PI3KInhibitorpi3kinhibitor

Glimepiride

By

Glimepiride

Product: L-NAME (hydrochloride)

Identifier : DBSNPE001404
Drug : DB00222 (Glimepiride)
Interacting Gene/Enzyme : Glucose-6-phosphate 1-dehydrogenase
Gene Name : G6PD
UniProt ID : P11413
Defining Change(s) :

  • 1000_1002delACC

Allele Name : Villeurbanne
Genotype(s) : Not Available
Type(s) : ADR Inferred
Groups : G6PD deficiency
Description : Increased risk of hemolytic anemia.
References :

  1. Eichelbaum M, Evert B: Influence of pharmacogenetics on drug disposition and response. Clin Exp Pharmacol Physiol. 1996 Oct-Nov;23(10-11):983-5. [PubMed:8911746 ]
  2. Amaryl® (glimepiride) tablets[package insert]. Bridgewater, New Jersey: Sanofi-Aventis U.S. LLC; 2016. [Link]

PMID: 3315125

Glimepiride

By

Glimepiride

Product: Lipoic acid

Identifier : DBSNPE001405
Drug : DB00222 (Glimepiride)
Interacting Gene/Enzyme : Glucose-6-phosphate 1-dehydrogenase
Gene Name : G6PD
UniProt ID : P11413
Defining Change(s) :

  • 1006A->G

Allele Name : Torun
Genotype(s) : Not Available
Type(s) : ADR Inferred
Groups : G6PD deficiency
Description : Increased risk of hemolytic anemia.
References :

  1. Eichelbaum M, Evert B: Influence of pharmacogenetics on drug disposition and response. Clin Exp Pharmacol Physiol. 1996 Oct-Nov;23(10-11):983-5. [PubMed:8911746 ]
  2. Amaryl® (glimepiride) tablets[package insert]. Bridgewater, New Jersey: Sanofi-Aventis U.S. LLC; 2016. [Link]

PMID: 6089245

Glimepiride

By

Glimepiride

Product: Pyrrolidinedithiocarbamate (ammonium)

Identifier : DBSNPE001406
Drug : DB00222 (Glimepiride)
Interacting Gene/Enzyme : Glucose-6-phosphate 1-dehydrogenase
Gene Name : G6PD
UniProt ID : P11413
Defining Change(s) :

  • 105_107delCAT

Allele Name : Sunderland
Genotype(s) : Not Available
Type(s) : ADR Inferred
Groups : G6PD deficiency
Description : Increased risk of hemolytic anemia.
References :

  1. Eichelbaum M, Evert B: Influence of pharmacogenetics on drug disposition and response. Clin Exp Pharmacol Physiol. 1996 Oct-Nov;23(10-11):983-5. [PubMed:8911746 ]
  2. Amaryl® (glimepiride) tablets[package insert]. Bridgewater, New Jersey: Sanofi-Aventis U.S. LLC; 2016. [Link]

PMID: 2881979

Glimepiride

By

Glimepiride

Product: Nitroprusside (disodium dihydrate)

Identifier : DBSNPE001407
Drug : DB00222 (Glimepiride)
Interacting Gene/Enzyme : Glucose-6-phosphate 1-dehydrogenase
Gene Name : G6PD
UniProt ID : P11413
Defining Change(s) :

  • 1081G->A

Allele Name : Iwatsuki
Genotype(s) : Not Available
Type(s) : ADR Inferred
Groups : G6PD deficiency
Description : Increased risk of hemolytic anemia.
References :

  1. Eichelbaum M, Evert B: Influence of pharmacogenetics on drug disposition and response. Clin Exp Pharmacol Physiol. 1996 Oct-Nov;23(10-11):983-5. [PubMed:8911746 ]
  2. Amaryl® (glimepiride) tablets[package insert]. Bridgewater, New Jersey: Sanofi-Aventis U.S. LLC; 2016. [Link]

PMID: 6089247

Glimepiride

By

Glimepiride

Product: Wortmannin

Identifier : DBSNPE001408
Drug : DB00222 (Glimepiride)
Interacting Gene/Enzyme : Glucose-6-phosphate 1-dehydrogenase
Gene Name : G6PD
UniProt ID : P11413
Defining Change(s) :

  • 1082C->T

Allele Name : Serres
Genotype(s) : Not Available
Type(s) : ADR Inferred
Groups : G6PD deficiency
Description : Increased risk of hemolytic anemia.
References :

  1. Eichelbaum M, Evert B: Influence of pharmacogenetics on drug disposition and response. Clin Exp Pharmacol Physiol. 1996 Oct-Nov;23(10-11):983-5. [PubMed:8911746 ]
  2. Amaryl® (glimepiride) tablets[package insert]. Bridgewater, New Jersey: Sanofi-Aventis U.S. LLC; 2016. [Link]

PMID: 11090095

Glimepiride

By

Glimepiride

Product: Ozanimod

Identifier : DBSNPE001409
Drug : DB00222 (Glimepiride)
Interacting Gene/Enzyme : Glucose-6-phosphate 1-dehydrogenase
Gene Name : G6PD
UniProt ID : P11413
Defining Change(s) :

  • 1084_1101delCTGAACGAGCGCAAGGCC

Allele Name : Tondela
Genotype(s) : Not Available
Type(s) : ADR Inferred
Groups : G6PD deficiency
Description : Increased risk of hemolytic anemia.
References :

  1. Eichelbaum M, Evert B: Influence of pharmacogenetics on drug disposition and response. Clin Exp Pharmacol Physiol. 1996 Oct-Nov;23(10-11):983-5. [PubMed:8911746 ]
  2. Amaryl® (glimepiride) tablets[package insert]. Bridgewater, New Jersey: Sanofi-Aventis U.S. LLC; 2016. [Link]

PMID: 1403792

Glimepiride

By

Glimepiride

Product: KC7F2

Identifier : DBSNPE001410
Drug : DB00222 (Glimepiride)
Interacting Gene/Enzyme : Glucose-6-phosphate 1-dehydrogenase
Gene Name : G6PD
UniProt ID : P11413
Defining Change(s) :

  • 1089C->A

Allele Name : Loma Linda
Genotype(s) : Not Available
Type(s) : ADR Inferred
Groups : G6PD deficiency
Description : Increased risk of hemolytic anemia.
References :

  1. Eichelbaum M, Evert B: Influence of pharmacogenetics on drug disposition and response. Clin Exp Pharmacol Physiol. 1996 Oct-Nov;23(10-11):983-5. [PubMed:8911746 ]
  2. Amaryl® (glimepiride) tablets[package insert]. Bridgewater, New Jersey: Sanofi-Aventis U.S. LLC; 2016. [Link]

PMID: 2878820

Glimepiride

By

Glimepiride

Product: Azeliragon

Identifier : DBSNPE001411
Drug : DB00222 (Glimepiride)
Interacting Gene/Enzyme : Glucose-6-phosphate 1-dehydrogenase
Gene Name : G6PD
UniProt ID : P11413
Defining Change(s) :

  • 1089C->G

Allele Name : Aachen
Genotype(s) : Not Available
Type(s) : ADR Inferred
Groups : G6PD deficiency
Description : Increased risk of hemolytic anemia.
References :

  1. Eichelbaum M, Evert B: Influence of pharmacogenetics on drug disposition and response. Clin Exp Pharmacol Physiol. 1996 Oct-Nov;23(10-11):983-5. [PubMed:8911746 ]
  2. Amaryl® (glimepiride) tablets[package insert]. Bridgewater, New Jersey: Sanofi-Aventis U.S. LLC; 2016. [Link]

PMID: 2871178

Glimepiride

By

Glimepiride

Product: GDC-0994 (hydrochloride)

Identifier : DBSNPE001412
Drug : DB00222 (Glimepiride)
Interacting Gene/Enzyme : Glucose-6-phosphate 1-dehydrogenase
Gene Name : G6PD
UniProt ID : P11413
Defining Change(s) :

  • 1096A->G

Allele Name : Tenri
Genotype(s) : Not Available
Type(s) : ADR Inferred
Groups : G6PD deficiency
Description : Increased risk of hemolytic anemia.
References :

  1. Eichelbaum M, Evert B: Influence of pharmacogenetics on drug disposition and response. Clin Exp Pharmacol Physiol. 1996 Oct-Nov;23(10-11):983-5. [PubMed:8911746 ]
  2. Amaryl® (glimepiride) tablets[package insert]. Bridgewater, New Jersey: Sanofi-Aventis U.S. LLC; 2016. [Link]

PMID: 27402603

Glimepiride

By

Glimepiride

Product: Taltobulin (hydrochloride)

Identifier : DBSNPE001413
Drug : DB00222 (Glimepiride)
Interacting Gene/Enzyme : Glucose-6-phosphate 1-dehydrogenase
Gene Name : G6PD
UniProt ID : P11413
Defining Change(s) :

  • 1132G>A

Allele Name : Montpellier
Genotype(s) : Not Available
Type(s) : ADR Inferred
Groups : G6PD deficiency
Description : Increased risk of hemolytic anemia.
References :

  1. Eichelbaum M, Evert B: Influence of pharmacogenetics on drug disposition and response. Clin Exp Pharmacol Physiol. 1996 Oct-Nov;23(10-11):983-5. [PubMed:8911746 ]
  2. Amaryl® (glimepiride) tablets[package insert]. Bridgewater, New Jersey: Sanofi-Aventis U.S. LLC; 2016. [Link]

PMID: 21613595

Glimepiride

By

Glimepiride

Product: IDO-IN-5

Identifier : DBSNPE001414
Drug : DB00222 (Glimepiride)
Interacting Gene/Enzyme : Glucose-6-phosphate 1-dehydrogenase
Gene Name : G6PD
UniProt ID : P11413
Defining Change(s) :

  • 1138A->G

Allele Name : Calvo Mackenna
Genotype(s) : Not Available
Type(s) : ADR Inferred
Groups : G6PD deficiency
Description : Increased risk of hemolytic anemia.
References :

  1. Eichelbaum M, Evert B: Influence of pharmacogenetics on drug disposition and response. Clin Exp Pharmacol Physiol. 1996 Oct-Nov;23(10-11):983-5. [PubMed:8911746 ]
  2. Amaryl® (glimepiride) tablets[package insert]. Bridgewater, New Jersey: Sanofi-Aventis U.S. LLC; 2016. [Link]

PMID: 12415111

Glimepiride

By

Glimepiride

Product: IDO-IN-6

Identifier : DBSNPE001416
Drug : DB00222 (Glimepiride)
Interacting Gene/Enzyme : Glucose-6-phosphate 1-dehydrogenase
Gene Name : G6PD
UniProt ID : P11413
Defining Change(s) :

  • 1141T->C

Allele Name : Olomouc
Genotype(s) : Not Available
Type(s) : ADR Inferred
Groups : G6PD deficiency
Description : Increased risk of hemolytic anemia.
References :

  1. Eichelbaum M, Evert B: Influence of pharmacogenetics on drug disposition and response. Clin Exp Pharmacol Physiol. 1996 Oct-Nov;23(10-11):983-5. [PubMed:8911746 ]
  2. Amaryl® (glimepiride) tablets[package insert]. Bridgewater, New Jersey: Sanofi-Aventis U.S. LLC; 2016. [Link]

PMID: 8762113

Glimepiride

By

Glimepiride

Product: Navoximod

Identifier : DBSNPE001417
Drug : DB00222 (Glimepiride)
Interacting Gene/Enzyme : Glucose-6-phosphate 1-dehydrogenase
Gene Name : G6PD
UniProt ID : P11413
Defining Change(s) :

  • 1153T->C

Allele Name : Tomah
Genotype(s) : Not Available
Type(s) : ADR Inferred
Groups : G6PD deficiency
Description : Increased risk of hemolytic anemia.
References :

  1. Eichelbaum M, Evert B: Influence of pharmacogenetics on drug disposition and response. Clin Exp Pharmacol Physiol. 1996 Oct-Nov;23(10-11):983-5. [PubMed:8911746 ]
  2. Amaryl® (glimepiride) tablets[package insert]. Bridgewater, New Jersey: Sanofi-Aventis U.S. LLC; 2016. [Link]

PMID: 7901754

Glimepiride

By

Glimepiride

Product: IDO-IN-8

Identifier : DBSNPE001418
Drug : DB00222 (Glimepiride)
Interacting Gene/Enzyme : Glucose-6-phosphate 1-dehydrogenase
Gene Name : G6PD
UniProt ID : P11413
Defining Change(s) :

  • 1154G->T

Allele Name : Lynwood
Genotype(s) : Not Available
Type(s) : ADR Inferred
Groups : G6PD deficiency
Description : Increased risk of hemolytic anemia.
References :

  1. Eichelbaum M, Evert B: Influence of pharmacogenetics on drug disposition and response. Clin Exp Pharmacol Physiol. 1996 Oct-Nov;23(10-11):983-5. [PubMed:8911746 ]
  2. Amaryl® (glimepiride) tablets[package insert]. Bridgewater, New Jersey: Sanofi-Aventis U.S. LLC; 2016. [Link]

PMID: 2874974

Glimepiride

By

Glimepiride

Product: IDO-IN-4

Identifier : DBSNPE001420
Drug : DB00222 (Glimepiride)
Interacting Gene/Enzyme : Glucose-6-phosphate 1-dehydrogenase
Gene Name : G6PD
UniProt ID : P11413
Defining Change(s) :

  • 1156A->G

Allele Name : Iowa, Walter Reed, Springfield
Genotype(s) : Not Available
Type(s) : ADR Inferred
Groups : G6PD deficiency
Description : Increased risk of hemolytic anemia.
References :

  1. Eichelbaum M, Evert B: Influence of pharmacogenetics on drug disposition and response. Clin Exp Pharmacol Physiol. 1996 Oct-Nov;23(10-11):983-5. [PubMed:8911746 ]
  2. Amaryl® (glimepiride) tablets[package insert]. Bridgewater, New Jersey: Sanofi-Aventis U.S. LLC; 2016. [Link]

PMID: 20060846

Glimepiride

By

Glimepiride

Product: Pipobroman

Identifier : DBSNPE001421
Drug : DB00222 (Glimepiride)
Interacting Gene/Enzyme : Glucose-6-phosphate 1-dehydrogenase
Gene Name : G6PD
UniProt ID : P11413
Defining Change(s) :

  • 1160G->A

Allele Name : Beverly Hills, Genova, Iwate, Niigata, Yamaguchi
Genotype(s) : Not Available
Type(s) : ADR Inferred
Groups : G6PD deficiency
Description : Increased risk of hemolytic anemia.
References :

  1. Eichelbaum M, Evert B: Influence of pharmacogenetics on drug disposition and response. Clin Exp Pharmacol Physiol. 1996 Oct-Nov;23(10-11):983-5. [PubMed:8911746 ]
  2. Amaryl® (glimepiride) tablets[package insert]. Bridgewater, New Jersey: Sanofi-Aventis U.S. LLC; 2016. [Link]

PMID: 15959466

Glimepiride

By

Glimepiride

Product: Chlormethine (hydrochloride)

Identifier : DBSNPE001422
Drug : DB00222 (Glimepiride)
Interacting Gene/Enzyme : Glucose-6-phosphate 1-dehydrogenase
Gene Name : G6PD
UniProt ID : P11413
Defining Change(s) :

  • 1162A->G

Allele Name : Hartford
Genotype(s) : Not Available
Type(s) : ADR Inferred
Groups : G6PD deficiency
Description : Increased risk of hemolytic anemia.
References :

  1. Eichelbaum M, Evert B: Influence of pharmacogenetics on drug disposition and response. Clin Exp Pharmacol Physiol. 1996 Oct-Nov;23(10-11):983-5. [PubMed:8911746 ]
  2. Amaryl® (glimepiride) tablets[package insert]. Bridgewater, New Jersey: Sanofi-Aventis U.S. LLC; 2016. [Link]

PMID: 2160838

Glimepiride

By

Glimepiride

Product: NCT-501

Identifier : DBSNPE001423
Drug : DB00222 (Glimepiride)
Interacting Gene/Enzyme : Glucose-6-phosphate 1-dehydrogenase
Gene Name : G6PD
UniProt ID : P11413
Defining Change(s) :

  • 1166A->G

Allele Name : Praha
Genotype(s) : Not Available
Type(s) : ADR Inferred
Groups : G6PD deficiency
Description : Increased risk of hemolytic anemia.
References :

  1. Eichelbaum M, Evert B: Influence of pharmacogenetics on drug disposition and response. Clin Exp Pharmacol Physiol. 1996 Oct-Nov;23(10-11):983-5. [PubMed:8911746 ]
  2. Amaryl® (glimepiride) tablets[package insert]. Bridgewater, New Jersey: Sanofi-Aventis U.S. LLC; 2016. [Link]

PMID: 19228970

Glimepiride

By

Glimepiride

Product: Noscapine

Identifier : DBSNPE001424
Drug : DB00222 (Glimepiride)
Interacting Gene/Enzyme : Glucose-6-phosphate 1-dehydrogenase
Gene Name : G6PD
UniProt ID : P11413
Defining Change(s) :

  • 1175T>C

Allele Name : Krakow
Genotype(s) : Not Available
Type(s) : ADR Inferred
Groups : G6PD deficiency
Description : Increased risk of hemolytic anemia.
References :

  1. Eichelbaum M, Evert B: Influence of pharmacogenetics on drug disposition and response. Clin Exp Pharmacol Physiol. 1996 Oct-Nov;23(10-11):983-5. [PubMed:8911746 ]
  2. Amaryl® (glimepiride) tablets[package insert]. Bridgewater, New Jersey: Sanofi-Aventis U.S. LLC; 2016. [Link]

PMID: 17084864

Glimepiride

By

Glimepiride

Product: FLT3-IN-2

Identifier : DBSNPE001425
Drug : DB00222 (Glimepiride)
Interacting Gene/Enzyme : Glucose-6-phosphate 1-dehydrogenase
Gene Name : G6PD
UniProt ID : P11413
Defining Change(s) :

  • 1177C->G

Allele Name : Wisconsin
Genotype(s) : Not Available
Type(s) : ADR Inferred
Groups : G6PD deficiency
Description : Increased risk of hemolytic anemia.
References :

  1. Eichelbaum M, Evert B: Influence of pharmacogenetics on drug disposition and response. Clin Exp Pharmacol Physiol. 1996 Oct-Nov;23(10-11):983-5. [PubMed:8911746 ]
  2. Amaryl® (glimepiride) tablets[package insert]. Bridgewater, New Jersey: Sanofi-Aventis U.S. LLC; 2016. [Link]

PMID: 10082863

Glimepiride

By

Glimepiride

Product: Cobalt phthalocyanine

Identifier : DBSNPE001426
Drug : DB00222 (Glimepiride)
Interacting Gene/Enzyme : Glucose-6-phosphate 1-dehydrogenase
Gene Name : G6PD
UniProt ID : P11413
Defining Change(s) :

