : ADR Inferred
Groups : G6PD deficiency
Description : Increased risk of hemolytic anemia.
References :

  1. Eichelbaum M, Evert B: Influence of pharmacogenetics on drug disposition and response. Clin Exp Pharmacol Physiol. 1996 Oct-Nov;23(10-11):983-5. [PubMed:8911746 ]
  2. Glucodivol® (glipizide) tablets[package insert]. New York City, New York: Roerig, Division of Pfizer Inc; 2016. [Link]

PMID: 19001437

Glipizide

Glipizide

Product: Taurocholic Acid (sodium hydrate)

Identifier : DBSNPE001731
Drug : DB01067 (Glipizide)
Interacting Gene/Enzyme : Glucose-6-phosphate 1-dehydrogenase
Gene Name : G6PD
UniProt ID : P11413
Defining Change(s) :

  • 376A->G
  • 968T->C

Allele Name : A- (968), Betica,Selma, Guantanamo
Genotype(s) : Not Available
Type(s) : ADR Inferred
Groups : G6PD deficiency
Description : Increased risk of hemolytic anemia.
References :

  1. Eichelbaum M, Evert B: Influence of pharmacogenetics on drug disposition and response. Clin Exp Pharmacol Physiol. 1996 Oct-Nov;23(10-11):983-5. [PubMed:8911746 ]
  2. Glucodivol® (glipizide) tablets[package insert]. New York City, New York: Roerig, Division of Pfizer Inc; 2016. [Link]

PMID: 16489043

Glipizide

Glipizide

Product: Cefamandole

Identifier : DBSNPE001732
Drug : DB01067 (Glipizide)
Interacting Gene/Enzyme : Glucose-6-phosphate 1-dehydrogenase
Gene Name : G6PD
UniProt ID : P11413
Defining Change(s) :

  • 383T>G

Allele Name : Salerno Pyrgos
Genotype(s) : Not Available
Type(s) : ADR Inferred
Groups : G6PD deficiency
Description : Increased risk of hemolytic anemia.
References :

  1. Eichelbaum M, Evert B: Influence of pharmacogenetics on drug disposition and response. Clin Exp Pharmacol Physiol. 1996 Oct-Nov;23(10-11):983-5. [PubMed:8911746 ]
  2. Glucodivol® (glipizide) tablets[package insert]. New York City, New York: Roerig, Division of Pfizer Inc; 2016. [Link]

PMID: 26542550

Glipizide

Glipizide

Product: Orphenadrine (hydrochloride)

Identifier : DBSNPE001733
Drug : DB01067 (Glipizide)
Interacting Gene/Enzyme : Glucose-6-phosphate 1-dehydrogenase
Gene Name : G6PD
UniProt ID : P11413
Defining Change(s) :

  • 392G->T

Allele Name : Quing Yan
Genotype(s) : Not Available
Type(s) : ADR Inferred
Groups : G6PD deficiency
Description : Increased risk of hemolytic anemia.
References :

  1. Eichelbaum M, Evert B: Influence of pharmacogenetics on drug disposition and response. Clin Exp Pharmacol Physiol. 1996 Oct-Nov;23(10-11):983-5. [PubMed:8911746 ]
  2. Glucodivol® (glipizide) tablets[package insert]. New York City, New York: Roerig, Division of Pfizer Inc; 2016. [Link]

PMID: 26541605

Glipizide

Glipizide

Product: Glucosamine

Identifier : DBSNPE001734
Drug : DB01067 (Glipizide)
Interacting Gene/Enzyme : Glucose-6-phosphate 1-dehydrogenase
Gene Name : G6PD
UniProt ID : P11413
Defining Change(s) :

  • 40G->A

Allele Name : Lages
Genotype(s) : Not Available
Type(s) : ADR Inferred
Groups : G6PD deficiency
Description : Increased risk of hemolytic anemia.
References :

  1. Eichelbaum M, Evert B: Influence of pharmacogenetics on drug disposition and response. Clin Exp Pharmacol Physiol. 1996 Oct-Nov;23(10-11):983-5. [PubMed:8911746 ]
  2. Glucodivol® (glipizide) tablets[package insert]. New York City, New York: Roerig, Division of Pfizer Inc; 2016. [Link]

PMID: 2901691

Glipizide

Glipizide

Product: Fipexide

Identifier : DBSNPE001735
Drug : DB01067 (Glipizide)
Interacting Gene/Enzyme : Glucose-6-phosphate 1-dehydrogenase
Gene Name : G6PD
UniProt ID : P11413
Defining Change(s) :

  • 466G->A

Allele Name : Ilesha
Genotype(s) : Not Available
Type(s) : ADR Inferred
Groups : G6PD deficiency
Description : Increased risk of hemolytic anemia.
References :

  1. Eichelbaum M, Evert B: Influence of pharmacogenetics on drug disposition and response. Clin Exp Pharmacol Physiol. 1996 Oct-Nov;23(10-11):983-5. [PubMed:8911746 ]
  2. Glucodivol® (glipizide) tablets[package insert]. New York City, New York: Roerig, Division of Pfizer Inc; 2016. [Link]