  • 1178G->A

Allele Name : Nashville, Anaheim, Portici
Genotype(s) : Not Available
Type(s) : ADR Inferred
Groups : G6PD deficiency
Description : Increased risk of hemolytic anemia.
References :

  1. Eichelbaum M, Evert B: Influence of pharmacogenetics on drug disposition and response. Clin Exp Pharmacol Physiol. 1996 Oct-Nov;23(10-11):983-5. [PubMed:8911746 ]
  2. Amaryl® (glimepiride) tablets[package insert]. Bridgewater, New Jersey: Sanofi-Aventis U.S. LLC; 2016. [Link]

PMID: 7599932

Glimepiride

By

Glimepiride

Product: BAY 11-7082

Identifier : DBSNPE001427
Drug : DB00222 (Glimepiride)
Interacting Gene/Enzyme : Glucose-6-phosphate 1-dehydrogenase
Gene Name : G6PD
UniProt ID : P11413
Defining Change(s) :

  • 1180G->C

Allele Name : Alhambra
Genotype(s) : Not Available
Type(s) : ADR Inferred
Groups : G6PD deficiency
Description : Increased risk of hemolytic anemia.
References :

  1. Eichelbaum M, Evert B: Influence of pharmacogenetics on drug disposition and response. Clin Exp Pharmacol Physiol. 1996 Oct-Nov;23(10-11):983-5. [PubMed:8911746 ]
  2. Amaryl® (glimepiride) tablets[package insert]. Bridgewater, New Jersey: Sanofi-Aventis U.S. LLC; 2016. [Link]

PMID: 7539115

Glimepiride

By

Glimepiride

Product: 5-Tamra-DRVYIHP

Identifier : DBSNPE001428
Drug : DB00222 (Glimepiride)
Interacting Gene/Enzyme : Glucose-6-phosphate 1-dehydrogenase
Gene Name : G6PD
UniProt ID : P11413
Defining Change(s) :

  • 1187C->T

Allele Name : Bari
Genotype(s) : Not Available
Type(s) : ADR Inferred
Groups : G6PD deficiency
Description : Increased risk of hemolytic anemia.
References :

  1. Eichelbaum M, Evert B: Influence of pharmacogenetics on drug disposition and response. Clin Exp Pharmacol Physiol. 1996 Oct-Nov;23(10-11):983-5. [PubMed:8911746 ]
  2. Amaryl® (glimepiride) tablets[package insert]. Bridgewater, New Jersey: Sanofi-Aventis U.S. LLC; 2016. [Link]

PMID: 18762200

Glimepiride

By

Glimepiride

Product: Corticosterone

Identifier : DBSNPE001429
Drug : DB00222 (Glimepiride)
Interacting Gene/Enzyme : Glucose-6-phosphate 1-dehydrogenase
Gene Name : G6PD
UniProt ID : P11413
Defining Change(s) :

  • 1192G->A

Allele Name : Puerto Limon
Genotype(s) : Not Available
Type(s) : ADR Inferred
Groups : G6PD deficiency
Description : Increased risk of hemolytic anemia.
References :

  1. Eichelbaum M, Evert B: Influence of pharmacogenetics on drug disposition and response. Clin Exp Pharmacol Physiol. 1996 Oct-Nov;23(10-11):983-5. [PubMed:8911746 ]
  2. Amaryl® (glimepiride) tablets[package insert]. Bridgewater, New Jersey: Sanofi-Aventis U.S. LLC; 2016. [Link]

PMID: 24072672

Glimepiride

By

Glimepiride

Product: Argireline

Identifier : DBSNPE001430
Drug : DB00222 (Glimepiride)
Interacting Gene/Enzyme : Glucose-6-phosphate 1-dehydrogenase
Gene Name : G6PD
UniProt ID : P11413
Defining Change(s) :

  • 1205C>A

Allele Name : Covao do Lobo
Genotype(s) : Not Available
Type(s) : ADR Inferred
Groups : G6PD deficiency
Description : Increased risk of hemolytic anemia.
References :

  1. Eichelbaum M, Evert B: Influence of pharmacogenetics on drug disposition and response. Clin Exp Pharmacol Physiol. 1996 Oct-Nov;23(10-11):983-5. [PubMed:8911746 ]
  2. Amaryl® (glimepiride) tablets[package insert]. Bridgewater, New Jersey: Sanofi-Aventis U.S. LLC; 2016. [Link]

PMID: 10049144

Glimepiride

By

Glimepiride

Product: Endoxifen (Z-isomer hydrochloride)

Identifier : DBSNPE001431
Drug : DB00222 (Glimepiride)
Interacting Gene/Enzyme : Glucose-6-phosphate 1-dehydrogenase
Gene Name : G6PD
UniProt ID : P11413
Defining Change(s) :

  • 1215G->A

Allele Name : Clinic
Genotype(s) : Not Available
Type(s) : ADR Inferred
Groups : G6PD deficiency
Description : Increased risk of hemolytic anemia.
References :

  1. Eichelbaum M, Evert B: Influence of pharmacogenetics on drug disposition and response. Clin Exp Pharmacol Physiol. 1996 Oct-Nov;23(10-11):983-5. [PubMed:8911746 ]
  2. Amaryl® (glimepiride) tablets[package insert]. Bridgewater, New Jersey: Sanofi-Aventis U.S. LLC; 2016. [Link]

PMID: 9380754

Glimepiride

By

Glimepiride

Product: Cortisone

Identifier : DBSNPE001432
Drug : DB00222 (Glimepiride)
Interacting Gene/Enzyme : Glucose-6-phosphate 1-dehydrogenase
Gene Name : G6PD
UniProt ID : P11413
Defining Change(s) :

  • 1225C->T

Allele Name : Udivecht
Genotype(s) : Not Available
Type(s) : ADR Inferred
Groups : G6PD deficiency
Description : Increased risk of hemolytic anemia.
References :

  1. Eichelbaum M, Evert B: Influence of pharmacogenetics on drug disposition and response. Clin Exp Pharmacol Physiol. 1996 Oct-Nov;23(10-11):983-5. [PubMed:8911746 ]
  2. Amaryl® (glimepiride) tablets[package insert]. Bridgewater, New Jersey: Sanofi-Aventis U.S. LLC; 2016. [Link]

PMID: 6359080

Glimepiride

By

Glimepiride

Product: GlyT2-IN-1

Identifier : DBSNPE001433
Drug : DB00222 (Glimepiride)
Interacting Gene/Enzyme : Glucose-6-phosphate 1-dehydrogenase
Gene Name : G6PD
UniProt ID : P11413
Defining Change(s) :

  • 1226C->G

Allele Name : Suwalki
Genotype(s) : Not Available
Type(s) : ADR Inferred
Groups : G6PD deficiency
Description : Increased risk of hemolytic anemia.
References :

  1. Eichelbaum M, Evert B: Influence of pharmacogenetics on drug disposition and response. Clin Exp Pharmacol Physiol. 1996 Oct-Nov;23(10-11):983-5. [PubMed:8911746 ]
  2. Amaryl® (glimepiride) tablets[package insert]. Bridgewater, New Jersey: Sanofi-Aventis U.S. LLC; 2016. [Link]

PMID: 26134653

Glimepiride

By

Glimepiride

Product: STF-31

Identifier : DBSNPE001434
Drug : DB00222 (Glimepiride)
Interacting Gene/Enzyme : Glucose-6-phosphate 1-dehydrogenase
Gene Name : G6PD
UniProt ID : P11413
Defining Change(s) :

  • 1228G->T

Allele Name : Riverside
Genotype(s) : Not Available
Type(s) : ADR Inferred
Groups : G6PD deficiency
Description : Increased risk of hemolytic anemia.
References :

  1. Eichelbaum M, Evert B: Influence of pharmacogenetics on drug disposition and response. Clin Exp Pharmacol Physiol. 1996 Oct-Nov;23(10-11):983-5. [PubMed:8911746 ]
  2. Amaryl® (glimepiride) tablets[package insert]. Bridgewater, New Jersey: Sanofi-Aventis U.S. LLC; 2016. [Link]

PMID: 22188423

Glimepiride

By

Glimepiride

Product: Endoxifen (Z-isomer)

Identifier : DBSNPE001435
Drug : DB00222 (Glimepiride)
Interacting Gene/Enzyme : Glucose-6-phosphate 1-dehydrogenase
Gene Name : G6PD
UniProt ID : P11413
Defining Change(s) :

  • 1229G->A

Allele Name : Japan, Shinagawa
Genotype(s) : Not Available
Type(s) : ADR Inferred
Groups : G6PD deficiency
Description : Increased risk of hemolytic anemia.
References :

  1. Eichelbaum M, Evert B: Influence of pharmacogenetics on drug disposition and response. Clin Exp Pharmacol Physiol. 1996 Oct-Nov;23(10-11):983-5. [PubMed:8911746 ]
  2. Amaryl® (glimepiride) tablets[package insert]. Bridgewater, New Jersey: Sanofi-Aventis U.S. LLC; 2016. [Link]

PMID: 17519950

Glimepiride

By

Glimepiride

Product: Cyclo(RADfK)

Identifier : DBSNPE001436
Drug : DB00222 (Glimepiride)
Interacting Gene/Enzyme : Glucose-6-phosphate 1-dehydrogenase
Gene Name : G6PD
UniProt ID : P11413
Defining Change(s) :

  • 1229G->C

Allele Name : Kawasaki
Genotype(s) : Not Available
Type(s) : ADR Inferred
Groups : G6PD deficiency
Description : Increased risk of hemolytic anemia.
References :

  1. Eichelbaum M, Evert B: Influence of pharmacogenetics on drug disposition and response. Clin Exp Pharmacol Physiol. 1996 Oct-Nov;23(10-11):983-5. [PubMed:8911746 ]
  2. Amaryl® (glimepiride) tablets[package insert]. Bridgewater, New Jersey: Sanofi-Aventis U.S. LLC; 2016. [Link]

PMID: 15488320

Glimepiride

By

Glimepiride

Product: Dextrorotation nimorazole phosphate ester

Identifier : DBSNPE001437
Drug : DB00222 (Glimepiride)
Interacting Gene/Enzyme : Glucose-6-phosphate 1-dehydrogenase
Gene Name : G6PD
UniProt ID : P11413
Defining Change(s) :

  • 1231A->G

Allele Name : Munich
Genotype(s) : Not Available
Type(s) : ADR Inferred
Groups : G6PD deficiency
Description : Increased risk of hemolytic anemia.
References :

  1. Eichelbaum M, Evert B: Influence of pharmacogenetics on drug disposition and response. Clin Exp Pharmacol Physiol. 1996 Oct-Nov;23(10-11):983-5. [PubMed:8911746 ]
  2. Amaryl® (glimepiride) tablets[package insert]. Bridgewater, New Jersey: Sanofi-Aventis U.S. LLC; 2016. [Link]

PMID: 9510072

Glimepiride

By

Glimepiride

Product: BRD7116

Identifier : DBSNPE001438
Drug : DB00222 (Glimepiride)
Interacting Gene/Enzyme : Glucose-6-phosphate 1-dehydrogenase
Gene Name : G6PD
UniProt ID : P11413
Defining Change(s) :

  • 1284C->A

Allele Name : Georgia
Genotype(s) : Not Available
Type(s) : ADR Inferred
Groups : G6PD deficiency
Description : Increased risk of hemolytic anemia.
References :

  1. Eichelbaum M, Evert B: Influence of pharmacogenetics on drug disposition and response. Clin Exp Pharmacol Physiol. 1996 Oct-Nov;23(10-11):983-5. [PubMed:8911746 ]
  2. Amaryl® (glimepiride) tablets[package insert]. Bridgewater, New Jersey: Sanofi-Aventis U.S. LLC; 2016. [Link]

PMID: 10625734

Glimepiride

By

Glimepiride

Product: Santacruzamate A

Identifier : DBSNPE001439
Drug : DB00222 (Glimepiride)
Interacting Gene/Enzyme : Glucose-6-phosphate 1-dehydrogenase
Gene Name : G6PD
UniProt ID : P11413
Defining Change(s) :

  • 1292T->G

Allele Name : Sumare
Genotype(s) : Not Available
Type(s) : ADR Inferred
Groups : G6PD deficiency
Description : Increased risk of hemolytic anemia.
References :

  1. Eichelbaum M, Evert B: Influence of pharmacogenetics on drug disposition and response. Clin Exp Pharmacol Physiol. 1996 Oct-Nov;23(10-11):983-5. [PubMed:8911746 ]
  2. Amaryl® (glimepiride) tablets[package insert]. Bridgewater, New Jersey: Sanofi-Aventis U.S. LLC; 2016. [Link]

PMID: 10928304

Glimepiride

By

Glimepiride

Product: Cefmetazole (sodium)

Identifier : DBSNPE001440
Drug : DB00222 (Glimepiride)
Interacting Gene/Enzyme : Glucose-6-phosphate 1-dehydrogenase
Gene Name : G6PD
UniProt ID : P11413
Defining Change(s) :

  • 1318C->T

Allele Name : Telti/Kobe
Genotype(s) : Not Available
Type(s) : ADR Inferred
Groups : G6PD deficiency
Description : Increased risk of hemolytic anemia.
References :

  1. Eichelbaum M, Evert B: Influence of pharmacogenetics on drug disposition and response. Clin Exp Pharmacol Physiol. 1996 Oct-Nov;23(10-11):983-5. [PubMed:8911746 ]
  2. Amaryl® (glimepiride) tablets[package insert]. Bridgewater, New Jersey: Sanofi-Aventis U.S. LLC; 2016. [Link]

PMID: 9067315

Glimepiride

By

Glimepiride

Product: Trichlormethine

Identifier : DBSNPE001441
Drug : DB00222 (Glimepiride)
Interacting Gene/Enzyme : Glucose-6-phosphate 1-dehydrogenase
Gene Name : G6PD
UniProt ID : P11413
Defining Change(s) :

  • 1339G->A

Allele Name : Santiago de Cuba, Morioka
Genotype(s) : Not Available
Type(s) : ADR Inferred
Groups : G6PD deficiency
Description : Increased risk of hemolytic anemia.
References :

  1. Eichelbaum M, Evert B: Influence of pharmacogenetics on drug disposition and response. Clin Exp Pharmacol Physiol. 1996 Oct-Nov;23(10-11):983-5. [PubMed:8911746 ]
  2. Amaryl® (glimepiride) tablets[package insert]. Bridgewater, New Jersey: Sanofi-Aventis U.S. LLC; 2016. [Link]

PMID: 16399882

Glimepiride

By

Glimepiride

Product: Chlorhexidine

Identifier : DBSNPE001442
Drug : DB00222 (Glimepiride)
Interacting Gene/Enzyme : Glucose-6-phosphate 1-dehydrogenase
Gene Name : G6PD
UniProt ID : P11413
Defining Change(s) :

  • 1358T->A

Allele Name : Harima
Genotype(s) : Not Available
Type(s) : ADR Inferred
Groups : G6PD deficiency
Description : Increased risk of hemolytic anemia.
References :

  1. Eichelbaum M, Evert B: Influence of pharmacogenetics on drug disposition and response. Clin Exp Pharmacol Physiol. 1996 Oct-Nov;23(10-11):983-5. [PubMed:8911746 ]
  2. Amaryl® (glimepiride) tablets[package insert]. Bridgewater, New Jersey: Sanofi-Aventis U.S. LLC; 2016. [Link]

PMID: 15256538

Glimepiride

By

Glimepiride

Product: Thonzonium (bromide)

Identifier : DBSNPE001443
Drug : DB00222 (Glimepiride)
Interacting Gene/Enzyme : Glucose-6-phosphate 1-dehydrogenase
Gene Name : G6PD
UniProt ID : P11413
Defining Change(s) :

  • 1366G->C

Allele Name : Figuera da Foz
Genotype(s) : Not Available
Type(s) : ADR Inferred
Groups : G6PD deficiency
Description : Increased risk of hemolytic anemia.
References :

  1. Eichelbaum M, Evert B: Influence of pharmacogenetics on drug disposition and response. Clin Exp Pharmacol Physiol. 1996 Oct-Nov;23(10-11):983-5. [PubMed:8911746 ]
  2. Amaryl® (glimepiride) tablets[package insert]. Bridgewater, New Jersey: Sanofi-Aventis U.S. LLC; 2016. [Link]

PMID: 15256540

Glimepiride

By

Glimepiride

Product: Dimetridazole

Identifier : DBSNPE001444
Drug : DB00222 (Glimepiride)
Interacting Gene/Enzyme : Glucose-6-phosphate 1-dehydrogenase
Gene Name : G6PD
UniProt ID : P11413
Defining Change(s) :

  • 1367A>T

Allele Name : Amiens
Genotype(s) : Not Available
Type(s) : ADR Inferred
Groups : G6PD deficiency
Description : Increased risk of hemolytic anemia.
References :

  1. Eichelbaum M, Evert B: Influence of pharmacogenetics on drug disposition and response. Clin Exp Pharmacol Physiol. 1996 Oct-Nov;23(10-11):983-5. [PubMed:8911746 ]
  2. Amaryl® (glimepiride) tablets[package insert]. Bridgewater, New Jersey: Sanofi-Aventis U.S. LLC; 2016. [Link]

PMID: 15210837

Glimepiride

By

Glimepiride

Product: Propoxycaine (hydrochloride)

Identifier : DBSNPE001445
Drug : DB00222 (Glimepiride)
Interacting Gene/Enzyme : Glucose-6-phosphate 1-dehydrogenase
Gene Name : G6PD
UniProt ID : P11413
Defining Change(s) :

  • 1376G->T, 1502T->G

Allele Name : Bangkok Noi
Genotype(s) : Not Available
Type(s) : ADR Inferred
Groups : G6PD deficiency
Description : Increased risk of hemolytic anemia.
References :

  1. Eichelbaum M, Evert B: Influence of pharmacogenetics on drug disposition and response. Clin Exp Pharmacol Physiol. 1996 Oct-Nov;23(10-11):983-5. [PubMed:8911746 ]
  2. Amaryl® (glimepiride) tablets[package insert]. Bridgewater, New Jersey: Sanofi-Aventis U.S. LLC; 2016. [Link]

PMID: 10670419

Glimepiride

By

Glimepiride

Product: 3-Cyano-7-ethoxycoumarin

Identifier : DBSNPE001446
Drug : DB00222 (Glimepiride)
Interacting Gene/Enzyme : Glucose-6-phosphate 1-dehydrogenase
Gene Name : G6PD
UniProt ID : P11413
Defining Change(s) :

  • 1462G->A

Allele Name : Fukaya
Genotype(s) : Not Available
Type(s) : ADR Inferred
Groups : G6PD deficiency
Description : Increased risk of hemolytic anemia.
References :

  1. Eichelbaum M, Evert B: Influence of pharmacogenetics on drug disposition and response. Clin Exp Pharmacol Physiol. 1996 Oct-Nov;23(10-11):983-5. [PubMed:8911746 ]
  2. Amaryl® (glimepiride) tablets[package insert]. Bridgewater, New Jersey: Sanofi-Aventis U.S. LLC; 2016. [Link]

PMID: 11080529

Glimepiride

By

Glimepiride

Product: ILK-IN-1

Identifier : DBSNPE001447
Drug : DB00222 (Glimepiride)
Interacting Gene/Enzyme : Glucose-6-phosphate 1-dehydrogenase
Gene Name : G6PD
UniProt ID : P11413
Defining Change(s) :

  • 1463G->T

Allele Name : Campinas
Genotype(s) : Not Available
Type(s) : ADR Inferred
Groups : G6PD deficiency
Description : Increased risk of hemolytic anemia.
References :

  1. Eichelbaum M, Evert B: Influence of pharmacogenetics on drug disposition and response. Clin Exp Pharmacol Physiol. 1996 Oct-Nov;23(10-11):983-5. [PubMed:8911746 ]
  2. Amaryl® (glimepiride) tablets[package insert]. Bridgewater, New Jersey: Sanofi-Aventis U.S. LLC; 2016. [Link]

PMID: 9014138

Glimepiride

By

Glimepiride

Product: IQ-R

Identifier : DBSNPE001448
Drug : DB00222 (Glimepiride)
Interacting Gene/Enzyme : Glucose-6-phosphate 1-dehydrogenase
Gene Name : G6PD
UniProt ID : P11413
Defining Change(s) :

  • 1465C>T

Allele Name : Buenos Aires
Genotype(s) : Not Available
Type(s) : ADR Inferred
Groups : G6PD deficiency
Description : Increased risk of hemolytic anemia.
References :

  1. Eichelbaum M, Evert B: Influence of pharmacogenetics on drug disposition and response. Clin Exp Pharmacol Physiol. 1996 Oct-Nov;23(10-11):983-5. [PubMed:8911746 ]
  2. Amaryl® (glimepiride) tablets[package insert]. Bridgewater, New Jersey: Sanofi-Aventis U.S. LLC; 2016. [Link]

PMID: 16339395

Glimepiride

By

Glimepiride

Product: BoNT-IN-1

Identifier : DBSNPE001449
Drug : DB00222 (Glimepiride)
Interacting Gene/Enzyme : Glucose-6-phosphate 1-dehydrogenase
Gene Name : G6PD
UniProt ID : P11413
Defining Change(s) :

  • 1466C->T

Allele Name : Arakawa
Genotype(s) : Not Available
Type(s) : ADR Inferred
Groups : G6PD deficiency
Description : Increased risk of hemolytic anemia.
References :

  1. Eichelbaum M, Evert B: Influence of pharmacogenetics on drug disposition and response. Clin Exp Pharmacol Physiol. 1996 Oct-Nov;23(10-11):983-5. [PubMed:8911746 ]
  2. Amaryl® (glimepiride) tablets[package insert]. Bridgewater, New Jersey: Sanofi-Aventis U.S. LLC; 2016. [Link]

PMID: 17071543

Glimepiride

By

Glimepiride

Product: Integrin Antagonists 27

Identifier : DBSNPE001450
Drug : DB00222 (Glimepiride)
Interacting Gene/Enzyme : Glucose-6-phosphate 1-dehydrogenase
Gene Name : G6PD
UniProt ID : P11413
Defining Change(s) :

  • 1488_1490delGAA

Allele Name : Brighton
Genotype(s) : Not Available
Type(s) : ADR Inferred
Groups : G6PD deficiency
Description : Increased risk of hemolytic anemia.
References :

  1. Eichelbaum M, Evert B: Influence of pharmacogenetics on drug disposition and response. Clin Exp Pharmacol Physiol. 1996 Oct-Nov;23(10-11):983-5. [PubMed:8911746 ]
  2. Amaryl® (glimepiride) tablets[package insert]. Bridgewater, New Jersey: Sanofi-Aventis U.S. LLC; 2016. [Link]

PMID: 15870187

Glimepiride

By

Glimepiride

Product: Glucosamine (hydrochloride)

Identifier : DBSNPE001451
Drug : DB00222 (Glimepiride)
Interacting Gene/Enzyme : Glucose-6-phosphate 1-dehydrogenase
Gene Name : G6PD
UniProt ID : P11413
Defining Change(s) :

  • 159G->C

Allele Name : Kozukata
Genotype(s) : Not Available
Type(s) : ADR Inferred
Groups : G6PD deficiency
Description : Increased risk of hemolytic anemia.
References :

  1. Eichelbaum M, Evert B: Influence of pharmacogenetics on drug disposition and response. Clin Exp Pharmacol Physiol. 1996 Oct-Nov;23(10-11):983-5. [PubMed:8911746 ]
  2. Amaryl® (glimepiride) tablets[package insert]. Bridgewater, New Jersey: Sanofi-Aventis U.S. LLC; 2016. [Link]

PMID: 15033889

Glimepiride

By

Glimepiride

Product: DL-Glutamine

Identifier : DBSNPE001452
Drug : DB00222 (Glimepiride)
Interacting Gene/Enzyme : Glucose-6-phosphate 1-dehydrogenase
Gene Name : G6PD
UniProt ID : P11413
Defining Change(s) :

  • 180_182delTCT

Allele Name : Amsterdam
Genotype(s) : Not Available
Type(s) : ADR Inferred
Groups : G6PD deficiency
Description : Increased risk of hemolytic anemia.
References :

  1. Eichelbaum M, Evert B: Influence of pharmacogenetics on drug disposition and response. Clin Exp Pharmacol Physiol. 1996 Oct-Nov;23(10-11):983-5. [PubMed:8911746 ]
  2. Amaryl® (glimepiride) tablets[package insert]. Bridgewater, New Jersey: Sanofi-Aventis U.S. LLC; 2016. [Link]

PMID: 12388643

Glimepiride

By

Glimepiride

Product: Droperidol

Identifier : DBSNPE001453
Drug : DB00222 (Glimepiride)
Interacting Gene/Enzyme : Glucose-6-phosphate 1-dehydrogenase
Gene Name : G6PD
UniProt ID : P11413
Defining Change(s) :

  • 202G->A, 376A->G, 1264C>G

Allele Name : No name
Genotype(s) : Not Available
Type(s) : ADR Inferred
Groups : G6PD deficiency
Description : Increased risk of hemolytic anemia.
References :

  1. Eichelbaum M, Evert B: Influence of pharmacogenetics on drug disposition and response. Clin Exp Pharmacol Physiol. 1996 Oct-Nov;23(10-11):983-5. [PubMed:8911746 ]
  2. Amaryl® (glimepiride) tablets[package insert]. Bridgewater, New Jersey: Sanofi-Aventis U.S. LLC; 2016. [Link]

PMID: 9014136

Glimepiride

By

Glimepiride

Product: Drofenine (hydrochloride)

Identifier : DBSNPE001454
Drug : DB00222 (Glimepiride)
Interacting Gene/Enzyme : Glucose-6-phosphate 1-dehydrogenase
Gene Name : G6PD
UniProt ID : P11413
Defining Change(s) :

  • 224T->C

Allele Name : Swansea
Genotype(s) : Not Available
Type(s) : ADR Inferred
Groups : G6PD deficiency
Description : Increased risk of hemolytic anemia.
References :

  1. Eichelbaum M, Evert B: Influence of pharmacogenetics on drug disposition and response. Clin Exp Pharmacol Physiol. 1996 Oct-Nov;23(10-11):983-5. [PubMed:8911746 ]
  2. Amaryl® (glimepiride) tablets[package insert]. Bridgewater, New Jersey: Sanofi-Aventis U.S. LLC; 2016. [Link]

PMID: 17105870

Glimepiride

By

Glimepiride

Product: Pronethalol

Identifier : DBSNPE001455
Drug : DB00222 (Glimepiride)
Interacting Gene/Enzyme : Glucose-6-phosphate 1-dehydrogenase
Gene Name : G6PD
UniProt ID : P11413
Defining Change(s) :

  • 281_283delAGA

Allele Name : Urayasu
Genotype(s) : Not Available
Type(s) : ADR Inferred
Groups : G6PD deficiency
Description : Increased risk of hemolytic anemia.
References :

  1. Eichelbaum M, Evert B: Influence of pharmacogenetics on drug disposition and response. Clin Exp Pharmacol Physiol. 1996 Oct-Nov;23(10-11):983-5. [PubMed:8911746 ]
  2. Amaryl® (glimepiride) tablets[package insert]. Bridgewater, New Jersey: Sanofi-Aventis U.S. LLC; 2016. [Link]

PMID: 17658511

Glimepiride

By

Glimepiride

Product: Suloctidil

Identifier : DBSNPE001456
Drug : DB00222 (Glimepiride)
Interacting Gene/Enzyme : Glucose-6-phosphate 1-dehydrogenase
Gene Name : G6PD
UniProt ID : P11413
Defining Change(s) :

  • 317C->G544C->T592C->T

Allele Name : Vancouver
Genotype(s) : Not Available
Type(s) : ADR Inferred
Groups : G6PD deficiency
Description : Increased risk of hemolytic anemia.
References :

  1. Eichelbaum M, Evert B: Influence of pharmacogenetics on drug disposition and response. Clin Exp Pharmacol Physiol. 1996 Oct-Nov;23(10-11):983-5. [PubMed:8911746 ]
  2. Amaryl® (glimepiride) tablets[package insert]. Bridgewater, New Jersey: Sanofi-Aventis U.S. LLC; 2016. [Link]

PMID: 15102947

Glimepiride

By

Glimepiride

Product: Sulfacarbamide

Identifier : DBSNPE001457
Drug : DB00222 (Glimepiride)
Interacting Gene/Enzyme : Glucose-6-phosphate 1-dehydrogenase
Gene Name : G6PD
UniProt ID : P11413
Defining Change(s) :

  • 376A->G, 1159C->T

Allele Name : Mt Sinai
Genotype(s) : Not Available
Type(s) : ADR Inferred
Groups : G6PD deficiency
Description : Increased risk of hemolytic anemia.
References :

  1. Eichelbaum M, Evert B: Influence of pharmacogenetics on drug disposition and response. Clin Exp Pharmacol Physiol. 1996 Oct-Nov;23(10-11):983-5. [PubMed:8911746 ]
  2. Amaryl® (glimepiride) tablets[package insert]. Bridgewater, New Jersey: Sanofi-Aventis U.S. LLC; 2016. [Link]

PMID: 10496958

Glimepiride

By

Glimepiride

Product: SBC-115076

Identifier : DBSNPE001458
Drug : DB00222 (Glimepiride)
Interacting Gene/Enzyme : Glucose-6-phosphate 1-dehydrogenase
Gene Name : G6PD
UniProt ID : P11413
Defining Change(s) :

  • 488G->A

Allele Name : Plymouth
Genotype(s) : Not Available
Type(s) : ADR Inferred
Groups : G6PD deficiency
Description : Increased risk of hemolytic anemia.
References :

  1. Eichelbaum M, Evert B: Influence of pharmacogenetics on drug disposition and response. Clin Exp Pharmacol Physiol. 1996 Oct-Nov;23(10-11):983-5. [PubMed:8911746 ]
  2. Amaryl® (glimepiride) tablets[package insert]. Bridgewater, New Jersey: Sanofi-Aventis U.S. LLC; 2016. [Link]

PMID: 3033209

Glimepiride

By

Glimepiride

Product: Cholesterol

Identifier : DBSNPE001459
Drug : DB00222 (Glimepiride)
Interacting Gene/Enzyme : Glucose-6-phosphate 1-dehydrogenase
Gene Name : G6PD
UniProt ID : P11413
Defining Change(s) :

  • 514C->T

Allele Name : Volendam
Genotype(s) : Not Available
Type(s) : ADR Inferred
Groups : G6PD deficiency
Description : Increased risk of hemolytic anemia.
References :

  1. Eichelbaum M, Evert B: Influence of pharmacogenetics on drug disposition and response. Clin Exp Pharmacol Physiol. 1996 Oct-Nov;23(10-11):983-5. [PubMed:8911746 ]
  2. Amaryl® (glimepiride) tablets[package insert]. Bridgewater, New Jersey: Sanofi-Aventis U.S. LLC; 2016. [Link]

PMID: 2721568

Glimepiride

By

Glimepiride

Product: CARM1-IN-1 (hydrochloride)

Identifier : DBSNPE001460
Drug : DB00222 (Glimepiride)
Interacting Gene/Enzyme : Glucose-6-phosphate 1-dehydrogenase
Gene Name : G6PD
UniProt ID : P11413
Defining Change(s) :

  • 527A->G

Allele Name : Shinshu
Genotype(s) : Not Available
Type(s) : ADR Inferred
Groups : G6PD deficiency
Description : Increased risk of hemolytic anemia.
References :

  1. Eichelbaum M, Evert B: Influence of pharmacogenetics on drug disposition and response. Clin Exp Pharmacol Physiol. 1996 Oct-Nov;23(10-11):983-5. [PubMed:8911746 ]
  2. Amaryl® (glimepiride) tablets[package insert]. Bridgewater, New Jersey: Sanofi-Aventis U.S. LLC; 2016. [Link]

PMID: 10618148

Glimepiride

By

Glimepiride

Product: AKT inhibitor

Identifier : DBSNPE001461
Drug : DB00222 (Glimepiride)
Interacting Gene/Enzyme : Glucose-6-phosphate 1-dehydrogenase
Gene Name : G6PD
UniProt ID : P11413
Defining Change(s) :

  • 535A->T

Allele Name : Chikugo
Genotype(s) : Not Available
Type(s) : ADR Inferred
Groups : G6PD deficiency
Description : Increased risk of hemolytic anemia.
References :

  1. Eichelbaum M, Evert B: Influence of pharmacogenetics on drug disposition and response. Clin Exp Pharmacol Physiol. 1996 Oct-Nov;23(10-11):983-5. [PubMed:8911746 ]
  2. Amaryl® (glimepiride) tablets[package insert]. Bridgewater, New Jersey: Sanofi-Aventis U.S. LLC; 2016. [Link]

PMID: 9559912

Glimepiride

By

Glimepiride

Product: BQU57

Identifier : DBSNPE001462
Drug : DB00222 (Glimepiride)
Interacting Gene/Enzyme : Glucose-6-phosphate 1-dehydrogenase
Gene Name : G6PD
UniProt ID : P11413
Defining Change(s) :

  • 561_563delCTC

Allele Name : Tsukui
Genotype(s) : Not Available
Type(s) : ADR Inferred
Groups : G6PD deficiency
Description : Increased risk of hemolytic anemia.
References :

  1. Eichelbaum M, Evert B: Influence of pharmacogenetics on drug disposition and response. Clin Exp Pharmacol Physiol. 1996 Oct-Nov;23(10-11):983-5. [PubMed:8911746 ]
  2. Amaryl® (glimepiride) tablets[package insert]. Bridgewater, New Jersey: Sanofi-Aventis U.S. LLC; 2016. [Link]

PMID: 9257911

Glimepiride

By

Glimepiride

Product: SC79

Identifier : DBSNPE001463
Drug : DB00222 (Glimepiride)
Interacting Gene/Enzyme : Glucose-6-phosphate 1-dehydrogenase
Gene Name : G6PD
UniProt ID : P11413
Defining Change(s) :

  • 573C>G

Allele Name : Pedoplis-Ckaro
Genotype(s) : Not Available
Type(s) : ADR Inferred
Groups : G6PD deficiency
Description : Increased risk of hemolytic anemia.
References :

  1. Eichelbaum M, Evert B: Influence of pharmacogenetics on drug disposition and response. Clin Exp Pharmacol Physiol. 1996 Oct-Nov;23(10-11):983-5. [PubMed:8911746 ]
  2. Amaryl® (glimepiride) tablets[package insert]. Bridgewater, New Jersey: Sanofi-Aventis U.S. LLC; 2016. [Link]

PMID: 20512339

Glimepiride

By

Glimepiride

Product: L189

Identifier : DBSNPE001464
Drug : DB00222 (Glimepiride)
Interacting Gene/Enzyme : Glucose-6-phosphate 1-dehydrogenase
Gene Name : G6PD
UniProt ID : P11413
Defining Change(s) :

  • 593G->C

Allele Name : Santiago
Genotype(s) : Not Available
Type(s) : ADR Inferred
Groups : G6PD deficiency
Description : Increased risk of hemolytic anemia.
References :

  1. Eichelbaum M, Evert B: Influence of pharmacogenetics on drug disposition and response. Clin Exp Pharmacol Physiol. 1996 Oct-Nov;23(10-11):983-5. [PubMed:8911746 ]
  2. Amaryl® (glimepiride) tablets[package insert]. Bridgewater, New Jersey: Sanofi-Aventis U.S. LLC; 2016. [Link]

PMID: 11901225

Glimepiride

By

Glimepiride

Product: Mutant IDH1-IN-2

Identifier : DBSNPE001465
Drug : DB00222 (Glimepiride)
Interacting Gene/Enzyme : Glucose-6-phosphate 1-dehydrogenase
Gene Name : G6PD
UniProt ID : P11413
Defining Change(s) :

  • 637G->T

Allele Name : Minnesota, Marion, Gastonia, LeJeune
Genotype(s) : Not Available
Type(s) : ADR Inferred
Groups : G6PD deficiency
Description : Increased risk of hemolytic anemia.
References :

  1. Eichelbaum M, Evert B: Influence of pharmacogenetics on drug disposition and response. Clin Exp Pharmacol Physiol. 1996 Oct-Nov;23(10-11):983-5. [PubMed:8911746 ]
  2. Amaryl® (glimepiride) tablets[package insert]. Bridgewater, New Jersey: Sanofi-Aventis U.S. LLC; 2016. [Link]

PMID: 6121710

Glimepiride

By

Glimepiride

Product: BG45

Identifier : DBSNPE001466
Drug : DB00222 (Glimepiride)
Interacting Gene/Enzyme : Glucose-6-phosphate 1-dehydrogenase
Gene Name : G6PD
UniProt ID : P11413
Defining Change(s) :

  • 637G->T, 1037A->T

Allele Name : Cincinnati
Genotype(s) : Not Available
Type(s) : ADR Inferred
Groups : G6PD deficiency
Description : Increased risk of hemolytic anemia.
References :

  1. Eichelbaum M, Evert B: Influence of pharmacogenetics on drug disposition and response. Clin Exp Pharmacol Physiol. 1996 Oct-Nov;23(10-11):983-5. [PubMed:8911746 ]
  2. Amaryl® (glimepiride) tablets[package insert]. Bridgewater, New Jersey: Sanofi-Aventis U.S. LLC; 2016. [Link]

PMID: 6121711

Glimepiride

By

Glimepiride

Product: Tranilast (trans-)

Identifier : DBSNPE001467
Drug : DB00222 (Glimepiride)
Interacting Gene/Enzyme : Glucose-6-phosphate 1-dehydrogenase
Gene Name : G6PD
UniProt ID : P11413
Defining Change(s) :

  • 648T->G

Allele Name : Harilaou
Genotype(s) : Not Available
Type(s) : ADR Inferred
Groups : G6PD deficiency
Description : Increased risk of hemolytic anemia.
References :