PMID: 2543272

Glipizide

Glipizide

Product: Auranofin

Identifier : DBSNPE001736
Drug : DB01067 (Glipizide)
Interacting Gene/Enzyme : Glucose-6-phosphate 1-dehydrogenase
Gene Name : G6PD
UniProt ID : P11413
Defining Change(s) :

  • 487G->A

Allele Name : Mahidol
Genotype(s) : Not Available
Type(s) : ADR Inferred
Groups : G6PD deficiency
Description : Increased risk of hemolytic anemia.
References :

  1. Eichelbaum M, Evert B: Influence of pharmacogenetics on drug disposition and response. Clin Exp Pharmacol Physiol. 1996 Oct-Nov;23(10-11):983-5. [PubMed:8911746 ]
  2. Glucodivol® (glipizide) tablets[package insert]. New York City, New York: Roerig, Division of Pfizer Inc; 2016. [Link]

PMID: 6112965

Glipizide

Glipizide

Product: Gluconate (sodium)

Identifier : DBSNPE001737
Drug : DB01067 (Glipizide)
Interacting Gene/Enzyme : Glucose-6-phosphate 1-dehydrogenase
Gene Name : G6PD
UniProt ID : P11413
Defining Change(s) :

  • 542A->T

Allele Name : Malaga
Genotype(s) : Not Available
Type(s) : ADR Inferred
Groups : G6PD deficiency
Description : Increased risk of hemolytic anemia.
References :

  1. Eichelbaum M, Evert B: Influence of pharmacogenetics on drug disposition and response. Clin Exp Pharmacol Physiol. 1996 Oct-Nov;23(10-11):983-5. [PubMed:8911746 ]
  2. Glucodivol® (glipizide) tablets[package insert]. New York City, New York: Roerig, Division of Pfizer Inc; 2016. [Link]

PMID: 23129762

Glipizide

Glipizide

Product: Ciclopirox (olamine)

Identifier : DBSNPE001738
Drug : DB01067 (Glipizide)
Interacting Gene/Enzyme : Glucose-6-phosphate 1-dehydrogenase
Gene Name : G6PD
UniProt ID : P11413
Defining Change(s) :

  • 634A->G

Allele Name : Sibari
Genotype(s) : Not Available
Type(s) : ADR Inferred
Groups : G6PD deficiency
Description : Increased risk of hemolytic anemia.
References :

  1. Eichelbaum M, Evert B: Influence of pharmacogenetics on drug disposition and response. Clin Exp Pharmacol Physiol. 1996 Oct-Nov;23(10-11):983-5. [PubMed:8911746 ]
  2. Glucodivol® (glipizide) tablets[package insert]. New York City, New York: Roerig, Division of Pfizer Inc; 2016. [Link]

PMID: 21850438

Glipizide

Glipizide

Product: DL-Carnitine

Identifier : DBSNPE001739
Drug : DB01067 (Glipizide)
Interacting Gene/Enzyme : Glucose-6-phosphate 1-dehydrogenase
Gene Name : G6PD
UniProt ID : P11413
Defining Change(s) :

  • 680G->A

Allele Name : Mexico City
Genotype(s) : Not Available
Type(s) : ADR Inferred
Groups : G6PD deficiency
Description : Increased risk of hemolytic anemia.
References :

  1. Eichelbaum M, Evert B: Influence of pharmacogenetics on drug disposition and response. Clin Exp Pharmacol Physiol. 1996 Oct-Nov;23(10-11):983-5. [PubMed:8911746 ]
  2. Glucodivol® (glipizide) tablets[package insert]. New York City, New York: Roerig, Division of Pfizer Inc; 2016. [Link]

PMID: 21289196

Glipizide

Glipizide

Product: Teicoplanin

Identifier : DBSNPE001740
Drug : DB01067 (Glipizide)
Interacting Gene/Enzyme : Glucose-6-phosphate 1-dehydrogenase
Gene Name : G6PD
UniProt ID : P11413
Defining Change(s) :

  • 703C->T

Allele Name : Nanning
Genotype(s) : Not Available
Type(s) : ADR Inferred
Groups : G6PD deficiency
Description : Increased risk of hemolytic anemia.
References :

  1. Eichelbaum M, Evert B: Influence of pharmacogenetics on drug disposition and response. Clin Exp Pharmacol Physiol. 1996 Oct-Nov;23(10-11):983-5. [PubMed:8911746 ]
  2. Glucodivol® (glipizide) tablets[package insert]. New York City, New York: Roerig, Division of Pfizer Inc; 2016. [Link]

PMID: 16608916

Glipizide

Glipizide

Product: Terutroban

Identifier : DBSNPE001741
Drug : DB01067 (Glipizide)
Interacting Gene/Enzyme : Glucose-6-phosphate 1-dehydrogenase
Gene Name : G6PD
UniProt ID : P11413
Defining Change(s) :

  • 844G->C

Allele Name : Seattle, Lodi, Modena, Ferrara II, Athens-like
Genotype(s) : Not Available
Type(s) : ADR Inferred
Groups : G6PD deficiency
Description : Increased risk of hemolytic anemia.
References :