  1. Eichelbaum M, Evert B: Influence of pharmacogenetics on drug disposition and response. Clin Exp Pharmacol Physiol. 1996 Oct-Nov;23(10-11):983-5. [PubMed:8911746 ]
  2. Amaryl® (glimepiride) tablets[package insert]. Bridgewater, New Jersey: Sanofi-Aventis U.S. LLC; 2016. [Link]

PMID: 8619892

Glimepiride

By

Glimepiride

Product: Amentoflavone

Identifier : DBSNPE001468
Drug : DB00222 (Glimepiride)
Interacting Gene/Enzyme : Glucose-6-phosphate 1-dehydrogenase
Gene Name : G6PD
UniProt ID : P11413
Defining Change(s) :

  • 683_685delACA

Allele Name : North Dallas
Genotype(s) : Not Available
Type(s) : ADR Inferred
Groups : G6PD deficiency
Description : Increased risk of hemolytic anemia.
References :

  1. Eichelbaum M, Evert B: Influence of pharmacogenetics on drug disposition and response. Clin Exp Pharmacol Physiol. 1996 Oct-Nov;23(10-11):983-5. [PubMed:8911746 ]
  2. Amaryl® (glimepiride) tablets[package insert]. Bridgewater, New Jersey: Sanofi-Aventis U.S. LLC; 2016. [Link]

PMID: 7473542

Glimepiride

By

Glimepiride

Product: K-Ras-IN-1

Identifier : DBSNPE001469
Drug : DB00222 (Glimepiride)
Interacting Gene/Enzyme : Glucose-6-phosphate 1-dehydrogenase
Gene Name : G6PD
UniProt ID : P11413
Defining Change(s) :

  • 695G->A

Allele Name : Asahikawa
Genotype(s) : Not Available
Type(s) : ADR Inferred
Groups : G6PD deficiency
Description : Increased risk of hemolytic anemia.
References :

  1. Eichelbaum M, Evert B: Influence of pharmacogenetics on drug disposition and response. Clin Exp Pharmacol Physiol. 1996 Oct-Nov;23(10-11):983-5. [PubMed:8911746 ]
  2. Amaryl® (glimepiride) tablets[package insert]. Bridgewater, New Jersey: Sanofi-Aventis U.S. LLC; 2016. [Link]

PMID: 8531107

Glimepiride

By

Glimepiride

Product: 2-Ethoxybenzamide

Identifier : DBSNPE001470
Drug : DB00222 (Glimepiride)
Interacting Gene/Enzyme : Glucose-6-phosphate 1-dehydrogenase
Gene Name : G6PD
UniProt ID : P11413
Defining Change(s) :

  • 713A->G

Allele Name : Durham
Genotype(s) : Not Available
Type(s) : ADR Inferred
Groups : G6PD deficiency
Description : Increased risk of hemolytic anemia.
References :

  1. Eichelbaum M, Evert B: Influence of pharmacogenetics on drug disposition and response. Clin Exp Pharmacol Physiol. 1996 Oct-Nov;23(10-11):983-5. [PubMed:8911746 ]
  2. Amaryl® (glimepiride) tablets[package insert]. Bridgewater, New Jersey: Sanofi-Aventis U.S. LLC; 2016. [Link]

PMID: 7473164

Glimepiride

By

Glimepiride

Product: 9-Aminoacridine

Identifier : DBSNPE001471
Drug : DB00222 (Glimepiride)
Interacting Gene/Enzyme : Glucose-6-phosphate 1-dehydrogenase
Gene Name : G6PD
UniProt ID : P11413
Defining Change(s) :

  • 724_729delGGCACT

Allele Name : Stonybrook
Genotype(s) : Not Available
Type(s) : ADR Inferred
Groups : G6PD deficiency
Description : Increased risk of hemolytic anemia.
References :

  1. Eichelbaum M, Evert B: Influence of pharmacogenetics on drug disposition and response. Clin Exp Pharmacol Physiol. 1996 Oct-Nov;23(10-11):983-5. [PubMed:8911746 ]
  2. Amaryl® (glimepiride) tablets[package insert]. Bridgewater, New Jersey: Sanofi-Aventis U.S. LLC; 2016. [Link]

PMID: 27190170

Glimepiride

By

Glimepiride

Product: Nortriptyline (hydrochloride)

Identifier : DBSNPE001472
Drug : DB00222 (Glimepiride)
Interacting Gene/Enzyme : Glucose-6-phosphate 1-dehydrogenase
Gene Name : G6PD
UniProt ID : P11413
Defining Change(s) :

  • 769C->G

Allele Name : Wayne
Genotype(s) : Not Available
Type(s) : ADR Inferred
Groups : G6PD deficiency
Description : Increased risk of hemolytic anemia.
References :

  1. Eichelbaum M, Evert B: Influence of pharmacogenetics on drug disposition and response. Clin Exp Pharmacol Physiol. 1996 Oct-Nov;23(10-11):983-5. [PubMed:8911746 ]
  2. Amaryl® (glimepiride) tablets[package insert]. Bridgewater, New Jersey: Sanofi-Aventis U.S. LLC; 2016. [Link]

PMID: 18602406

Glimepiride

By

Glimepiride

Product: Chloroxylenol

Identifier : DBSNPE001473
Drug : DB00222 (Glimepiride)
Interacting Gene/Enzyme : Glucose-6-phosphate 1-dehydrogenase
Gene Name : G6PD
UniProt ID : P11413
Defining Change(s) :

  • 806G->A

Allele Name : Aveiro
Genotype(s) : Not Available
Type(s) : ADR Inferred
Groups : G6PD deficiency
Description : Increased risk of hemolytic anemia.
References :

  1. Eichelbaum M, Evert B: Influence of pharmacogenetics on drug disposition and response. Clin Exp Pharmacol Physiol. 1996 Oct-Nov;23(10-11):983-5. [PubMed:8911746 ]
  2. Amaryl® (glimepiride) tablets[package insert]. Bridgewater, New Jersey: Sanofi-Aventis U.S. LLC; 2016. [Link]

PMID: 17585957

Glimepiride

By

Glimepiride

Product: Dienestrol

Identifier : DBSNPE001474
Drug : DB00222 (Glimepiride)
Interacting Gene/Enzyme : Glucose-6-phosphate 1-dehydrogenase
Gene Name : G6PD
UniProt ID : P11413
Defining Change(s) :

  • 820G->A

Allele Name : Cleveland Corum
Genotype(s) : Not Available
Type(s) : ADR Inferred
Groups : G6PD deficiency
Description : Increased risk of hemolytic anemia.
References :

  1. Eichelbaum M, Evert B: Influence of pharmacogenetics on drug disposition and response. Clin Exp Pharmacol Physiol. 1996 Oct-Nov;23(10-11):983-5. [PubMed:8911746 ]
  2. Amaryl® (glimepiride) tablets[package insert]. Bridgewater, New Jersey: Sanofi-Aventis U.S. LLC; 2016. [Link]

PMID: 15921820

Glimepiride

By

Glimepiride

Product: Diiodohydroxyquinoline

Identifier : DBSNPE001475
Drug : DB00222 (Glimepiride)
Interacting Gene/Enzyme : Glucose-6-phosphate 1-dehydrogenase
Gene Name : G6PD
UniProt ID : P11413
Defining Change(s) :

  • 821A>T

Allele Name : Lille
Genotype(s) : Not Available
Type(s) : ADR Inferred
Groups : G6PD deficiency
Description : Increased risk of hemolytic anemia.
References :

  1. Eichelbaum M, Evert B: Influence of pharmacogenetics on drug disposition and response. Clin Exp Pharmacol Physiol. 1996 Oct-Nov;23(10-11):983-5. [PubMed:8911746 ]
  2. Amaryl® (glimepiride) tablets[package insert]. Bridgewater, New Jersey: Sanofi-Aventis U.S. LLC; 2016. [Link]

PMID: 1654254

Glimepiride

By

Glimepiride

Product: 3-Methylsalicylic acid

Identifier : DBSNPE001476
Drug : DB00222 (Glimepiride)
Interacting Gene/Enzyme : Glucose-6-phosphate 1-dehydrogenase
Gene Name : G6PD
UniProt ID : P11413
Defining Change(s) :

  • 825G>C

Allele Name : Bangkok
Genotype(s) : Not Available
Type(s) : ADR Inferred
Groups : G6PD deficiency
Description : Increased risk of hemolytic anemia.
References :

  1. Eichelbaum M, Evert B: Influence of pharmacogenetics on drug disposition and response. Clin Exp Pharmacol Physiol. 1996 Oct-Nov;23(10-11):983-5. [PubMed:8911746 ]
  2. Amaryl® (glimepiride) tablets[package insert]. Bridgewater, New Jersey: Sanofi-Aventis U.S. LLC; 2016. [Link]

PMID: 3016189

Glimepiride

By

Glimepiride

Product: Esmolol (hydrochloride)

Identifier : DBSNPE001477
Drug : DB00222 (Glimepiride)
Interacting Gene/Enzyme : Glucose-6-phosphate 1-dehydrogenase
Gene Name : G6PD
UniProt ID : P11413
Defining Change(s) :

  • 826C->T

Allele Name : Sugao
Genotype(s) : Not Available
Type(s) : ADR Inferred
Groups : G6PD deficiency
Description : Increased risk of hemolytic anemia.
References :

  1. Eichelbaum M, Evert B: Influence of pharmacogenetics on drug disposition and response. Clin Exp Pharmacol Physiol. 1996 Oct-Nov;23(10-11):983-5. [PubMed:8911746 ]
  2. Amaryl® (glimepiride) tablets[package insert]. Bridgewater, New Jersey: Sanofi-Aventis U.S. LLC; 2016. [Link]

PMID: 26388733

Glimepiride

By

Glimepiride

Product: 4-Aminoantipyrine

Identifier : DBSNPE001478
Drug : DB00222 (Glimepiride)
Interacting Gene/Enzyme : Glucose-6-phosphate 1-dehydrogenase
Gene Name : G6PD
UniProt ID : P11413
Defining Change(s) :

  • 832T->C

Allele Name : La Jolla
Genotype(s) : Not Available
Type(s) : ADR Inferred
Groups : G6PD deficiency
Description : Increased risk of hemolytic anemia.
References :

  1. Eichelbaum M, Evert B: Influence of pharmacogenetics on drug disposition and response. Clin Exp Pharmacol Physiol. 1996 Oct-Nov;23(10-11):983-5. [PubMed:8911746 ]
  2. Amaryl® (glimepiride) tablets[package insert]. Bridgewater, New Jersey: Sanofi-Aventis U.S. LLC; 2016. [Link]

PMID: 21636656

Glimepiride

By

Glimepiride

Product: Dehydrocholic acid

Identifier : DBSNPE001479
Drug : DB00222 (Glimepiride)
Interacting Gene/Enzyme : Glucose-6-phosphate 1-dehydrogenase
Gene Name : G6PD
UniProt ID : P11413
Defining Change(s) :

  • 833C->T

Allele Name : Wexham
Genotype(s) : Not Available
Type(s) : ADR Inferred
Groups : G6PD deficiency
Description : Increased risk of hemolytic anemia.
References :

  1. Eichelbaum M, Evert B: Influence of pharmacogenetics on drug disposition and response. Clin Exp Pharmacol Physiol. 1996 Oct-Nov;23(10-11):983-5. [PubMed:8911746 ]
  2. Amaryl® (glimepiride) tablets[package insert]. Bridgewater, New Jersey: Sanofi-Aventis U.S. LLC; 2016. [Link]

PMID: 20406808

Glimepiride

By

Glimepiride

Product: 2,2,2-Tribromoethanol

Identifier : DBSNPE001480
Drug : DB00222 (Glimepiride)
Interacting Gene/Enzyme : Glucose-6-phosphate 1-dehydrogenase
Gene Name : G6PD
UniProt ID : P11413
Defining Change(s) :

  • 851T>C

Allele Name : Piodivkow
Genotype(s) : Not Available
Type(s) : ADR Inferred
Groups : G6PD deficiency
Description : Increased risk of hemolytic anemia.
References :

  1. Eichelbaum M, Evert B: Influence of pharmacogenetics on drug disposition and response. Clin Exp Pharmacol Physiol. 1996 Oct-Nov;23(10-11):983-5. [PubMed:8911746 ]
  2. Amaryl® (glimepiride) tablets[package insert]. Bridgewater, New Jersey: Sanofi-Aventis U.S. LLC; 2016. [Link]

PMID: 8388192

Glimepiride

By

Glimepiride

Product: Liraglutide

Identifier : DBSNPE001481
Drug : DB00222 (Glimepiride)
Interacting Gene/Enzyme : Glucose-6-phosphate 1-dehydrogenase
Gene Name : G6PD
UniProt ID : P11413
Defining Change(s) :

  • 910G->T

Allele Name : West Virginia
Genotype(s) : Not Available
Type(s) : ADR Inferred
Groups : G6PD deficiency
Description : Increased risk of hemolytic anemia.
References :

  1. Eichelbaum M, Evert B: Influence of pharmacogenetics on drug disposition and response. Clin Exp Pharmacol Physiol. 1996 Oct-Nov;23(10-11):983-5. [PubMed:8911746 ]
  2. Amaryl® (glimepiride) tablets[package insert]. Bridgewater, New Jersey: Sanofi-Aventis U.S. LLC; 2016. [Link]

PMID: 1652022

Glimepiride

By

Glimepiride

Product: Aprotinin

Identifier : DBSNPE001482
Drug : DB00222 (Glimepiride)
Interacting Gene/Enzyme : Glucose-6-phosphate 1-dehydrogenase
Gene Name : G6PD
UniProt ID : P11413
Defining Change(s) :

  • 921G->C

Allele Name : Omiya
Genotype(s) : Not Available
Type(s) : ADR Inferred
Groups : G6PD deficiency
Description : Increased risk of hemolytic anemia.
References :

  1. Eichelbaum M, Evert B: Influence of pharmacogenetics on drug disposition and response. Clin Exp Pharmacol Physiol. 1996 Oct-Nov;23(10-11):983-5. [PubMed:8911746 ]
  2. Amaryl® (glimepiride) tablets[package insert]. Bridgewater, New Jersey: Sanofi-Aventis U.S. LLC; 2016. [Link]

PMID: 6259535

Glimepiride

By

Glimepiride

Product: K-Ras(G12C) inhibitor 12

Identifier : DBSNPE001483
Drug : DB00222 (Glimepiride)
Interacting Gene/Enzyme : Glucose-6-phosphate 1-dehydrogenase
Gene Name : G6PD
UniProt ID : P11413
Defining Change(s) :

  • 953_976delCCACCAAAGGGTACCTGGAC GACC

Allele Name : Nara
Genotype(s) : Not Available
Type(s) : ADR Inferred
Groups : G6PD deficiency
Description : Increased risk of hemolytic anemia.
References :

  1. Eichelbaum M, Evert B: Influence of pharmacogenetics on drug disposition and response. Clin Exp Pharmacol Physiol. 1996 Oct-Nov;23(10-11):983-5. [PubMed:8911746 ]
  2. Amaryl® (glimepiride) tablets[package insert]. Bridgewater, New Jersey: Sanofi-Aventis U.S. LLC; 2016. [Link]

PMID: 25261019

Glimepiride

By

Glimepiride

Product: Oroxylin A

Identifier : DBSNPE001484
Drug : DB00222 (Glimepiride)
Interacting Gene/Enzyme : Glucose-6-phosphate 1-dehydrogenase
Gene Name : G6PD
UniProt ID : P11413
Defining Change(s) :

  • 962G->A

Allele Name : Manhattan
Genotype(s) : Not Available
Type(s) : ADR Inferred
Groups : G6PD deficiency
Description : Increased risk of hemolytic anemia.
References :

  1. Eichelbaum M, Evert B: Influence of pharmacogenetics on drug disposition and response. Clin Exp Pharmacol Physiol. 1996 Oct-Nov;23(10-11):983-5. [PubMed:8911746 ]
  2. Amaryl® (glimepiride) tablets[package insert]. Bridgewater, New Jersey: Sanofi-Aventis U.S. LLC; 2016. [Link]

PMID: 23321345

Glimepiride

By

Glimepiride

Product: SIBA

Identifier : DBSNPE001485
Drug : DB00222 (Glimepiride)
Interacting Gene/Enzyme : Glucose-6-phosphate 1-dehydrogenase
Gene Name : G6PD
UniProt ID : P11413
Defining Change(s) :

  • 964T->C

Allele Name : Rehevot
Genotype(s) : Not Available
Type(s) : ADR Inferred
Groups : G6PD deficiency
Description : Increased risk of hemolytic anemia.
References :

  1. Eichelbaum M, Evert B: Influence of pharmacogenetics on drug disposition and response. Clin Exp Pharmacol Physiol. 1996 Oct-Nov;23(10-11):983-5. [PubMed:8911746 ]
  2. Amaryl® (glimepiride) tablets[package insert]. Bridgewater, New Jersey: Sanofi-Aventis U.S. LLC; 2016. [Link]

PMID: 22761875

Glimepiride

By

Glimepiride

Product: LX7101

Identifier : DBSNPE001486
Drug : DB00222 (Glimepiride)
Interacting Gene/Enzyme : Glucose-6-phosphate 1-dehydrogenase
Gene Name : G6PD
UniProt ID : P11413
Defining Change(s) :

  • 99A->G
  • 1360C->T

Allele Name : Honiara
Genotype(s) : Not Available
Type(s) : ADR Inferred
Groups : G6PD deficiency
Description : Increased risk of hemolytic anemia.
References :

  1. Eichelbaum M, Evert B: Influence of pharmacogenetics on drug disposition and response. Clin Exp Pharmacol Physiol. 1996 Oct-Nov;23(10-11):983-5. [PubMed:8911746 ]
  2. Amaryl® (glimepiride) tablets[package insert]. Bridgewater, New Jersey: Sanofi-Aventis U.S. LLC; 2016. [Link]

PMID: 20164356

Glimepiride

By

Glimepiride

Product: Bergenin

Identifier : DBSNPE001488
Drug : DB00222 (Glimepiride)
Interacting Gene/Enzyme : Glucose-6-phosphate 1-dehydrogenase
Gene Name : G6PD
UniProt ID : P11413
Defining Change(s) :

  • 1003G->A

Allele Name : Chatham
Genotype(s) : Not Available
Type(s) : ADR Inferred
Groups : G6PD deficiency
Description : Increased risk of hemolytic anemia.
References :

  1. Eichelbaum M, Evert B: Influence of pharmacogenetics on drug disposition and response. Clin Exp Pharmacol Physiol. 1996 Oct-Nov;23(10-11):983-5. [PubMed:8911746 ]
  2. Amaryl® (glimepiride) tablets[package insert]. Bridgewater, New Jersey: Sanofi-Aventis U.S. LLC; 2016. [Link]

PMID: 19777558

Glimepiride

By

Glimepiride

Product: Nifuroxazide

Identifier : DBSNPE001489
Drug : DB00222 (Glimepiride)
Interacting Gene/Enzyme : Glucose-6-phosphate 1-dehydrogenase
Gene Name : G6PD
UniProt ID : P11413
Defining Change(s) :

  • 1004C->A

Allele Name : Fushan
Genotype(s) : Not Available
Type(s) : ADR Inferred
Groups : G6PD deficiency
Description : Increased risk of hemolytic anemia.
References :

  1. Eichelbaum M, Evert B: Influence of pharmacogenetics on drug disposition and response. Clin Exp Pharmacol Physiol. 1996 Oct-Nov;23(10-11):983-5. [PubMed:8911746 ]
  2. Amaryl® (glimepiride) tablets[package insert]. Bridgewater, New Jersey: Sanofi-Aventis U.S. LLC; 2016. [Link]

PMID: 10341258

Glimepiride

By

Glimepiride

Product: Chlorpropamide

Identifier : DBSNPE001490
Drug : DB00222 (Glimepiride)
Interacting Gene/Enzyme : Glucose-6-phosphate 1-dehydrogenase
Gene Name : G6PD
UniProt ID : P11413
Defining Change(s) :

  • 1052G->T

Allele Name : Partenope
Genotype(s) : Not Available
Type(s) : ADR Inferred
Groups : G6PD deficiency
Description : Increased risk of hemolytic anemia.
References :

  1. Eichelbaum M, Evert B: Influence of pharmacogenetics on drug disposition and response. Clin Exp Pharmacol Physiol. 1996 Oct-Nov;23(10-11):983-5. [PubMed:8911746 ]
  2. Amaryl® (glimepiride) tablets[package insert]. Bridgewater, New Jersey: Sanofi-Aventis U.S. LLC; 2016. [Link]

PMID: 9824455

Glimepiride

By

Glimepiride

Product: Proadifen (hydrochloride)

Identifier : DBSNPE001491
Drug : DB00222 (Glimepiride)
Interacting Gene/Enzyme : Glucose-6-phosphate 1-dehydrogenase
Gene Name : G6PD
UniProt ID : P11413
Defining Change(s) :

  • 1057C->T

Allele Name : Ierapediva
Genotype(s) : Not Available
Type(s) : ADR Inferred
Groups : G6PD deficiency
Description : Increased risk of hemolytic anemia.
References :

  1. Eichelbaum M, Evert B: Influence of pharmacogenetics on drug disposition and response. Clin Exp Pharmacol Physiol. 1996 Oct-Nov;23(10-11):983-5. [PubMed:8911746 ]
  2. Amaryl® (glimepiride) tablets[package insert]. Bridgewater, New Jersey: Sanofi-Aventis U.S. LLC; 2016. [Link]

PMID: 7715832

Glimepiride

By

Glimepiride

Product: Adrenalone (hydrochloride)

Identifier : DBSNPE001492
Drug : DB00222 (Glimepiride)
Interacting Gene/Enzyme : Glucose-6-phosphate 1-dehydrogenase
Gene Name : G6PD
UniProt ID : P11413
Defining Change(s) :

  • 1193A->G

Allele Name : Anadia
Genotype(s) : Not Available
Type(s) : ADR Inferred
Groups : G6PD deficiency
Description : Increased risk of hemolytic anemia.
References :

  1. Eichelbaum M, Evert B: Influence of pharmacogenetics on drug disposition and response. Clin Exp Pharmacol Physiol. 1996 Oct-Nov;23(10-11):983-5. [PubMed:8911746 ]
  2. Amaryl® (glimepiride) tablets[package insert]. Bridgewater, New Jersey: Sanofi-Aventis U.S. LLC; 2016. [Link]

PMID: 2176979

Glimepiride

By

Glimepiride

Product: Testosterone (propionate)

Identifier : DBSNPE001493
Drug : DB00222 (Glimepiride)
Interacting Gene/Enzyme : Glucose-6-phosphate 1-dehydrogenase
Gene Name : G6PD
UniProt ID : P11413
Defining Change(s) :

  • 1220A->C

Allele Name : Abeno
Genotype(s) : Not Available
Type(s) : ADR Inferred
Groups : G6PD deficiency
Description : Increased risk of hemolytic anemia.
References :

  1. Eichelbaum M, Evert B: Influence of pharmacogenetics on drug disposition and response. Clin Exp Pharmacol Physiol. 1996 Oct-Nov;23(10-11):983-5. [PubMed:8911746 ]
  2. Amaryl® (glimepiride) tablets[package insert]. Bridgewater, New Jersey: Sanofi-Aventis U.S. LLC; 2016. [Link]

PMID: 11274998

Glimepiride

By

Glimepiride

Product: Dihydrostreptomycin (sulfate)

Identifier : DBSNPE001494
Drug : DB00222 (Glimepiride)
Interacting Gene/Enzyme : Glucose-6-phosphate 1-dehydrogenase
Gene Name : G6PD
UniProt ID : P11413
Defining Change(s) :

  • 1291G->A

Allele Name : Surabaya
Genotype(s) : Not Available
Type(s) : ADR Inferred
Groups : G6PD deficiency
Description : Increased risk of hemolytic anemia.
References :

  1. Eichelbaum M, Evert B: Influence of pharmacogenetics on drug disposition and response. Clin Exp Pharmacol Physiol. 1996 Oct-Nov;23(10-11):983-5. [PubMed:8911746 ]
  2. Amaryl® (glimepiride) tablets[package insert]. Bridgewater, New Jersey: Sanofi-Aventis U.S. LLC; 2016. [Link]

PMID: 7650685

Glimepiride

By

Glimepiride

Product: 4-Chloro-DL-phenylalanine

Identifier : DBSNPE001495
Drug : DB00222 (Glimepiride)
Interacting Gene/Enzyme : Glucose-6-phosphate 1-dehydrogenase
Gene Name : G6PD
UniProt ID : P11413
Defining Change(s) :

  • 1316G->C

Allele Name : Pawnee
Genotype(s) : Not Available
Type(s) : ADR Inferred
Groups : G6PD deficiency
Description : Increased risk of hemolytic anemia.
References :

  1. Eichelbaum M, Evert B: Influence of pharmacogenetics on drug disposition and response. Clin Exp Pharmacol Physiol. 1996 Oct-Nov;23(10-11):983-5. [PubMed:8911746 ]
  2. Amaryl® (glimepiride) tablets[package insert]. Bridgewater, New Jersey: Sanofi-Aventis U.S. LLC; 2016. [Link]

PMID: 26208338

Glimepiride

By

Glimepiride

Product: Chlorquinaldol

Identifier : DBSNPE001496
Drug : DB00222 (Glimepiride)
Interacting Gene/Enzyme : Glucose-6-phosphate 1-dehydrogenase
Gene Name : G6PD
UniProt ID : P11413
Defining Change(s) :

  • 1342A->G

Allele Name : S. Antioco
Genotype(s) : Not Available
Type(s) : ADR Inferred
Groups : G6PD deficiency
Description : Increased risk of hemolytic anemia.
References :

  1. Eichelbaum M, Evert B: Influence of pharmacogenetics on drug disposition and response. Clin Exp Pharmacol Physiol. 1996 Oct-Nov;23(10-11):983-5. [PubMed:8911746 ]
  2. Amaryl® (glimepiride) tablets[package insert]. Bridgewater, New Jersey: Sanofi-Aventis U.S. LLC; 2016. [Link]

PMID: 9746138

Glimepiride

By

Glimepiride

Product: Furazolidone

Identifier : DBSNPE001497
Drug : DB00222 (Glimepiride)
Interacting Gene/Enzyme : Glucose-6-phosphate 1-dehydrogenase
Gene Name : G6PD
UniProt ID : P11413
Defining Change(s) :

  • 1347G->C

Allele Name : Cassano
Genotype(s) : Not Available
Type(s) : ADR Inferred
Groups : G6PD deficiency
Description : Increased risk of hemolytic anemia.
References :

  1. Eichelbaum M, Evert B: Influence of pharmacogenetics on drug disposition and response. Clin Exp Pharmacol Physiol. 1996 Oct-Nov;23(10-11):983-5. [PubMed:8911746 ]
  2. Amaryl® (glimepiride) tablets[package insert]. Bridgewater, New Jersey: Sanofi-Aventis U.S. LLC; 2016. [Link]

PMID: 25649745

Glimepiride

By

Glimepiride

Product: Bemegride

Identifier : DBSNPE001498
Drug : DB00222 (Glimepiride)
Interacting Gene/Enzyme : Glucose-6-phosphate 1-dehydrogenase
Gene Name : G6PD
UniProt ID : P11413
Defining Change(s) :

  • 1347G->C
  • 1360C->T

Allele Name : Hermoupolis
Genotype(s) : Not Available
Type(s) : ADR Inferred
Groups : G6PD deficiency
Description : Increased risk of hemolytic anemia.
References :

  1. Eichelbaum M, Evert B: Influence of pharmacogenetics on drug disposition and response. Clin Exp Pharmacol Physiol. 1996 Oct-Nov;23(10-11):983-5. [PubMed:8911746 ]
  2. Amaryl® (glimepiride) tablets[package insert]. Bridgewater, New Jersey: Sanofi-Aventis U.S. LLC; 2016. [Link]

PMID: 9874164

Glimepiride

By

Glimepiride

Product: Amodiaquin (dihydrochloride dihydrate)

Identifier : DBSNPE001499
Drug : DB00222 (Glimepiride)
Interacting Gene/Enzyme : Glucose-6-phosphate 1-dehydrogenase
Gene Name : G6PD
UniProt ID : P11413
Defining Change(s) :

  • 1360C->T

Allele Name : Union,Maewo, Chinese-2, Kalo
Genotype(s) : Not Available
Type(s) : ADR Inferred
Groups : G6PD deficiency
Description : Increased risk of hemolytic anemia.
References :

  1. Eichelbaum M, Evert B: Influence of pharmacogenetics on drug disposition and response. Clin Exp Pharmacol Physiol. 1996 Oct-Nov;23(10-11):983-5. [PubMed:8911746 ]
  2. Amaryl® (glimepiride) tablets[package insert]. Bridgewater, New Jersey: Sanofi-Aventis U.S. LLC; 2016. [Link]

PMID: 9750001

Glimepiride

By

Glimepiride

Product: Cetrimonium (bromide)

Identifier : DBSNPE001500
Drug : DB00222 (Glimepiride)
Interacting Gene/Enzyme : Glucose-6-phosphate 1-dehydrogenase
Gene Name : G6PD
UniProt ID : P11413
Defining Change(s) :

  • 1361G->A

Allele Name : Andalus
Genotype(s) : Not Available
Type(s) : ADR Inferred
Groups : G6PD deficiency
Description : Increased risk of hemolytic anemia.
References :

  1. Eichelbaum M, Evert B: Influence of pharmacogenetics on drug disposition and response. Clin Exp Pharmacol Physiol. 1996 Oct-Nov;23(10-11):983-5. [PubMed:8911746 ]
  2. Amaryl® (glimepiride) tablets[package insert]. Bridgewater, New Jersey: Sanofi-Aventis U.S. LLC; 2016. [Link]

PMID: 8103461

Glimepiride

By

Glimepiride

Product: 4-(Aminomethyl)benzoic acid

Identifier : DBSNPE001501
Drug : DB00222 (Glimepiride)
Interacting Gene/Enzyme : Glucose-6-phosphate 1-dehydrogenase
Gene Name : G6PD
UniProt ID : P11413
Defining Change(s) :

  • 1376G->C

Allele Name : Cosenza
Genotype(s) : Not Available
Type(s) : ADR Inferred
Groups : G6PD deficiency
Description : Increased risk of hemolytic anemia.
References :

  1. Eichelbaum M, Evert B: Influence of pharmacogenetics on drug disposition and response. Clin Exp Pharmacol Physiol. 1996 Oct-Nov;23(10-11):983-5. [PubMed:8911746 ]
  2. Amaryl® (glimepiride) tablets[package insert]. Bridgewater, New Jersey: Sanofi-Aventis U.S. LLC; 2016. [Link]

PMID: 27821575

Glimepiride

By

Glimepiride

Product: Salsalate

Identifier : DBSNPE001503
Drug : DB00222 (Glimepiride)
Interacting Gene/Enzyme : Glucose-6-phosphate 1-dehydrogenase
Gene Name : G6PD
UniProt ID : P11413
Defining Change(s) :

  • 1387C->A

Allele Name : Flores
Genotype(s) : Not Available
Type(s) : ADR Inferred
Groups : G6PD deficiency
Description : Increased risk of hemolytic anemia.
References :

  1. Eichelbaum M, Evert B: Influence of pharmacogenetics on drug disposition and response. Clin Exp Pharmacol Physiol. 1996 Oct-Nov;23(10-11):983-5. [PubMed:8911746 ]
  2. Amaryl® (glimepiride) tablets[package insert]. Bridgewater, New Jersey: Sanofi-Aventis U.S. LLC; 2016. [Link]

PMID: 25143547

Glimepiride

By

Glimepiride

Product: Clopidogrel thiolactone

Identifier : DBSNPE001504
Drug : DB00222 (Glimepiride)
Interacting Gene/Enzyme : Glucose-6-phosphate 1-dehydrogenase
Gene Name : G6PD
UniProt ID : P11413
Defining Change(s) :

  • 1388G->A

Allele Name : Kaiping, Anant, Dhon, Sapporo-like, Wosera
Genotype(s) : Not Available
Type(s) : ADR Inferred
Groups : G6PD deficiency
Description : Increased risk of hemolytic anemia.
References :

  1. Eichelbaum M, Evert B: Influence of pharmacogenetics on drug disposition and response. Clin Exp Pharmacol Physiol. 1996 Oct-Nov;23(10-11):983-5. [PubMed:8911746 ]
  2. Amaryl® (glimepiride) tablets[package insert]. Bridgewater, New Jersey: Sanofi-Aventis U.S. LLC; 2016. [Link]

PMID: 23536710

Glimepiride

By

Glimepiride

Product: AF-353

Identifier : DBSNPE001505
Drug : DB00222 (Glimepiride)
Interacting Gene/Enzyme : Glucose-6-phosphate 1-dehydrogenase
Gene Name : G6PD
UniProt ID : P11413
Defining Change(s) :

  • 169C->T

Allele Name : Kamogawa
Genotype(s) : Not Available
Type(s) : ADR Inferred
Groups : G6PD deficiency
Description : Increased risk of hemolytic anemia.
References :

  1. Eichelbaum M, Evert B: Influence of pharmacogenetics on drug disposition and response. Clin Exp Pharmacol Physiol. 1996 Oct-Nov;23(10-11):983-5. [PubMed:8911746 ]
  2. Amaryl® (glimepiride) tablets[package insert]. Bridgewater, New Jersey: Sanofi-Aventis U.S. LLC; 2016. [Link]

PMID: 23197707

Glimepiride

By

Glimepiride

Product: (S)-Gossypol (acetic acid)

Identifier : DBSNPE001506
Drug : DB00222 (Glimepiride)
Interacting Gene/Enzyme : Glucose-6-phosphate 1-dehydrogenase
Gene Name : G6PD
UniProt ID : P11413
Defining Change(s) :

  • 179T>C

Allele Name : Costanzo
Genotype(s) : Not Available
Type(s) : ADR Inferred
Groups : G6PD deficiency
Description : Increased risk of hemolytic anemia.
References :

  1. Eichelbaum M, Evert B: Influence of pharmacogenetics on drug disposition and response. Clin Exp Pharmacol Physiol. 1996 Oct-Nov;23(10-11):983-5. [PubMed:8911746 ]
  2. Amaryl® (glimepiride) tablets[package insert]. Bridgewater, New Jersey: Sanofi-Aventis U.S. LLC; 2016. [Link]

PMID: 20831600

Glimepiride

By

Glimepiride

Product: Morinidazole

Identifier : DBSNPE001507
Drug : DB00222 (Glimepiride)
Interacting Gene/Enzyme : Glucose-6-phosphate 1-dehydrogenase
Gene Name : G6PD
UniProt ID : P11413
Defining Change(s) :

  • 185C->A

Allele Name : Amazonia
Genotype(s) : Not Available
Type(s) : ADR Inferred
Groups : G6PD deficiency
Description : Increased risk of hemolytic anemia.
References :

  1. Eichelbaum M, Evert B: Influence of pharmacogenetics on drug disposition and response. Clin Exp Pharmacol Physiol. 1996 Oct-Nov;23(10-11):983-5. [PubMed:8911746 ]
  2. Amaryl® (glimepiride) tablets[package insert]. Bridgewater, New Jersey: Sanofi-Aventis U.S. LLC; 2016. [Link]

PMID: 9872317

Glimepiride

By

Glimepiride

Product: Morinidazole (R enantiomer)

Identifier : DBSNPE001508
Drug : DB00222 (Glimepiride)
Interacting Gene/Enzyme : Glucose-6-phosphate 1-dehydrogenase
Gene Name : G6PD
UniProt ID : P11413
Defining Change(s) :

  • 196T->A

Allele Name : Songklanagarind
Genotype(s) : Not Available
Type(s) : ADR Inferred
Groups : G6PD deficiency
Description : Increased risk of hemolytic anemia.
References :

  1. Eichelbaum M, Evert B: Influence of pharmacogenetics on drug disposition and response. Clin Exp Pharmacol Physiol. 1996 Oct-Nov;23(10-11):983-5. [PubMed:8911746 ]
  2. Amaryl® (glimepiride) tablets[package insert]. Bridgewater, New Jersey: Sanofi-Aventis U.S. LLC; 2016. [Link]

PMID: 8390938

Glimepiride

By

Glimepiride

Product: Garenoxacin

Identifier : DBSNPE001509
Drug : DB00222 (Glimepiride)
Interacting Gene/Enzyme : Glucose-6-phosphate 1-dehydrogenase
Gene Name : G6PD
UniProt ID : P11413
Defining Change(s) :

  • 202G->A
  • 871G->A

Allele Name : Hechi
Genotype(s) : Not Available
Type(s) : ADR Inferred
Groups : G6PD deficiency
Description : Increased risk of hemolytic anemia.
References :

  1. Eichelbaum M, Evert B: Influence of pharmacogenetics on drug disposition and response. Clin Exp Pharmacol Physiol. 1996 Oct-Nov;23(10-11):983-5. [PubMed:8911746 ]
  2. Amaryl® (glimepiride) tablets[package insert]. Bridgewater, New Jersey: Sanofi-Aventis U.S. LLC; 2016. [Link]

PMID: 27701470

Glimepiride

By

Glimepiride

Product: Garenoxacin (Mesylate hydrate)

Identifier : DBSNPE001510
Drug : DB00222 (Glimepiride)
Interacting Gene/Enzyme : Glucose-6-phosphate 1-dehydrogenase
Gene Name : G6PD
UniProt ID : P11413
Defining Change(s) :

  • 208T->C

Allele Name : Namouru
Genotype(s) : Not Available
Type(s) : ADR Inferred
Groups : G6PD deficiency
Description : Increased risk of hemolytic anemia.
References :