  1. Eichelbaum M, Evert B: Influence of pharmacogenetics on drug disposition and response. Clin Exp Pharmacol Physiol. 1996 Oct-Nov;23(10-11):983-5. [PubMed:8911746 ]
  2. Glucodivol® (glipizide) tablets[package insert]. New York City, New York: Roerig, Division of Pfizer Inc; 2016. [Link]

PMID: 316343

Glipizide

Glipizide

Product: GDC-0339

Identifier : DBSNPE001742
Drug : DB01067 (Glipizide)
Interacting Gene/Enzyme : Glucose-6-phosphate 1-dehydrogenase
Gene Name : G6PD
UniProt ID : P11413
Defining Change(s) :

  • 844G->T

Allele Name : Bajo Maumere
Genotype(s) : Not Available
Type(s) : ADR Inferred
Groups : G6PD deficiency
Description : Increased risk of hemolytic anemia.
References :

  1. Eichelbaum M, Evert B: Influence of pharmacogenetics on drug disposition and response. Clin Exp Pharmacol Physiol. 1996 Oct-Nov;23(10-11):983-5. [PubMed:8911746 ]
  2. Glucodivol® (glipizide) tablets[package insert]. New York City, New York: Roerig, Division of Pfizer Inc; 2016. [Link]

PMID: 15964274

Glipizide

Glipizide

Product: ARV-825

Identifier : DBSNPE001743
Drug : DB01067 (Glipizide)
Interacting Gene/Enzyme : Glucose-6-phosphate 1-dehydrogenase
Gene Name : G6PD
UniProt ID : P11413
Defining Change(s) :

  • 854G->A

Allele Name : Montalbano
Genotype(s) : Not Available
Type(s) : ADR Inferred
Groups : G6PD deficiency
Description : Increased risk of hemolytic anemia.
References :

  1. Eichelbaum M, Evert B: Influence of pharmacogenetics on drug disposition and response. Clin Exp Pharmacol Physiol. 1996 Oct-Nov;23(10-11):983-5. [PubMed:8911746 ]
  2. Glucodivol® (glipizide) tablets[package insert]. New York City, New York: Roerig, Division of Pfizer Inc; 2016. [Link]

PMID: 27523302

Glipizide

Glipizide

Product: ELN-441958

Identifier : DBSNPE001744
Drug : DB01067 (Glipizide)
Interacting Gene/Enzyme : Glucose-6-phosphate 1-dehydrogenase
Gene Name : G6PD
UniProt ID : P11413
Defining Change(s) :

  • 949G->A

Allele Name : Kalyan-Kerala, Jamnaga, Rohini
Genotype(s) : Not Available
Type(s) : ADR Inferred
Groups : G6PD deficiency
Description : Increased risk of hemolytic anemia.
References :

  1. Eichelbaum M, Evert B: Influence of pharmacogenetics on drug disposition and response. Clin Exp Pharmacol Physiol. 1996 Oct-Nov;23(10-11):983-5. [PubMed:8911746 ]
  2. Glucodivol® (glipizide) tablets[package insert]. New York City, New York: Roerig, Division of Pfizer Inc; 2016. [Link]

PMID: 11311902

Glipizide

Glipizide

Product: Cediranib (maleate)

Identifier : DBSNPE001745
Drug : DB01067 (Glipizide)
Interacting Gene/Enzyme : Glucose-6-phosphate 1-dehydrogenase
Gene Name : G6PD
UniProt ID : P11413
Defining Change(s) :

  • 95A->G

Allele Name : Gaohe
Genotype(s) : Not Available
Type(s) : ADR Inferred
Groups : G6PD deficiency
Description : Increased risk of hemolytic anemia.
References :

  1. Eichelbaum M, Evert B: Influence of pharmacogenetics on drug disposition and response. Clin Exp Pharmacol Physiol. 1996 Oct-Nov;23(10-11):983-5. [PubMed:8911746 ]
  2. Glucodivol® (glipizide) tablets[package insert]. New York City, New York: Roerig, Division of Pfizer Inc; 2016. [Link]

PMID: 9455991

Glipizide

Glipizide

Product: HIV-1 integrase inhibitor 2

Identifier : DBSNPE005719
Drug : DB01067 (Glipizide)
Interacting Gene/Enzyme : Cytochrome P450 2C9
Gene Name : CYP2C9
UniProt ID : P11712
Defining Change(s) :

  • 818delA (rs9332131 )

Allele Name : CYP2C9*6
Genotype(s) : Not Available
Type(s) : Effect Inferred
Groups : Non-functional CYP2C9
Description : Poor drug metabolizer, lower dose requirements
References :

  1. Kidd RS, Curry TB, Gallagher S, Edeki T, Blaisdell J, Goldstein JA: Identification of a null allele of CYP2C9 in an African-American exhibiting toxicity to phenytoin. Pharmacogenetics. 2001 Dec;11(9):803-8. [PubMed:11740344 ]
  2. Allabi AC, Gala JL, Horsmans Y: CYP2C9, CYP2C19, ABCB1 (MDR1) genetic polymorphisms and phenytoin metabolism in a Black Beninese population. Pharmacogenet Genomics. 2005 Nov;15(11):779-86. [PubMed:16220110 ]
  3. The Human Cytochrome P450 (CYP) Allele Nomenclature Database [Link]

PMID: 17251021

Glipizide

Glipizide

Product: PF-03814735

Identifier : DBSNPE005720
Drug : DB01067 (Glipizide)
Interacting Gene/Enzyme : Cytochrome P450 2C9
Gene Name : CYP2C9
UniProt ID : P11712
Defining Change(s) :

  • 485C>A (rs72558190 )

Allele Name : CYP2C9*15
Genotype(s) : Not Available
Type(s) : Effect Inferred
Groups : Non-functional CYP2C9
Description : Poor drug metabolizer, lower dose requirements
References :

  1. Zhao F, Loke C, Rankin SC, Guo JY, Lee HS, Wu TS, Tan T, Liu TC, Lu WL, Lim YT, Zhang Q, Goh BC, Lee SC: Novel CYP2C9 genetic variants in Asian subjects and their influence on maintenance warfarin dose. Clin Pharmacol Ther. 2004 Sep;76(3):210-9. [PubMed:15371982 ]
  2. DeLozier TC, Lee SC, Coulter SJ, Goh BC, Goldstein JA: Functional characterization of novel allelic variants of CYP2C9 recently discovered in southeast Asians. J Pharmacol Exp Ther. 2005 Dec;315(3):1085-90. Epub 2005 Aug 11. [PubMed:16099926 ]
  3. The Human Cytochrome P450 (CYP) Allele Nomenclature Database [Link]

PMID: 19072652

Glipizide

Glipizide

Product: PDK1 inhibitor

Identifier : DBSNPE005721
Drug : DB01067 (Glipizide)
Interacting Gene/Enzyme : Cytochrome P450 2C9
Gene Name : CYP2C9
UniProt ID : P11712
Defining Change(s) :

  • 353_362delAGAAATGGAA (rs72558188 )

Allele Name : CYP2C9*25
Genotype(s) : Not Available
Type(s) : Effect Inferred
Groups : Non-functional CYP2C9
Description : Poor drug metabolizer, lower dose requirements
References :

  1. Maekawa K, Fukushima-Uesaka H, Tohkin M, Hasegawa R, Kajio H, Kuzuya N, Yasuda K, Kawamoto M, Kamatani N, Suzuki K, Yanagawa T, Saito Y, Sawada J: Four novel defective alleles and comprehensive haplotype analysis of CYP2C9 in Japanese. Pharmacogenet Genomics. 2006 Jul;16(7):497-514. [PubMed:16788382 ]
  2. The Human Cytochrome P450 (CYP) Allele Nomenclature Database [Link]

PMID: 3003155

Glipizide

Glipizide

Product: Quetiapine (fumarate)

Identifier : DBSNPE005722
Drug : DB01067 (Glipizide)
Interacting Gene/Enzyme : Cytochrome P450 2C9
Gene Name : CYP2C9
UniProt ID : P11712
Defining Change(s) :

  • 374G>T
  • 430C>T

Allele Name : CYP2C9*35
Genotype(s) : Not Available
Type(s) : Effect Inferred
Groups : Non-functional CYP2C9
Description : Poor drug metabolizer, lower dose requirements
References :

  1. Ciccacci C, Falconi M, Paolillo N, Oteri F, Forte V, Novelli G, Desideri A, Borgiani P: Characterization of a novel CYP2C9 gene mutation and sdivuctural bioinformatic protein analysis in a warfarin hypersensitive patient. Pharmacogenet Genomics. 2011 Jun;21(6):344-6. doi: 10.1097/FPC.0b013e328344c340. [PubMed:21451434 ]
  2. Lee MY, Borgiani P, Johansson I, Oteri F, Mkrtchian S, Falconi M, Ingelman-Sundberg M: High warfarin sensitivity in carriers of CYP2C9*35 is determined by the impaired interaction with P450 oxidoreductase. Pharmacogenomics J. 2014 Aug;14(4):343-9. doi: 10.1038/tpj.2013.41. Epub 2013 Dec 10. [PubMed:24322786 ]
  3. The Human Cytochrome P450 (CYP) Allele Nomenclature Database [Link]

PMID: 12702731

Glipizide

Glipizide

Product: Rimonabant (Hydrochloride)

Identifier : DBSNPE005723
Drug : DB01067 (Glipizide)
Interacting Gene/Enzyme : Cytochrome P450 2C9
Gene Name : CYP2C9
UniProt ID : P11712
Defining Change(s) :

  • 430C>T (rs1799853 )

Allele Name : CYP2C9*2
Genotype(s) : Not Available
Type(s) : Effect Inferred
Groups : Decreased CYP2C9
Description : Poor drug metabolizer, lower dose requirements
References :