  1. Eichelbaum M, Evert B: Influence of pharmacogenetics on drug disposition and response. Clin Exp Pharmacol Physiol. 1996 Oct-Nov;23(10-11):983-5. [PubMed:8911746 ]
  2. Amaryl® (glimepiride) tablets[package insert]. Bridgewater, New Jersey: Sanofi-Aventis U.S. LLC; 2016. [Link]

PMID: 25948263

Glimepiride

By

Glimepiride

Product: Ornidazole (Levo-)

Identifier : DBSNPE001511
Drug : DB00222 (Glimepiride)
Interacting Gene/Enzyme : Glucose-6-phosphate 1-dehydrogenase
Gene Name : G6PD
UniProt ID : P11413
Defining Change(s) :

  • 352T>C

Allele Name : Bao Loc
Genotype(s) : Not Available
Type(s) : ADR Inferred
Groups : G6PD deficiency
Description : Increased risk of hemolytic anemia.
References :

  1. Eichelbaum M, Evert B: Influence of pharmacogenetics on drug disposition and response. Clin Exp Pharmacol Physiol. 1996 Oct-Nov;23(10-11):983-5. [PubMed:8911746 ]
  2. Amaryl® (glimepiride) tablets[package insert]. Bridgewater, New Jersey: Sanofi-Aventis U.S. LLC; 2016. [Link]

PMID: 23817549

Glimepiride

By

Glimepiride

Product: Cefoperazone (sodium salt)

Identifier : DBSNPE001512
Drug : DB00222 (Glimepiride)
Interacting Gene/Enzyme : Glucose-6-phosphate 1-dehydrogenase
Gene Name : G6PD
UniProt ID : P11413
Defining Change(s) :

  • 375G->T, 379G->T383T->C384C>T

Allele Name : Crispim
Genotype(s) : Not Available
Type(s) : ADR Inferred
Groups : G6PD deficiency
Description : Increased risk of hemolytic anemia.
References :

  1. Eichelbaum M, Evert B: Influence of pharmacogenetics on drug disposition and response. Clin Exp Pharmacol Physiol. 1996 Oct-Nov;23(10-11):983-5. [PubMed:8911746 ]
  2. Amaryl® (glimepiride) tablets[package insert]. Bridgewater, New Jersey: Sanofi-Aventis U.S. LLC; 2016. [Link]

PMID: 19863268

Glimepiride

By

Glimepiride

Product: Camylofine

Identifier : DBSNPE001513
Drug : DB00222 (Glimepiride)
Interacting Gene/Enzyme : Glucose-6-phosphate 1-dehydrogenase
Gene Name : G6PD
UniProt ID : P11413
Defining Change(s) :

  • 376A->G
  • 463C->G

Allele Name : Acrokorinthos
Genotype(s) : Not Available
Type(s) : ADR Inferred
Groups : G6PD deficiency
Description : Increased risk of hemolytic anemia.
References :

  1. Eichelbaum M, Evert B: Influence of pharmacogenetics on drug disposition and response. Clin Exp Pharmacol Physiol. 1996 Oct-Nov;23(10-11):983-5. [PubMed:8911746 ]
  2. Amaryl® (glimepiride) tablets[package insert]. Bridgewater, New Jersey: Sanofi-Aventis U.S. LLC; 2016. [Link]

PMID: 17310064

Glimepiride

By

Glimepiride

Product: Heptaminol (hydrochloride)

Identifier : DBSNPE001514
Drug : DB00222 (Glimepiride)
Interacting Gene/Enzyme : Glucose-6-phosphate 1-dehydrogenase
Gene Name : G6PD
UniProt ID : P11413
Defining Change(s) :

  • 376A->G
  • 542A->T

Allele Name : Santa Maria
Genotype(s) : Not Available
Type(s) : ADR Inferred
Groups : G6PD deficiency
Description : Increased risk of hemolytic anemia.
References :

  1. Eichelbaum M, Evert B: Influence of pharmacogenetics on drug disposition and response. Clin Exp Pharmacol Physiol. 1996 Oct-Nov;23(10-11):983-5. [PubMed:8911746 ]
  2. Amaryl® (glimepiride) tablets[package insert]. Bridgewater, New Jersey: Sanofi-Aventis U.S. LLC; 2016. [Link]

PMID: 12692303

Glimepiride

By

Glimepiride

Product: Metyrapone

Identifier : DBSNPE001516
Drug : DB00222 (Glimepiride)
Interacting Gene/Enzyme : Glucose-6-phosphate 1-dehydrogenase
Gene Name : G6PD
UniProt ID : P11413
Defining Change(s) :

  • 383T->C

Allele Name : Vanua Lava
Genotype(s) : Not Available
Type(s) : ADR Inferred
Groups : G6PD deficiency
Description : Increased risk of hemolytic anemia.
References :

  1. Eichelbaum M, Evert B: Influence of pharmacogenetics on drug disposition and response. Clin Exp Pharmacol Physiol. 1996 Oct-Nov;23(10-11):983-5. [PubMed:8911746 ]
  2. Amaryl® (glimepiride) tablets[package insert]. Bridgewater, New Jersey: Sanofi-Aventis U.S. LLC; 2016. [Link]

PMID: 18538357

Glimepiride

By

Glimepiride

Product: 2-Amino-6-methylheptane

Identifier : DBSNPE001517
Drug : DB00222 (Glimepiride)
Interacting Gene/Enzyme : Glucose-6-phosphate 1-dehydrogenase
Gene Name : G6PD
UniProt ID : P11413
Defining Change(s) :

  • 406C->T

Allele Name : Valladolid
Genotype(s) : Not Available
Type(s) : ADR Inferred
Groups : G6PD deficiency
Description : Increased risk of hemolytic anemia.
References :

  1. Eichelbaum M, Evert B: Influence of pharmacogenetics on drug disposition and response. Clin Exp Pharmacol Physiol. 1996 Oct-Nov;23(10-11):983-5. [PubMed:8911746 ]
  2. Amaryl® (glimepiride) tablets[package insert]. Bridgewater, New Jersey: Sanofi-Aventis U.S. LLC; 2016. [Link]

PMID: 17124268

Glimepiride

By

Glimepiride

Product: Acetohydroxamic acid

Identifier : DBSNPE001518
Drug : DB00222 (Glimepiride)
Interacting Gene/Enzyme : Glucose-6-phosphate 1-dehydrogenase
Gene Name : G6PD
UniProt ID : P11413
Defining Change(s) :

  • 409C->T

Allele Name : Belem
Genotype(s) : Not Available
Type(s) : ADR Inferred
Groups : G6PD deficiency
Description : Increased risk of hemolytic anemia.
References :

  1. Eichelbaum M, Evert B: Influence of pharmacogenetics on drug disposition and response. Clin Exp Pharmacol Physiol. 1996 Oct-Nov;23(10-11):983-5. [PubMed:8911746 ]
  2. Amaryl® (glimepiride) tablets[package insert]. Bridgewater, New Jersey: Sanofi-Aventis U.S. LLC; 2016. [Link]

PMID: 10501448

Glimepiride

By

Glimepiride

Product: Piperacillin (sodium)

Identifier : DBSNPE001519
Drug : DB00222 (Glimepiride)
Interacting Gene/Enzyme : Glucose-6-phosphate 1-dehydrogenase
Gene Name : G6PD
UniProt ID : P11413
Defining Change(s) :

  • 442G->A

Allele Name : Liuzhou
Genotype(s) : Not Available
Type(s) : ADR Inferred
Groups : G6PD deficiency
Description : Increased risk of hemolytic anemia.
References :

  1. Eichelbaum M, Evert B: Influence of pharmacogenetics on drug disposition and response. Clin Exp Pharmacol Physiol. 1996 Oct-Nov;23(10-11):983-5. [PubMed:8911746 ]
  2. Amaryl® (glimepiride) tablets[package insert]. Bridgewater, New Jersey: Sanofi-Aventis U.S. LLC; 2016. [Link]

PMID: 8782915

Glimepiride

By

Glimepiride

Product: Tazobactam

Identifier : DBSNPE001520
Drug : DB00222 (Glimepiride)
Interacting Gene/Enzyme : Glucose-6-phosphate 1-dehydrogenase
Gene Name : G6PD
UniProt ID : P11413
Defining Change(s) :

  • 473G>A

Allele Name : Shenzen
Genotype(s) : Not Available
Type(s) : ADR Inferred
Groups : G6PD deficiency
Description : Increased risk of hemolytic anemia.
References :

  1. Eichelbaum M, Evert B: Influence of pharmacogenetics on drug disposition and response. Clin Exp Pharmacol Physiol. 1996 Oct-Nov;23(10-11):983-5. [PubMed:8911746 ]
  2. Amaryl® (glimepiride) tablets[package insert]. Bridgewater, New Jersey: Sanofi-Aventis U.S. LLC; 2016. [Link]

PMID: 7889310

Glimepiride

By

Glimepiride

Product: Pentylenetetrazol

Identifier : DBSNPE001521
Drug : DB00222 (Glimepiride)
Interacting Gene/Enzyme : Glucose-6-phosphate 1-dehydrogenase
Gene Name : G6PD
UniProt ID : P11413
Defining Change(s) :

  • 493A->G

Allele Name : Taipei “Chinese- 3”
Genotype(s) : Not Available
Type(s) : ADR Inferred
Groups : G6PD deficiency
Description : Increased risk of hemolytic anemia.
References :

  1. Eichelbaum M, Evert B: Influence of pharmacogenetics on drug disposition and response. Clin Exp Pharmacol Physiol. 1996 Oct-Nov;23(10-11):983-5. [PubMed:8911746 ]
  2. Amaryl® (glimepiride) tablets[package insert]. Bridgewater, New Jersey: Sanofi-Aventis U.S. LLC; 2016. [Link]

PMID: 27721466

Glimepiride

By

Glimepiride

Product: Isovaleramide

Identifier : DBSNPE001522
Drug : DB00222 (Glimepiride)
Interacting Gene/Enzyme : Glucose-6-phosphate 1-dehydrogenase
Gene Name : G6PD
UniProt ID : P11413
Defining Change(s) :

  • 496C>T

Allele Name : Toledo
Genotype(s) : Not Available
Type(s) : ADR Inferred
Groups : G6PD deficiency
Description : Increased risk of hemolytic anemia.
References :

  1. Eichelbaum M, Evert B: Influence of pharmacogenetics on drug disposition and response. Clin Exp Pharmacol Physiol. 1996 Oct-Nov;23(10-11):983-5. [PubMed:8911746 ]
  2. Amaryl® (glimepiride) tablets[package insert]. Bridgewater, New Jersey: Sanofi-Aventis U.S. LLC; 2016. [Link]

PMID: 26769224

Glimepiride

By

Glimepiride

Product: Carprofen

Identifier : DBSNPE001523
Drug : DB00222 (Glimepiride)
Interacting Gene/Enzyme : Glucose-6-phosphate 1-dehydrogenase
Gene Name : G6PD
UniProt ID : P11413
Defining Change(s) :

  • 497G->A

Allele Name : Naone
Genotype(s) : Not Available
Type(s) : ADR Inferred
Groups : G6PD deficiency
Description : Increased risk of hemolytic anemia.
References :

  1. Eichelbaum M, Evert B: Influence of pharmacogenetics on drug disposition and response. Clin Exp Pharmacol Physiol. 1996 Oct-Nov;23(10-11):983-5. [PubMed:8911746 ]
  2. Amaryl® (glimepiride) tablets[package insert]. Bridgewater, New Jersey: Sanofi-Aventis U.S. LLC; 2016. [Link]

PMID: 26308580

Glimepiride

By

Glimepiride

Product: Diperodon (hydrochloride)

Identifier : DBSNPE001524
Drug : DB00222 (Glimepiride)
Interacting Gene/Enzyme : Glucose-6-phosphate 1-dehydrogenase
Gene Name : G6PD
UniProt ID : P11413
Defining Change(s) :

  • 517T->C

Allele Name : Nankang
Genotype(s) : Not Available
Type(s) : ADR Inferred
Groups : G6PD deficiency
Description : Increased risk of hemolytic anemia.
References :

  1. Eichelbaum M, Evert B: Influence of pharmacogenetics on drug disposition and response. Clin Exp Pharmacol Physiol. 1996 Oct-Nov;23(10-11):983-5. [PubMed:8911746 ]
  2. Amaryl® (glimepiride) tablets[package insert]. Bridgewater, New Jersey: Sanofi-Aventis U.S. LLC; 2016. [Link]

PMID: 25852468

Glimepiride

By

Glimepiride

Product: Naftidrofuryl (oxalate)

Identifier : DBSNPE001525
Drug : DB00222 (Glimepiride)
Interacting Gene/Enzyme : Glucose-6-phosphate 1-dehydrogenase
Gene Name : G6PD
UniProt ID : P11413
Defining Change(s) :

  • 519C->G

Allele Name : Miaoli
Genotype(s) : Not Available
Type(s) : ADR Inferred
Groups : G6PD deficiency
Description : Increased risk of hemolytic anemia.
References :

  1. Eichelbaum M, Evert B: Influence of pharmacogenetics on drug disposition and response. Clin Exp Pharmacol Physiol. 1996 Oct-Nov;23(10-11):983-5. [PubMed:8911746 ]
  2. Amaryl® (glimepiride) tablets[package insert]. Bridgewater, New Jersey: Sanofi-Aventis U.S. LLC; 2016. [Link]

PMID: 24653676

Glimepiride

By

Glimepiride

Product: Bethanechol

Identifier : DBSNPE001526
Drug : DB00222 (Glimepiride)
Interacting Gene/Enzyme : Glucose-6-phosphate 1-dehydrogenase
Gene Name : G6PD
UniProt ID : P11413
Defining Change(s) :

  • 563C->T

Allele Name : Mediterranean, Dallas, Panama‚ Sassari, Cagliari, Birmingham
Genotype(s) : Not Available
Type(s) : ADR Inferred
Groups : G6PD deficiency
Description : Increased risk of hemolytic anemia.
References :

  1. Eichelbaum M, Evert B: Influence of pharmacogenetics on drug disposition and response. Clin Exp Pharmacol Physiol. 1996 Oct-Nov;23(10-11):983-5. [PubMed:8911746 ]
  2. Amaryl® (glimepiride) tablets[package insert]. Bridgewater, New Jersey: Sanofi-Aventis U.S. LLC; 2016. [Link]

PMID: 25114926

Glimepiride

By

Glimepiride

Product: Milnacipran ((1S-cis) hydrochloride)

Identifier : DBSNPE001527
Drug : DB00222 (Glimepiride)
Interacting Gene/Enzyme : Glucose-6-phosphate 1-dehydrogenase
Gene Name : G6PD
UniProt ID : P11413
Defining Change(s) :

  • 592C->T

Allele Name : Coimbra Shunde
Genotype(s) : Not Available
Type(s) : ADR Inferred
Groups : G6PD deficiency
Description : Increased risk of hemolytic anemia.
References :

  1. Eichelbaum M, Evert B: Influence of pharmacogenetics on drug disposition and response. Clin Exp Pharmacol Physiol. 1996 Oct-Nov;23(10-11):983-5. [PubMed:8911746 ]
  2. Amaryl® (glimepiride) tablets[package insert]. Bridgewater, New Jersey: Sanofi-Aventis U.S. LLC; 2016. [Link]

PMID: 23974706

Glimepiride

By

Glimepiride

Product: Carvedilol (phosphate hemihydrate)

Identifier : DBSNPE001528
Drug : DB00222 (Glimepiride)
Interacting Gene/Enzyme : Glucose-6-phosphate 1-dehydrogenase
Gene Name : G6PD
UniProt ID : P11413
Defining Change(s) :

  • 593G>A

Allele Name : Nilgiri
Genotype(s) : Not Available
Type(s) : ADR Inferred
Groups : G6PD deficiency
Description : Increased risk of hemolytic anemia.
References :

  1. Eichelbaum M, Evert B: Influence of pharmacogenetics on drug disposition and response. Clin Exp Pharmacol Physiol. 1996 Oct-Nov;23(10-11):983-5. [PubMed:8911746 ]
  2. Amaryl® (glimepiride) tablets[package insert]. Bridgewater, New Jersey: Sanofi-Aventis U.S. LLC; 2016. [Link]

PMID: 24009558

Glimepiride

By

Glimepiride

Product: Naloxegol

Identifier : DBSNPE001530
Drug : DB00222 (Glimepiride)
Interacting Gene/Enzyme : Glucose-6-phosphate 1-dehydrogenase
Gene Name : G6PD
UniProt ID : P11413
Defining Change(s) :

  • 811G>C

Allele Name : Roubaix
Genotype(s) : Not Available
Type(s) : ADR Inferred
Groups : G6PD deficiency
Description : Increased risk of hemolytic anemia.
References :

  1. Eichelbaum M, Evert B: Influence of pharmacogenetics on drug disposition and response. Clin Exp Pharmacol Physiol. 1996 Oct-Nov;23(10-11):983-5. [PubMed:8911746 ]
  2. Amaryl® (glimepiride) tablets[package insert]. Bridgewater, New Jersey: Sanofi-Aventis U.S. LLC; 2016. [Link]

PMID: 22728089

Glimepiride

By

Glimepiride

Product: Erdafitinib

Identifier : DBSNPE001531
Drug : DB00222 (Glimepiride)
Interacting Gene/Enzyme : Glucose-6-phosphate 1-dehydrogenase
Gene Name : G6PD
UniProt ID : P11413
Defining Change(s) :

  • 835A->G

Allele Name : Haikou
Genotype(s) : Not Available
Type(s) : ADR Inferred
Groups : G6PD deficiency
Description : Increased risk of hemolytic anemia.
References :

  1. Eichelbaum M, Evert B: Influence of pharmacogenetics on drug disposition and response. Clin Exp Pharmacol Physiol. 1996 Oct-Nov;23(10-11):983-5. [PubMed:8911746 ]
  2. Amaryl® (glimepiride) tablets[package insert]. Bridgewater, New Jersey: Sanofi-Aventis U.S. LLC; 2016. [Link]

PMID: 21858222

Glimepiride

By

Glimepiride

Product: BRD73954

Identifier : DBSNPE001532
Drug : DB00222 (Glimepiride)
Interacting Gene/Enzyme : Glucose-6-phosphate 1-dehydrogenase
Gene Name : G6PD
UniProt ID : P11413
Defining Change(s) :

  • 835A->T

Allele Name : Chinese-1
Genotype(s) : Not Available
Type(s) : ADR Inferred
Groups : G6PD deficiency
Description : Increased risk of hemolytic anemia.
References :

  1. Eichelbaum M, Evert B: Influence of pharmacogenetics on drug disposition and response. Clin Exp Pharmacol Physiol. 1996 Oct-Nov;23(10-11):983-5. [PubMed:8911746 ]
  2. Amaryl® (glimepiride) tablets[package insert]. Bridgewater, New Jersey: Sanofi-Aventis U.S. LLC; 2016. [Link]