  1. Rettie AE, Wienkers LC, Gonzalez FJ, Trager WF, Korzekwa KR: Impaired (S)-warfarin metabolism catalysed by the R144C allelic variant of CYP2C9. Pharmacogenetics. 1994 Feb;4(1):39-42. [PubMed:8004131 ]
  2. Crespi CL, Miller VP: The R144C change in the CYP2C9*2 allele alters interaction of the cytochrome P450 with NADPH:cytochrome P450 oxidoreductase. Pharmacogenetics. 1997 Jun;7(3):203-10. [PubMed:9241660 ]
  3. Takahashi H, Ieiri I, Wilkinson GR, Mayo G, Kashima T, Kimura S, Otsubo K, Echizen H: 5-Flanking region polymorphisms of CYP2C9 and their relationship to S-warfarin metabolism in white and Japanese patients. Blood. 2004 Apr 15;103(8):3055-7. Epub 2003 Dec 30. [PubMed:15070684 ]
  4. Sandberg M, Johansson I, Christensen M, Rane A, Eliasson E: The impact of CYP2C9 genetics and oral condivaceptives on cytochrome P450 2C9 phenotype. Drug Metab Dispos. 2004 May;32(5):484-9. [PubMed:15100169 ]
  5. King BP, Khan TI, Aithal GP, Kamali F, Daly AK: Upsdiveam and coding region CYP2C9 polymorphisms: correlation with warfarin dose and metabolism. Pharmacogenetics. 2004 Dec;14(12):813-22. [PubMed:15608560 ]
  6. The Human Cytochrome P450 (CYP) Allele Nomenclature Database [Link]

PMID: 10734112

Glipizide

Glipizide

Product: CCT 137690

Identifier : DBSNPE005724
Drug : DB01067 (Glipizide)
Interacting Gene/Enzyme : Cytochrome P450 2C9
Gene Name : CYP2C9
UniProt ID : P11712
Defining Change(s) :

  • 1075A>C (rs1057910 )

Allele Name : CYP2C9*3
Genotype(s) : Not Available
Type(s) : Effect Inferred
Groups : Decreased CYP2C9
Description : Poor drug metabolizer, lower dose requirements
References :

  1. Sullivan-Klose TH, Ghanayem BI, Bell DA, Zhang ZY, Kaminsky LS, Shenfield GM, Miners JO, Birkett DJ, Goldstein JA: The role of the CYP2C9-Leu359 allelic variant in the tolbutamide polymorphism. Pharmacogenetics. 1996 Aug;6(4):341-9. [PubMed:8873220 ]
  2. Haining RL, Hunter AP, Veronese ME, Trager WF, Rettie AE: Allelic variants of human cytochrome P450 2C9: baculovirus-mediated expression, purification, sdivuctural characterization, subsdivate stereoselectivity, and prochiral selectivity of the wild-type and I359L mutant forms. Arch Biochem Biophys. 1996 Sep 15;333(2):447-58. [PubMed:8809086 ]
  3. Aithal GP, Day CP, Kesteven PJ, Daly AK: Association of polymorphisms in the cytochrome P450 CYP2C9 with warfarin dose requirement and risk of bleeding complications. Lancet. 1999 Feb 27;353(9154):717-9. [PubMed:10073515 ]
  4. Kidd RS, Sdivaughn AB, Meyer MC, Blaisdell J, Goldstein JA, Dalton JT: Pharmacokinetics of chlorpheniramine, phenytoin, glipizide and nifedipine in an individual homozygous for the CYP2C9*3 allele. Pharmacogenetics. 1999 Feb;9(1):71-80. [PubMed:10208645 ]
  5. Takanashi K, Tainaka H, Kobayashi K, Yasumori T, Hosakawa M, Chiba K: CYP2C9 Ile359 and Leu359 variants: enzyme kinetic study with seven subsdivates. Pharmacogenetics. 2000 Mar;10(2):95-104. [PubMed:10761997 ]
  6. Shintani M, Ieiri I, Inoue K, Mamiya K, Ninomiya H, Tashiro N, Higuchi S, Otsubo K: Genetic polymorphisms and functional characterization of the 5-flanking region of the human CYP2C9 gene: in vidivo and in vivo studies. Clin Pharmacol Ther. 2001 Aug;70(2):175-82. [PubMed:11503012 ]
  7. King BP, Khan TI, Aithal GP, Kamali F, Daly AK: Upsdiveam and coding region CYP2C9 polymorphisms: correlation with warfarin dose and metabolism. Pharmacogenetics. 2004 Dec;14(12):813-22. [PubMed:15608560 ]
  8. The Human Cytochrome P450 (CYP) Allele Nomenclature Database [Link]

PMID: 9677417

Glipizide

Glipizide

Product: Paricalcitol

Identifier : DBSNPE005725
Drug : DB01067 (Glipizide)
Interacting Gene/Enzyme : Cytochrome P450 2C9
Gene Name : CYP2C9
UniProt ID : P11712
Defining Change(s) :

  • 1076T>C (rs56165452 )

Allele Name : CYP2C9*4
Genotype(s) : Not Available
Type(s) : Effect Inferred
Groups : Decreased CYP2C9
Description : Poor drug metabolizer, lower dose requirements
References :

  1. Van Booven D, Marsh S, McLeod H, Carrillo MW, Sangkuhl K, Klein TE, Altman RB: Cytochrome P450 2C9-CYP2C9. Pharmacogenet Genomics. 2010 Apr;20(4):277-81. doi: 10.1097/FPC.0b013e3283349e84. [PubMed:20150829 ]
  2. The Human Cytochrome P450 (CYP) Allele Nomenclature Database [Link]

PMID: 2244923

Glipizide

Glipizide

Product: IRAK-1-4 Inhibitor I

Identifier : DBSNPE005726
Drug : DB01067 (Glipizide)
Interacting Gene/Enzyme : Cytochrome P450 2C9
Gene Name : CYP2C9
UniProt ID : P11712
Defining Change(s) :

  • 1080C>G (rs28371686 )

Allele Name : CYP2C9*5
Genotype(s) : Not Available
Type(s) : Effect Inferred
Groups : Decreased CYP2C9
Description : Poor drug metabolizer, lower dose requirements
References :

  1. Dickmann LJ, Rettie AE, Kneller MB, Kim RB, Wood AJ, Stein CM, Wilkinson GR, Schwarz UI: Identification and functional characterization of a new CYP2C9 variant (CYP2C9*5) expressed among African Americans. Mol Pharmacol. 2001 Aug;60(2):382-7. [PubMed:11455026 ]
  2. Allabi AC, Gala JL, Horsmans Y, Babaoglu MO, Bozkurt A, Heusterspreute M, Yasar U: Functional impact of CYP2C95, CYP2C96, CYP2C98, and CYP2C911 in vivo among black Africans. Clin Pharmacol Ther. 2004 Aug;76(2):113-8. [PubMed:15289788 ]
  3. Allabi AC, Gala JL, Horsmans Y: CYP2C9, CYP2C19, ABCB1 (MDR1) genetic polymorphisms and phenytoin metabolism in a Black Beninese population. Pharmacogenet Genomics. 2005 Nov;15(11):779-86. [PubMed:16220110 ]
  4. The Human Cytochrome P450 (CYP) Allele Nomenclature Database [Link]

PMID: 24368897

Glipizide

Glipizide

Product: QL-IX-55

Identifier : DBSNPE005727
Drug : DB01067 (Glipizide)
Interacting Gene/Enzyme : Cytochrome P450 2C9
Gene Name : CYP2C9
UniProt ID : P11712
Defining Change(s) :

  • 449G>A (rs7900194 )

Allele Name : CYP2C9*8
Genotype(s) : Not Available
Type(s) : Effect Inferred
Groups : Decreased CYP2C9
Description : Poor drug metabolizer, lower dose requirements
References :

  1. Blaisdell J, Jorge-Nebert LF, Coulter S, Ferguson SS, Lee SJ, Chanas B, Xi T, Mohrenweiser H, Ghanayem B, Goldstein JA: Discovery of new potentially defective alleles of human CYP2C9. Pharmacogenetics. 2004 Aug;14(8):527-37. [PubMed:15284535 ]
  2. Allabi AC, Gala JL, Horsmans Y: CYP2C9, CYP2C19, ABCB1 (MDR1) genetic polymorphisms and phenytoin metabolism in a Black Beninese population. Pharmacogenet Genomics. 2005 Nov;15(11):779-86. [PubMed:16220110 ]
  3. Liu Y, Jeong H, Takahashi H, Drozda K, Patel SR, Shapiro NL, Nutescu EA, Cavallari LH: Decreased warfarin clearance associated with the CYP2C9 R150H (*8) polymorphism. Clin Pharmacol Ther. 2012 Apr;91(4):660-5. doi: 10.1038/clpt.2011.269. Epub 2012 Feb 29. [PubMed:22378156 ]
  4. The Human Cytochrome P450 (CYP) Allele Nomenclature Database [Link]

PMID: 22778820

Glipizide

Glipizide

Product: AIM-100

Identifier : DBSNPE005728
Drug : DB01067 (Glipizide)
Interacting Gene/Enzyme : Cytochrome P450 2C9
Gene Name : CYP2C9
UniProt ID : P11712
Defining Change(s) :

  • 1003C>T (rs28371685 )

Allele Name : CYP2C9*11
Genotype(s) : Not Available
Type(s) : Effect Inferred
Groups : Decreased CYP2C9
Description : Poor drug metabolizer, lower dose requirements
References :

  1. Higashi MK, Veensdiva DL, Kondo LM, Wittkowsky AK, Srinouanprachanh SL, Farin FM, Rettie AE: Association between CYP2C9 genetic variants and anticoagulation-related outcomes during warfarin therapy. JAMA. 2002 Apr 3;287(13):1690-8. [PubMed:11926893 ]
  2. Blaisdell J, Jorge-Nebert LF, Coulter S, Ferguson SS, Lee SJ, Chanas B, Xi T, Mohrenweiser H, Ghanayem B, Goldstein JA: Discovery of new potentially defective alleles of human CYP2C9. Pharmacogenetics. 2004 Aug;14(8):527-37. [PubMed:15284535 ]
  3. King BP, Khan TI, Aithal GP, Kamali F, Daly AK: Upsdiveam and coding region CYP2C9 polymorphisms: correlation with warfarin dose and metabolism. Pharmacogenetics. 2004 Dec;14(12):813-22. [PubMed:15608560 ]
  4. Allabi AC, Gala JL, Horsmans Y: CYP2C9, CYP2C19, ABCB1 (MDR1) genetic polymorphisms and phenytoin metabolism in a Black Beninese population. Pharmacogenet Genomics. 2005 Nov;15(11):779-86. [PubMed:16220110 ]
  5. The Human Cytochrome P450 (CYP) Allele Nomenclature Database [Link]