PMID: 19535596

Glimepiride

By

Glimepiride

Product: CIQ

Identifier : DBSNPE001533
Drug : DB00222 (Glimepiride)
Interacting Gene/Enzyme : Glucose-6-phosphate 1-dehydrogenase
Gene Name : G6PD
UniProt ID : P11413
Defining Change(s) :

  • 848A>G

Allele Name : Mizushima
Genotype(s) : Not Available
Type(s) : ADR Inferred
Groups : G6PD deficiency
Description : Increased risk of hemolytic anemia.
References :

  1. Eichelbaum M, Evert B: Influence of pharmacogenetics on drug disposition and response. Clin Exp Pharmacol Physiol. 1996 Oct-Nov;23(10-11):983-5. [PubMed:8911746 ]
  2. Amaryl® (glimepiride) tablets[package insert]. Bridgewater, New Jersey: Sanofi-Aventis U.S. LLC; 2016. [Link]

PMID: 17045484

Glimepiride

By

Glimepiride

Product: L-701324

Identifier : DBSNPE001534
Drug : DB00222 (Glimepiride)
Interacting Gene/Enzyme : Glucose-6-phosphate 1-dehydrogenase
Gene Name : G6PD
UniProt ID : P11413
Defining Change(s) :

  • 853C->T

Allele Name : Osaka
Genotype(s) : Not Available
Type(s) : ADR Inferred
Groups : G6PD deficiency
Description : Increased risk of hemolytic anemia.
References :

  1. Eichelbaum M, Evert B: Influence of pharmacogenetics on drug disposition and response. Clin Exp Pharmacol Physiol. 1996 Oct-Nov;23(10-11):983-5. [PubMed:8911746 ]
  2. Amaryl® (glimepiride) tablets[package insert]. Bridgewater, New Jersey: Sanofi-Aventis U.S. LLC; 2016. [Link]

PMID: 2847093

Glimepiride

By

Glimepiride

Product: SYM2206

Identifier : DBSNPE001535
Drug : DB00222 (Glimepiride)
Interacting Gene/Enzyme : Glucose-6-phosphate 1-dehydrogenase
Gene Name : G6PD
UniProt ID : P11413
Defining Change(s) :

  • 871G->A

Allele Name : Viangchan, Jammu
Genotype(s) : Not Available
Type(s) : ADR Inferred
Groups : G6PD deficiency
Description : Increased risk of hemolytic anemia.
References :

  1. Eichelbaum M, Evert B: Influence of pharmacogenetics on drug disposition and response. Clin Exp Pharmacol Physiol. 1996 Oct-Nov;23(10-11):983-5. [PubMed:8911746 ]
  2. Amaryl® (glimepiride) tablets[package insert]. Bridgewater, New Jersey: Sanofi-Aventis U.S. LLC; 2016. [Link]

PMID: 2847092

Glimepiride

By

Glimepiride

Product: N6-[2-(4-Aminophenyl)ethyl]adenosine

Identifier : DBSNPE001536
Drug : DB00222 (Glimepiride)
Interacting Gene/Enzyme : Glucose-6-phosphate 1-dehydrogenase
Gene Name : G6PD
UniProt ID : P11413
Defining Change(s) :

  • 916G->A

Allele Name : Seoul
Genotype(s) : Not Available
Type(s) : ADR Inferred
Groups : G6PD deficiency
Description : Increased risk of hemolytic anemia.
References :

  1. Eichelbaum M, Evert B: Influence of pharmacogenetics on drug disposition and response. Clin Exp Pharmacol Physiol. 1996 Oct-Nov;23(10-11):983-5. [PubMed:8911746 ]
  2. Amaryl® (glimepiride) tablets[package insert]. Bridgewater, New Jersey: Sanofi-Aventis U.S. LLC; 2016. [Link]

PMID: 2559518

Glimepiride

By

Glimepiride

Product: PU-WS13

Identifier : DBSNPE001537
Drug : DB00222 (Glimepiride)
Interacting Gene/Enzyme : Glucose-6-phosphate 1-dehydrogenase
Gene Name : G6PD
UniProt ID : P11413
Defining Change(s) :

  • 929G->A

Allele Name : Ludhiana
Genotype(s) : Not Available
Type(s) : ADR Inferred
Groups : G6PD deficiency
Description : Increased risk of hemolytic anemia.
References :

  1. Eichelbaum M, Evert B: Influence of pharmacogenetics on drug disposition and response. Clin Exp Pharmacol Physiol. 1996 Oct-Nov;23(10-11):983-5. [PubMed:8911746 ]
  2. Amaryl® (glimepiride) tablets[package insert]. Bridgewater, New Jersey: Sanofi-Aventis U.S. LLC; 2016. [Link]

PMID: 25632146

Glimepiride

By

Glimepiride

Product: PROTO-1

Identifier : DBSNPE001538
Drug : DB00222 (Glimepiride)
Interacting Gene/Enzyme : Glucose-6-phosphate 1-dehydrogenase
Gene Name : G6PD
UniProt ID : P11413
Defining Change(s) :

  • 977C->A

Allele Name : Farroupilha
Genotype(s) : Not Available
Type(s) : ADR Inferred
Groups : G6PD deficiency
Description : Increased risk of hemolytic anemia.
References :

  1. Eichelbaum M, Evert B: Influence of pharmacogenetics on drug disposition and response. Clin Exp Pharmacol Physiol. 1996 Oct-Nov;23(10-11):983-5. [PubMed:8911746 ]
  2. Amaryl® (glimepiride) tablets[package insert]. Bridgewater, New Jersey: Sanofi-Aventis U.S. LLC; 2016. [Link]

PMID: 25362474

Glimepiride

By

Glimepiride

Product: Papaverine (hydrochloride)

Identifier : DBSNPE001540
Drug : DB00222 (Glimepiride)
Interacting Gene/Enzyme : Glucose-6-phosphate 1-dehydrogenase
Gene Name : G6PD
UniProt ID : P11413
Defining Change(s) :

  • 130G>A

Allele Name : Rignano
Genotype(s) : Not Available
Type(s) : ADR Inferred
Groups : G6PD deficiency
Description : Increased risk of hemolytic anemia.
References :

  1. Eichelbaum M, Evert B: Influence of pharmacogenetics on drug disposition and response. Clin Exp Pharmacol Physiol. 1996 Oct-Nov;23(10-11):983-5. [PubMed:8911746 ]
  2. Amaryl® (glimepiride) tablets[package insert]. Bridgewater, New Jersey: Sanofi-Aventis U.S. LLC; 2016. [Link]

PMID: 22801496

Glimepiride

By

Glimepiride

Product: Cyclophosphamide (hydrate)

Identifier : DBSNPE001541
Drug : DB00222 (Glimepiride)
Interacting Gene/Enzyme : Glucose-6-phosphate 1-dehydrogenase
Gene Name : G6PD
UniProt ID : P11413
Defining Change(s) :

  • 131C->G

Allele Name : Orissa
Genotype(s) : Not Available
Type(s) : ADR Inferred
Groups : G6PD deficiency
Description : Increased risk of hemolytic anemia.
References :

  1. Eichelbaum M, Evert B: Influence of pharmacogenetics on drug disposition and response. Clin Exp Pharmacol Physiol. 1996 Oct-Nov;23(10-11):983-5. [PubMed:8911746 ]
  2. Amaryl® (glimepiride) tablets[package insert]. Bridgewater, New Jersey: Sanofi-Aventis U.S. LLC; 2016. [Link]

PMID: 3362432

Glimepiride

By

Glimepiride

Product: Kevetrin (hydrochloride)

Identifier : DBSNPE001542
Drug : DB00222 (Glimepiride)
Interacting Gene/Enzyme : Glucose-6-phosphate 1-dehydrogenase
Gene Name : G6PD
UniProt ID : P11413
Defining Change(s) :

  • 1380G>C

Allele Name : G6PDNice
Genotype(s) : Not Available
Type(s) : ADR Inferred
Groups : G6PD deficiency
Description : Increased risk of hemolytic anemia.
References :

  1. Eichelbaum M, Evert B: Influence of pharmacogenetics on drug disposition and response. Clin Exp Pharmacol Physiol. 1996 Oct-Nov;23(10-11):983-5. [PubMed:8911746 ]
  2. Amaryl® (glimepiride) tablets[package insert]. Bridgewater, New Jersey: Sanofi-Aventis U.S. LLC; 2016. [Link]

PMID: 2838310

Glimepiride

By

Glimepiride

Product: ERK5-IN-1

Identifier : DBSNPE001543
Drug : DB00222 (Glimepiride)
Interacting Gene/Enzyme : Glucose-6-phosphate 1-dehydrogenase
Gene Name : G6PD
UniProt ID : P11413
Defining Change(s) :

  • 1387C->T

Allele Name : Kamiube, Keelung
Genotype(s) : Not Available
Type(s) : ADR Inferred
Groups : G6PD deficiency
Description : Increased risk of hemolytic anemia.
References :

  1. Eichelbaum M, Evert B: Influence of pharmacogenetics on drug disposition and response. Clin Exp Pharmacol Physiol. 1996 Oct-Nov;23(10-11):983-5. [PubMed:8911746 ]
  2. Amaryl® (glimepiride) tablets[package insert]. Bridgewater, New Jersey: Sanofi-Aventis U.S. LLC; 2016. [Link]

PMID: 3032346

Glimepiride

By

Glimepiride

Product: D-Luciferin

Identifier : DBSNPE001544
Drug : DB00222 (Glimepiride)
Interacting Gene/Enzyme : Glucose-6-phosphate 1-dehydrogenase
Gene Name : G6PD
UniProt ID : P11413
Defining Change(s) :

  • 1400C->G

Allele Name : Neapolis
Genotype(s) : Not Available
Type(s) : ADR Inferred
Groups : G6PD deficiency
Description : Increased risk of hemolytic anemia.
References :

  1. Eichelbaum M, Evert B: Influence of pharmacogenetics on drug disposition and response. Clin Exp Pharmacol Physiol. 1996 Oct-Nov;23(10-11):983-5. [PubMed:8911746 ]
  2. Amaryl® (glimepiride) tablets[package insert]. Bridgewater, New Jersey: Sanofi-Aventis U.S. LLC; 2016. [Link]

PMID: 9865527

Glimepiride

By

Glimepiride

Product: D-Luciferin (sodium salt)

Identifier : DBSNPE001545
Drug : DB00222 (Glimepiride)
Interacting Gene/Enzyme : Glucose-6-phosphate 1-dehydrogenase
Gene Name : G6PD
UniProt ID : P11413
Defining Change(s) :

  • 143T->C

Allele Name : Aures
Genotype(s) : Not Available
Type(s) : ADR Inferred
Groups : G6PD deficiency
Description : Increased risk of hemolytic anemia.
References :

  1. Eichelbaum M, Evert B: Influence of pharmacogenetics on drug disposition and response. Clin Exp Pharmacol Physiol. 1996 Oct-Nov;23(10-11):983-5. [PubMed:8911746 ]
  2. Amaryl® (glimepiride) tablets[package insert]. Bridgewater, New Jersey: Sanofi-Aventis U.S. LLC; 2016. [Link]

PMID: 7562513

Glimepiride

By

Glimepiride

Product: Leuprorelin

Identifier : DBSNPE001546
Drug : DB00222 (Glimepiride)
Interacting Gene/Enzyme : Glucose-6-phosphate 1-dehydrogenase
Gene Name : G6PD
UniProt ID : P11413
Defining Change(s) :

  • 1442C->G

Allele Name : Split
Genotype(s) : Not Available
Type(s) : ADR Inferred
Groups : G6PD deficiency
Description : Increased risk of hemolytic anemia.
References :

  1. Eichelbaum M, Evert B: Influence of pharmacogenetics on drug disposition and response. Clin Exp Pharmacol Physiol. 1996 Oct-Nov;23(10-11):983-5. [PubMed:8911746 ]
  2. Amaryl® (glimepiride) tablets[package insert]. Bridgewater, New Jersey: Sanofi-Aventis U.S. LLC; 2016. [Link]

PMID: 7562514

Glimepiride

By

Glimepiride

Product: AZD8186

Identifier : DBSNPE001547
Drug : DB00222 (Glimepiride)
Interacting Gene/Enzyme : Glucose-6-phosphate 1-dehydrogenase
Gene Name : G6PD
UniProt ID : P11413
Defining Change(s) :

  • 148C->T

Allele Name : Kambos
Genotype(s) : Not Available
Type(s) : ADR Inferred
Groups : G6PD deficiency
Description : Increased risk of hemolytic anemia.
References :

  1. Eichelbaum M, Evert B: Influence of pharmacogenetics on drug disposition and response. Clin Exp Pharmacol Physiol. 1996 Oct-Nov;23(10-11):983-5. [PubMed:8911746 ]
  2. Amaryl® (glimepiride) tablets[package insert]. Bridgewater, New Jersey: Sanofi-Aventis U.S. LLC; 2016. [Link]

PMID: 27543972

Glimepiride

By

Glimepiride

Product: Coptisine (chloride)

Identifier : DBSNPE001548
Drug : DB00222 (Glimepiride)
Interacting Gene/Enzyme : Glucose-6-phosphate 1-dehydrogenase
Gene Name : G6PD
UniProt ID : P11413
Defining Change(s) :

  • 170G>A

Allele Name : Palesdivina
Genotype(s) : Not Available
Type(s) : ADR Inferred
Groups : G6PD deficiency
Description : Increased risk of hemolytic anemia.
References :

  1. Eichelbaum M, Evert B: Influence of pharmacogenetics on drug disposition and response. Clin Exp Pharmacol Physiol. 1996 Oct-Nov;23(10-11):983-5. [PubMed:8911746 ]
  2. Amaryl® (glimepiride) tablets[package insert]. Bridgewater, New Jersey: Sanofi-Aventis U.S. LLC; 2016. [Link]

PMID: 11724957

Glimepiride

By

Glimepiride

Product: Azoramide

Identifier : DBSNPE001549
Drug : DB00222 (Glimepiride)
Interacting Gene/Enzyme : Glucose-6-phosphate 1-dehydrogenase
Gene Name : G6PD
UniProt ID : P11413
Defining Change(s) :

  • 172G->A

Allele Name : Metaponto
Genotype(s) : Not Available
Type(s) : ADR Inferred
Groups : G6PD deficiency
Description : Increased risk of hemolytic anemia.
References :

  1. Eichelbaum M, Evert B: Influence of pharmacogenetics on drug disposition and response. Clin Exp Pharmacol Physiol. 1996 Oct-Nov;23(10-11):983-5. [PubMed:8911746 ]
  2. Amaryl® (glimepiride) tablets[package insert]. Bridgewater, New Jersey: Sanofi-Aventis U.S. LLC; 2016. [Link]

PMID: 23275067

Glimepiride

By

Glimepiride

Product: HQ-415

Identifier : DBSNPE001550
Drug : DB00222 (Glimepiride)
Interacting Gene/Enzyme : Glucose-6-phosphate 1-dehydrogenase
Gene Name : G6PD
UniProt ID : P11413
Defining Change(s) :

  • 185C->T

Allele Name : Musashino
Genotype(s) : Not Available
Type(s) : ADR Inferred
Groups : G6PD deficiency
Description : Increased risk of hemolytic anemia.
References :

  1. Eichelbaum M, Evert B: Influence of pharmacogenetics on drug disposition and response. Clin Exp Pharmacol Physiol. 1996 Oct-Nov;23(10-11):983-5. [PubMed:8911746 ]
  2. Amaryl® (glimepiride) tablets[package insert]. Bridgewater, New Jersey: Sanofi-Aventis U.S. LLC; 2016. [Link]

PMID: 18536733

Glimepiride

By

Glimepiride

Product: Indoximod

Identifier : DBSNPE001551
Drug : DB00222 (Glimepiride)
Interacting Gene/Enzyme : Glucose-6-phosphate 1-dehydrogenase
Gene Name : G6PD
UniProt ID : P11413
Defining Change(s) :

  • 202G->A

Allele Name : Asahi
Genotype(s) : Not Available
Type(s) : ADR Inferred
Groups : G6PD deficiency
Description : Increased risk of hemolytic anemia.
References :

  1. Eichelbaum M, Evert B: Influence of pharmacogenetics on drug disposition and response. Clin Exp Pharmacol Physiol. 1996 Oct-Nov;23(10-11):983-5. [PubMed:8911746 ]
  2. Amaryl® (glimepiride) tablets[package insert]. Bridgewater, New Jersey: Sanofi-Aventis U.S. LLC; 2016. [Link]

PMID: 11641424

Glimepiride

By

Glimepiride

Product: Setipiprant

Identifier : DBSNPE001552
Drug : DB00222 (Glimepiride)
Interacting Gene/Enzyme : Glucose-6-phosphate 1-dehydrogenase
Gene Name : G6PD
UniProt ID : P11413
Defining Change(s) :

  • 202G->A
  • 376A->G

Allele Name : A- (202), Ferrara I
Genotype(s) : Not Available
Type(s) : ADR Inferred
Groups : G6PD deficiency
Description : Increased risk of hemolytic anemia.
References :

  1. Eichelbaum M, Evert B: Influence of pharmacogenetics on drug disposition and response. Clin Exp Pharmacol Physiol. 1996 Oct-Nov;23(10-11):983-5. [PubMed:8911746 ]
  2. Amaryl® (glimepiride) tablets[package insert]. Bridgewater, New Jersey: Sanofi-Aventis U.S. LLC; 2016. [Link]

PMID: 16507713

Glimepiride

By

Glimepiride

Product: L-655708

Identifier : DBSNPE001553
Drug : DB00222 (Glimepiride)
Interacting Gene/Enzyme : Glucose-6-phosphate 1-dehydrogenase
Gene Name : G6PD
UniProt ID : P11413
Defining Change(s) :

  • 209A->G

Allele Name : Murcia Oristano
Genotype(s) : Not Available
Type(s) : ADR Inferred
Groups : G6PD deficiency
Description : Increased risk of hemolytic anemia.
References :

  1. Eichelbaum M, Evert B: Influence of pharmacogenetics on drug disposition and response. Clin Exp Pharmacol Physiol. 1996 Oct-Nov;23(10-11):983-5. [PubMed:8911746 ]
  2. Amaryl® (glimepiride) tablets[package insert]. Bridgewater, New Jersey: Sanofi-Aventis U.S. LLC; 2016. [Link]

PMID: 16406445

Glimepiride

By

Glimepiride

Product: ITD-1

Identifier : DBSNPE001554
Drug : DB00222 (Glimepiride)
Interacting Gene/Enzyme : Glucose-6-phosphate 1-dehydrogenase
Gene Name : G6PD
UniProt ID : P11413
Defining Change(s) :

  • 241C->T

Allele Name : Ube Konan
Genotype(s) : Not Available
Type(s) : ADR Inferred
Groups : G6PD deficiency
Description : Increased risk of hemolytic anemia.
References :

  1. Eichelbaum M, Evert B: Influence of pharmacogenetics on drug disposition and response. Clin Exp Pharmacol Physiol. 1996 Oct-Nov;23(10-11):983-5. [PubMed:8911746 ]
  2. Amaryl® (glimepiride) tablets[package insert]. Bridgewater, New Jersey: Sanofi-Aventis U.S. LLC; 2016. [Link]