PMID: 19797427

Glipizide

Glipizide

Product: AZD2014

Identifier : DBSNPE005729
Drug : DB01067 (Glipizide)
Interacting Gene/Enzyme : Cytochrome P450 2C9
Gene Name : CYP2C9
UniProt ID : P11712
Defining Change(s) :

  • 1465C>T (rs9332239 )

Allele Name : CYP2C9*12
Genotype(s) : Not Available
Type(s) : Effect Inferred
Groups : Decreased CYP2C9
Description : Poor drug metabolizer, lower dose requirements
References :

  1. Blaisdell J, Jorge-Nebert LF, Coulter S, Ferguson SS, Lee SJ, Chanas B, Xi T, Mohrenweiser H, Ghanayem B, Goldstein JA: Discovery of new potentially defective alleles of human CYP2C9. Pharmacogenetics. 2004 Aug;14(8):527-37. [PubMed:15284535 ]
  2. The Human Cytochrome P450 (CYP) Allele Nomenclature Database [Link]

PMID: 19858408

Glipizide

Glipizide

Product: GDC-0349

Identifier : DBSNPE005730
Drug : DB01067 (Glipizide)
Interacting Gene/Enzyme : Cytochrome P450 2C9
Gene Name : CYP2C9
UniProt ID : P11712
Defining Change(s) :

  • 269T>C (rs72558187 )

Allele Name : CYP2C9*13
Genotype(s) : Not Available
Type(s) : Effect Inferred
Groups : Decreased CYP2C9
Description : Poor drug metabolizer, lower dose requirements
References :

  1. Si D, Guo Y, Zhang Y, Yang L, Zhou H, Zhong D: Identification of a novel variant CYP2C9 allele in Chinese. Pharmacogenetics. 2004 Jul;14(7):465-9. [PubMed:15226678 ]
  2. Guo Y, Zhang Y, Wang Y, Chen X, Si D, Zhong D, Fawcett JP, Zhou H: Role of CYP2C9 and its variants (CYP2C9*3 and CYP2C9*13) in the metabolism of lornoxicam in humans. Drug Metab Dispos. 2005 Jun;33(6):749-53. Epub 2005 Mar 11. [PubMed:15764711 ]
  3. Guo Y, Wang Y, Si D, Fawcett PJ, Zhong D, Zhou H: Catalytic activities of human cytochrome P450 2C9*1, 2C9*3 and 2C9*13. Xenobiotica. 2005 Sep;35(9):853-61. [PubMed:16308280 ]
  4. The Human Cytochrome P450 (CYP) Allele Nomenclature Database [Link]

PMID: 18752301

Glipizide

Glipizide

Product: AT7519 (Hydrochloride)

Identifier : DBSNPE005732
Drug : DB01067 (Glipizide)
Interacting Gene/Enzyme : Cytochrome P450 2C9
Gene Name : CYP2C9
UniProt ID : P11712
Defining Change(s) :

  • 895A>G (rs72558192 )

Allele Name : CYP2C9*16
Genotype(s) : Not Available
Type(s) : Effect Inferred
Groups : Decreased CYP2C9
Description : Poor drug metabolizer, lower dose requirements
References :

  1. Zhao F, Loke C, Rankin SC, Guo JY, Lee HS, Wu TS, Tan T, Liu TC, Lu WL, Lim YT, Zhang Q, Goh BC, Lee SC: Novel CYP2C9 genetic variants in Asian subjects and their influence on maintenance warfarin dose. Clin Pharmacol Ther. 2004 Sep;76(3):210-9. [PubMed:15371982 ]
  2. DeLozier TC, Lee SC, Coulter SJ, Goh BC, Goldstein JA: Functional characterization of novel allelic variants of CYP2C9 recently discovered in southeast Asians. J Pharmacol Exp Ther. 2005 Dec;315(3):1085-90. Epub 2005 Aug 11. [PubMed:16099926 ]
  3. The Human Cytochrome P450 (CYP) Allele Nomenclature Database [Link]

PMID: 8135836

Glipizide

Glipizide

Product: WYE-687

Identifier : DBSNPE005733
Drug : DB01067 (Glipizide)
Interacting Gene/Enzyme : Cytochrome P450 2C9
Gene Name : CYP2C9
UniProt ID : P11712
Defining Change(s) :

  • 1075A>C
  • 1190A>C
  • 1425A>T

Allele Name : CYP2C9*18
Genotype(s) : Not Available
Type(s) : Effect Inferred
Groups : Decreased CYP2C9
Description : Poor drug metabolizer, lower dose requirements
References :

  1. Zhao F, Loke C, Rankin SC, Guo JY, Lee HS, Wu TS, Tan T, Liu TC, Lu WL, Lim YT, Zhang Q, Goh BC, Lee SC: Novel CYP2C9 genetic variants in Asian subjects and their influence on maintenance warfarin dose. Clin Pharmacol Ther. 2004 Sep;76(3):210-9. [PubMed:15371982 ]
  2. DeLozier TC, Lee SC, Coulter SJ, Goh BC, Goldstein JA: Functional characterization of novel allelic variants of CYP2C9 recently discovered in southeast Asians. J Pharmacol Exp Ther. 2005 Dec;315(3):1085-90. Epub 2005 Aug 11. [PubMed:16099926 ]
  3. The Human Cytochrome P450 (CYP) Allele Nomenclature Database [Link]

PMID: 8250895

Glipizide

Glipizide

Product: Ganetespib

Identifier : DBSNPE005734
Drug : DB01067 (Glipizide)
Interacting Gene/Enzyme : Cytochrome P450 2C9
Gene Name : CYP2C9
UniProt ID : P11712
Defining Change(s) :

  • 389C>G

Allele Name : CYP2C9*26
Genotype(s) : Not Available
Type(s) : Effect Inferred
Groups : Decreased CYP2C9
Description : Poor drug metabolizer, lower dose requirements
References :

  1. Maekawa K, Fukushima-Uesaka H, Tohkin M, Hasegawa R, Kajio H, Kuzuya N, Yasuda K, Kawamoto M, Kamatani N, Suzuki K, Yanagawa T, Saito Y, Sawada J: Four novel defective alleles and comprehensive haplotype analysis of CYP2C9 in Japanese. Pharmacogenet Genomics. 2006 Jul;16(7):497-514. [PubMed:16788382 ]
  2. The Human Cytochrome P450 (CYP) Allele Nomenclature Database [Link]

PMID: 16103100

Glipizide

Glipizide

Product: MK-5108

Identifier : DBSNPE005735
Drug : DB01067 (Glipizide)
Interacting Gene/Enzyme : Cytochrome P450 2C9
Gene Name : CYP2C9
UniProt ID : P11712
Defining Change(s) :

  • 641A>T

Allele Name : CYP2C9*28
Genotype(s) : Not Available
Type(s) : Effect Inferred
Groups : Decreased CYP2C9
Description : Poor drug metabolizer, lower dose requirements
References :

  1. Maekawa K, Fukushima-Uesaka H, Tohkin M, Hasegawa R, Kajio H, Kuzuya N, Yasuda K, Kawamoto M, Kamatani N, Suzuki K, Yanagawa T, Saito Y, Sawada J: Four novel defective alleles and comprehensive haplotype analysis of CYP2C9 in Japanese. Pharmacogenet Genomics. 2006 Jul;16(7):497-514. [PubMed:16788382 ]
  2. The Human Cytochrome P450 (CYP) Allele Nomenclature Database [Link]

PMID: 11848470

Glipizide

Glipizide

Product: GSK1838705A

Identifier : DBSNPE005736
Drug : DB01067 (Glipizide)
Interacting Gene/Enzyme : Cytochrome P450 2C9
Gene Name : CYP2C9
UniProt ID : P11712
Defining Change(s) :

  • 1429G>A

Allele Name : CYP2C9*30
Genotype(s) : Not Available
Type(s) : Effect Inferred
Groups : Decreased CYP2C9
Description : Poor drug metabolizer, lower dose requirements
References :

  1. Maekawa K, Fukushima-Uesaka H, Tohkin M, Hasegawa R, Kajio H, Kuzuya N, Yasuda K, Kawamoto M, Kamatani N, Suzuki K, Yanagawa T, Saito Y, Sawada J: Four novel defective alleles and comprehensive haplotype analysis of CYP2C9 in Japanese. Pharmacogenet Genomics. 2006 Jul;16(7):497-514. [PubMed:16788382 ]
  2. The Human Cytochrome P450 (CYP) Allele Nomenclature Database [Link]

PMID: 19366805

Glipizide

Glipizide

Product: Apatinib

Identifier : DBSNPE005737
Drug : DB01067 (Glipizide)
Interacting Gene/Enzyme : Cytochrome P450 2C9
Gene Name : CYP2C9
UniProt ID : P11712
Defining Change(s) :

  • 395G>A (rs200183364 )

Allele Name : CYP2C9*33
Genotype(s) : Not Available
Type(s) : Effect Inferred
Groups : Decreased CYP2C9
Description : Poor drug metabolizer, lower dose requirements
References :

  1. Yin T, Maekawa K, Kamide K, Saito Y, Hanada H, Miyashita K, Kokubo Y, Akaiwa Y, Otsubo R, Nagatsuka K, Otsuki T, Horio T, Takiuchi S, Kawano Y, Minematsu K, Naritomi H, Tomoike H, Sawada J, Miyata T: Genetic variations of CYP2C9 in 724 Japanese individuals and their impact on the antihypertensive effects of losartan. Hypertens Res. 2008 Aug;31(8):1549-57. doi: 10.1291/hypres.31.1549. [PubMed:18971529 ]
  2. The Human Cytochrome P450 (CYP) Allele Nomenclature Database [Link]

PMID: 16956345

By