PMID: 18388862

Glimepiride

By

Glimepiride

Product: ZM39923

Identifier : DBSNPE001555
Drug : DB00222 (Glimepiride)
Interacting Gene/Enzyme : Glucose-6-phosphate 1-dehydrogenase
Gene Name : G6PD
UniProt ID : P11413
Defining Change(s) :

  • 242G->A

Allele Name : Lagosanto
Genotype(s) : Not Available
Type(s) : ADR Inferred
Groups : G6PD deficiency
Description : Increased risk of hemolytic anemia.
References :

  1. Eichelbaum M, Evert B: Influence of pharmacogenetics on drug disposition and response. Clin Exp Pharmacol Physiol. 1996 Oct-Nov;23(10-11):983-5. [PubMed:8911746 ]
  2. Amaryl® (glimepiride) tablets[package insert]. Bridgewater, New Jersey: Sanofi-Aventis U.S. LLC; 2016. [Link]

PMID: 17215447

Glimepiride

By

Glimepiride

Product: ZM39923 (hydrochloride)

Identifier : DBSNPE001556
Drug : DB00222 (Glimepiride)
Interacting Gene/Enzyme : Glucose-6-phosphate 1-dehydrogenase
Gene Name : G6PD
UniProt ID : P11413
Defining Change(s) :

  • 274C->T

Allele Name : Guangzhou
Genotype(s) : Not Available
Type(s) : ADR Inferred
Groups : G6PD deficiency
Description : Increased risk of hemolytic anemia.
References :

  1. Eichelbaum M, Evert B: Influence of pharmacogenetics on drug disposition and response. Clin Exp Pharmacol Physiol. 1996 Oct-Nov;23(10-11):983-5. [PubMed:8911746 ]
  2. Amaryl® (glimepiride) tablets[package insert]. Bridgewater, New Jersey: Sanofi-Aventis U.S. LLC; 2016. [Link]

PMID: 15113848

Glimepiride

By

Glimepiride

Product: AS601245

Identifier : DBSNPE001557
Drug : DB00222 (Glimepiride)
Interacting Gene/Enzyme : Glucose-6-phosphate 1-dehydrogenase
Gene Name : G6PD
UniProt ID : P11413
Defining Change(s) :

  • 323T->A

Allele Name : Hammersmith
Genotype(s) : Not Available
Type(s) : ADR Inferred
Groups : G6PD deficiency
Description : Increased risk of hemolytic anemia.
References :

  1. Eichelbaum M, Evert B: Influence of pharmacogenetics on drug disposition and response. Clin Exp Pharmacol Physiol. 1996 Oct-Nov;23(10-11):983-5. [PubMed:8911746 ]
  2. Amaryl® (glimepiride) tablets[package insert]. Bridgewater, New Jersey: Sanofi-Aventis U.S. LLC; 2016. [Link]

PMID: 12954816

Glimepiride

By

Glimepiride

Product: Promazine (hydrochloride)

Identifier : DBSNPE001558
Drug : DB00222 (Glimepiride)
Interacting Gene/Enzyme : Glucose-6-phosphate 1-dehydrogenase
Gene Name : G6PD
UniProt ID : P11413
Defining Change(s) :

  • 34G->T

Allele Name : Sinnai
Genotype(s) : Not Available
Type(s) : ADR Inferred
Groups : G6PD deficiency
Description : Increased risk of hemolytic anemia.
References :

  1. Eichelbaum M, Evert B: Influence of pharmacogenetics on drug disposition and response. Clin Exp Pharmacol Physiol. 1996 Oct-Nov;23(10-11):983-5. [PubMed:8911746 ]
  2. Amaryl® (glimepiride) tablets[package insert]. Bridgewater, New Jersey: Sanofi-Aventis U.S. LLC; 2016. [Link]

PMID: 12606613

Glimepiride

By

Glimepiride

Product: Exalamide

Identifier : DBSNPE001559
Drug : DB00222 (Glimepiride)
Interacting Gene/Enzyme : Glucose-6-phosphate 1-dehydrogenase
Gene Name : G6PD
UniProt ID : P11413
Defining Change(s) :

  • 376A->G
  • 680G->T

Allele Name : A- (680)
Genotype(s) : Not Available
Type(s) : ADR Inferred
Groups : G6PD deficiency
Description : Increased risk of hemolytic anemia.
References :

  1. Eichelbaum M, Evert B: Influence of pharmacogenetics on drug disposition and response. Clin Exp Pharmacol Physiol. 1996 Oct-Nov;23(10-11):983-5. [PubMed:8911746 ]
  2. Amaryl® (glimepiride) tablets[package insert]. Bridgewater, New Jersey: Sanofi-Aventis U.S. LLC; 2016. [Link]

PMID: 16699066

Glimepiride

By

Glimepiride

Product: Sisomicin (sulfate)

Identifier : DBSNPE001560
Drug : DB00222 (Glimepiride)
Interacting Gene/Enzyme : Glucose-6-phosphate 1-dehydrogenase
Gene Name : G6PD
UniProt ID : P11413
Defining Change(s) :

  • 376A->G
  • 968T->C

Allele Name : A- (968), Betica,Selma, Guantanamo
Genotype(s) : Not Available
Type(s) : ADR Inferred
Groups : G6PD deficiency
Description : Increased risk of hemolytic anemia.
References :

  1. Eichelbaum M, Evert B: Influence of pharmacogenetics on drug disposition and response. Clin Exp Pharmacol Physiol. 1996 Oct-Nov;23(10-11):983-5. [PubMed:8911746 ]
  2. Amaryl® (glimepiride) tablets[package insert]. Bridgewater, New Jersey: Sanofi-Aventis U.S. LLC; 2016. [Link]

PMID: 15944007

Glimepiride

By

Glimepiride

Product: Metrifonate

Identifier : DBSNPE001561
Drug : DB00222 (Glimepiride)
Interacting Gene/Enzyme : Glucose-6-phosphate 1-dehydrogenase
Gene Name : G6PD
UniProt ID : P11413
Defining Change(s) :

  • 383T>G

Allele Name : Salerno Pyrgos
Genotype(s) : Not Available
Type(s) : ADR Inferred
Groups : G6PD deficiency
Description : Increased risk of hemolytic anemia.
References :

  1. Eichelbaum M, Evert B: Influence of pharmacogenetics on drug disposition and response. Clin Exp Pharmacol Physiol. 1996 Oct-Nov;23(10-11):983-5. [PubMed:8911746 ]
  2. Amaryl® (glimepiride) tablets[package insert]. Bridgewater, New Jersey: Sanofi-Aventis U.S. LLC; 2016. [Link]

PMID: 8995226

Glimepiride

By

Glimepiride

Product: Sulfaphenazole

Identifier : DBSNPE001562
Drug : DB00222 (Glimepiride)
Interacting Gene/Enzyme : Glucose-6-phosphate 1-dehydrogenase
Gene Name : G6PD
UniProt ID : P11413
Defining Change(s) :

  • 392G->T

Allele Name : Quing Yan
Genotype(s) : Not Available
Type(s) : ADR Inferred
Groups : G6PD deficiency
Description : Increased risk of hemolytic anemia.
References :

  1. Eichelbaum M, Evert B: Influence of pharmacogenetics on drug disposition and response. Clin Exp Pharmacol Physiol. 1996 Oct-Nov;23(10-11):983-5. [PubMed:8911746 ]
  2. Amaryl® (glimepiride) tablets[package insert]. Bridgewater, New Jersey: Sanofi-Aventis U.S. LLC; 2016. [Link]

PMID: 28378856

Glimepiride

By

Glimepiride

Product: Oxeladin (citrate)

Identifier : DBSNPE001563
Drug : DB00222 (Glimepiride)
Interacting Gene/Enzyme : Glucose-6-phosphate 1-dehydrogenase
Gene Name : G6PD
UniProt ID : P11413
Defining Change(s) :

  • 40G->A

Allele Name : Lages
Genotype(s) : Not Available
Type(s) : ADR Inferred
Groups : G6PD deficiency
Description : Increased risk of hemolytic anemia.
References :

  1. Eichelbaum M, Evert B: Influence of pharmacogenetics on drug disposition and response. Clin Exp Pharmacol Physiol. 1996 Oct-Nov;23(10-11):983-5. [PubMed:8911746 ]
  2. Amaryl® (glimepiride) tablets[package insert]. Bridgewater, New Jersey: Sanofi-Aventis U.S. LLC; 2016. [Link]

PMID: 18729649

Glimepiride

By

Glimepiride

Product: Dimenhydrinate

Identifier : DBSNPE001564
Drug : DB00222 (Glimepiride)
Interacting Gene/Enzyme : Glucose-6-phosphate 1-dehydrogenase
Gene Name : G6PD
UniProt ID : P11413
Defining Change(s) :

  • 466G->A

Allele Name : Ilesha
Genotype(s) : Not Available
Type(s) : ADR Inferred
Groups : G6PD deficiency
Description : Increased risk of hemolytic anemia.
References :

  1. Eichelbaum M, Evert B: Influence of pharmacogenetics on drug disposition and response. Clin Exp Pharmacol Physiol. 1996 Oct-Nov;23(10-11):983-5. [PubMed:8911746 ]
  2. Amaryl® (glimepiride) tablets[package insert]. Bridgewater, New Jersey: Sanofi-Aventis U.S. LLC; 2016. [Link]

PMID: 10884520

Glimepiride

By

Glimepiride

Product: Trimipramine (maleate)

Identifier : DBSNPE001565
Drug : DB00222 (Glimepiride)
Interacting Gene/Enzyme : Glucose-6-phosphate 1-dehydrogenase
Gene Name : G6PD
UniProt ID : P11413
Defining Change(s) :

  • 487G->A

Allele Name : Mahidol
Genotype(s) : Not Available
Type(s) : ADR Inferred
Groups : G6PD deficiency
Description : Increased risk of hemolytic anemia.
References :

  1. Eichelbaum M, Evert B: Influence of pharmacogenetics on drug disposition and response. Clin Exp Pharmacol Physiol. 1996 Oct-Nov;23(10-11):983-5. [PubMed:8911746 ]
  2. Amaryl® (glimepiride) tablets[package insert]. Bridgewater, New Jersey: Sanofi-Aventis U.S. LLC; 2016. [Link]

PMID: 10588748

Glimepiride

By

Glimepiride

Product: Broxyquinoline

Identifier : DBSNPE001566
Drug : DB00222 (Glimepiride)
Interacting Gene/Enzyme : Glucose-6-phosphate 1-dehydrogenase
Gene Name : G6PD
UniProt ID : P11413
Defining Change(s) :

  • 542A->T

Allele Name : Malaga
Genotype(s) : Not Available
Type(s) : ADR Inferred
Groups : G6PD deficiency
Description : Increased risk of hemolytic anemia.
References :

  1. Eichelbaum M, Evert B: Influence of pharmacogenetics on drug disposition and response. Clin Exp Pharmacol Physiol. 1996 Oct-Nov;23(10-11):983-5. [PubMed:8911746 ]
  2. Amaryl® (glimepiride) tablets[package insert]. Bridgewater, New Jersey: Sanofi-Aventis U.S. LLC; 2016. [Link]

PMID: 2472967

Glimepiride

By

Glimepiride

Product: Pipemidic acid

Identifier : DBSNPE001567
Drug : DB00222 (Glimepiride)
Interacting Gene/Enzyme : Glucose-6-phosphate 1-dehydrogenase
Gene Name : G6PD
UniProt ID : P11413
Defining Change(s) :

  • 634A->G

Allele Name : Sibari
Genotype(s) : Not Available
Type(s) : ADR Inferred
Groups : G6PD deficiency
Description : Increased risk of hemolytic anemia.
References :

  1. Eichelbaum M, Evert B: Influence of pharmacogenetics on drug disposition and response. Clin Exp Pharmacol Physiol. 1996 Oct-Nov;23(10-11):983-5. [PubMed:8911746 ]
  2. Amaryl® (glimepiride) tablets[package insert]. Bridgewater, New Jersey: Sanofi-Aventis U.S. LLC; 2016. [Link]

PMID: 25522404

Glimepiride

By

Glimepiride

Product: Etofylline

Identifier : DBSNPE001568
Drug : DB00222 (Glimepiride)
Interacting Gene/Enzyme : Glucose-6-phosphate 1-dehydrogenase
Gene Name : G6PD
UniProt ID : P11413
Defining Change(s) :

  • 680G->A

Allele Name : Mexico City
Genotype(s) : Not Available
Type(s) : ADR Inferred
Groups : G6PD deficiency
Description : Increased risk of hemolytic anemia.
References :

  1. Eichelbaum M, Evert B: Influence of pharmacogenetics on drug disposition and response. Clin Exp Pharmacol Physiol. 1996 Oct-Nov;23(10-11):983-5. [PubMed:8911746 ]
  2. Amaryl® (glimepiride) tablets[package insert]. Bridgewater, New Jersey: Sanofi-Aventis U.S. LLC; 2016. [Link]

PMID: 9756377

Glimepiride

By

Glimepiride

Product: Carbamoylcholine (chloride)

Identifier : DBSNPE001569
Drug : DB00222 (Glimepiride)
Interacting Gene/Enzyme : Glucose-6-phosphate 1-dehydrogenase
Gene Name : G6PD
UniProt ID : P11413
Defining Change(s) :

  • 703C->T

Allele Name : Nanning
Genotype(s) : Not Available
Type(s) : ADR Inferred
Groups : G6PD deficiency
Description : Increased risk of hemolytic anemia.
References :

  1. Eichelbaum M, Evert B: Influence of pharmacogenetics on drug disposition and response. Clin Exp Pharmacol Physiol. 1996 Oct-Nov;23(10-11):983-5. [PubMed:8911746 ]
  2. Amaryl® (glimepiride) tablets[package insert]. Bridgewater, New Jersey: Sanofi-Aventis U.S. LLC; 2016. [Link]

PMID: 9729239

Glimepiride

By

Glimepiride

Product: Atropine (sulfate)

Identifier : DBSNPE001570
Drug : DB00222 (Glimepiride)
Interacting Gene/Enzyme : Glucose-6-phosphate 1-dehydrogenase
Gene Name : G6PD
UniProt ID : P11413
Defining Change(s) :

  • 844G->C

Allele Name : Seattle, Lodi, Modena, Ferrara II, Athens-like
Genotype(s) : Not Available
Type(s) : ADR Inferred
Groups : G6PD deficiency
Description : Increased risk of hemolytic anemia.
References :

  1. Eichelbaum M, Evert B: Influence of pharmacogenetics on drug disposition and response. Clin Exp Pharmacol Physiol. 1996 Oct-Nov;23(10-11):983-5. [PubMed:8911746 ]
  2. Amaryl® (glimepiride) tablets[package insert]. Bridgewater, New Jersey: Sanofi-Aventis U.S. LLC; 2016. [Link]

PMID: 1722333

Glimepiride

By

Glimepiride

Product: Atropine

Identifier : DBSNPE001571
Drug : DB00222 (Glimepiride)
Interacting Gene/Enzyme : Glucose-6-phosphate 1-dehydrogenase
Gene Name : G6PD
UniProt ID : P11413
Defining Change(s) :

  • 844G->T

Allele Name : Bajo Maumere
Genotype(s) : Not Available
Type(s) : ADR Inferred
Groups : G6PD deficiency
Description : Increased risk of hemolytic anemia.
References :

  1. Eichelbaum M, Evert B: Influence of pharmacogenetics on drug disposition and response. Clin Exp Pharmacol Physiol. 1996 Oct-Nov;23(10-11):983-5. [PubMed:8911746 ]
  2. Amaryl® (glimepiride) tablets[package insert]. Bridgewater, New Jersey: Sanofi-Aventis U.S. LLC; 2016. [Link]

PMID: 23965627

Glimepiride

By

Glimepiride

Product: Fludrocortisone (acetate)

Identifier : DBSNPE001572
Drug : DB00222 (Glimepiride)
Interacting Gene/Enzyme : Glucose-6-phosphate 1-dehydrogenase
Gene Name : G6PD
UniProt ID : P11413
Defining Change(s) :

  • 854G->A

Allele Name : Montalbano
Genotype(s) : Not Available
Type(s) : ADR Inferred
Groups : G6PD deficiency
Description : Increased risk of hemolytic anemia.
References :

  1. Eichelbaum M, Evert B: Influence of pharmacogenetics on drug disposition and response. Clin Exp Pharmacol Physiol. 1996 Oct-Nov;23(10-11):983-5. [PubMed:8911746 ]
  2. Amaryl® (glimepiride) tablets[package insert]. Bridgewater, New Jersey: Sanofi-Aventis U.S. LLC; 2016. [Link]

PMID: 9405385

Glimepiride

By

Glimepiride

Product: Fludrocortisone

Identifier : DBSNPE001573
Drug : DB00222 (Glimepiride)
Interacting Gene/Enzyme : Glucose-6-phosphate 1-dehydrogenase
Gene Name : G6PD
UniProt ID : P11413
Defining Change(s) :

  • 949G->A

Allele Name : Kalyan-Kerala, Jamnaga, Rohini
Genotype(s) : Not Available
Type(s) : ADR Inferred
Groups : G6PD deficiency
Description : Increased risk of hemolytic anemia.
References :

  1. Eichelbaum M, Evert B: Influence of pharmacogenetics on drug disposition and response. Clin Exp Pharmacol Physiol. 1996 Oct-Nov;23(10-11):983-5. [PubMed:8911746 ]
  2. Amaryl® (glimepiride) tablets[package insert]. Bridgewater, New Jersey: Sanofi-Aventis U.S. LLC; 2016. [Link]

PMID: 9281594

Glimepiride

By

Glimepiride

Product: Alrestatin (sodium)

Identifier : DBSNPE001574
Drug : DB00222 (Glimepiride)
Interacting Gene/Enzyme : Glucose-6-phosphate 1-dehydrogenase
Gene Name : G6PD
UniProt ID : P11413
Defining Change(s) :

  • 95A->G

Allele Name : Gaohe
Genotype(s) : Not Available
Type(s) : ADR Inferred
Groups : G6PD deficiency
Description : Increased risk of hemolytic anemia.
References :

  1. Eichelbaum M, Evert B: Influence of pharmacogenetics on drug disposition and response. Clin Exp Pharmacol Physiol. 1996 Oct-Nov;23(10-11):983-5. [PubMed:8911746 ]
  2. Amaryl® (glimepiride) tablets[package insert]. Bridgewater, New Jersey: Sanofi-Aventis U.S. LLC; 2016. [Link]

PMID: 15647369

By

Related Post

You Missed

Uncategorized

COMM domain containing 4

Uncategorized

SHBG Monoclonal Antibody (OTI1A6), TrueMAB™

Uncategorized

CCR4-NOT transcription complex, subunit 3

Uncategorized

SGSM2 Polyclonal Antibody