PI3KInhibitorpi3kinhibitor

Dapsone

By

Dapsone

Product: Troxipide

Identifier : DBSNPE001233
Drug : DB00250 (Dapsone)
Interacting Gene/Enzyme : Glucose-6-phosphate 1-dehydrogenase
Gene Name : G6PD
UniProt ID : P11413
Defining Change(s) :

  • 1000_1002delACC

Allele Name : Villeurbanne
Genotype(s) : Not Available
Type(s) : ADR Inferred
Groups : G6PD deficiency
Description : Increased risk of hemolysis and hemolytic anemia.
References :

  1. Luzzatto L, Seneca E: G6PD deficiency: a classic example of pharmacogenetics with on-going clinical implications. Br J Haematol. 2014 Feb;164(4):469-80. doi: 10.1111/bjh.12665. Epub 2013 Dec 28. [PubMed:24372186 ]
  2. Aczone® (dapsone) Gel[package insert]. Irvine, California: Allergan, Inc.; 2016. [Link]

PMID: 25677551

Dapsone

By

Dapsone

Product: 3-Methyladenine

Identifier : DBSNPE001234
Drug : DB00250 (Dapsone)
Interacting Gene/Enzyme : Glucose-6-phosphate 1-dehydrogenase
Gene Name : G6PD
UniProt ID : P11413
Defining Change(s) :

  • 1006A->G

Allele Name : Torun
Genotype(s) : Not Available
Type(s) : ADR Inferred
Groups : G6PD deficiency
Description : Increased risk of hemolysis and hemolytic anemia.
References :

  1. Luzzatto L, Seneca E: G6PD deficiency: a classic example of pharmacogenetics with on-going clinical implications. Br J Haematol. 2014 Feb;164(4):469-80. doi: 10.1111/bjh.12665. Epub 2013 Dec 28. [PubMed:24372186 ]
  2. Aczone® (dapsone) Gel[package insert]. Irvine, California: Allergan, Inc.; 2016. [Link]

PMID: 24453941

Dapsone

By

Dapsone

Product: Hexaminolevulinate (hydrochloride)

Identifier : DBSNPE001235
Drug : DB00250 (Dapsone)
Interacting Gene/Enzyme : Glucose-6-phosphate 1-dehydrogenase
Gene Name : G6PD
UniProt ID : P11413
Defining Change(s) :

  • 105_107delCAT

Allele Name : Sunderland
Genotype(s) : Not Available
Type(s) : ADR Inferred
Groups : G6PD deficiency
Description : Increased risk of hemolysis and hemolytic anemia.
References :

  1. Luzzatto L, Seneca E: G6PD deficiency: a classic example of pharmacogenetics with on-going clinical implications. Br J Haematol. 2014 Feb;164(4):469-80. doi: 10.1111/bjh.12665. Epub 2013 Dec 28. [PubMed:24372186 ]
  2. Aczone® (dapsone) Gel[package insert]. Irvine, California: Allergan, Inc.; 2016. [Link]

PMID: 25231980

Dapsone

By

Dapsone

Product: PF-4989216

Identifier : DBSNPE001237
Drug : DB00250 (Dapsone)
Interacting Gene/Enzyme : Glucose-6-phosphate 1-dehydrogenase
Gene Name : G6PD
UniProt ID : P11413
Defining Change(s) :

  • 1082C->T

Allele Name : Serres
Genotype(s) : Not Available
Type(s) : ADR Inferred
Groups : G6PD deficiency
Description : Increased risk of hemolysis and hemolytic anemia.
References :

  1. Luzzatto L, Seneca E: G6PD deficiency: a classic example of pharmacogenetics with on-going clinical implications. Br J Haematol. 2014 Feb;164(4):469-80. doi: 10.1111/bjh.12665. Epub 2013 Dec 28. [PubMed:24372186 ]
  2. Aczone® (dapsone) Gel[package insert]. Irvine, California: Allergan, Inc.; 2016. [Link]

PMID: 23536061

Dapsone

By

Dapsone

Product: Solcitinib

Identifier : DBSNPE001238
Drug : DB00250 (Dapsone)
Interacting Gene/Enzyme : Glucose-6-phosphate 1-dehydrogenase
Gene Name : G6PD
UniProt ID : P11413
Defining Change(s) :

  • 1084_1101delCTGAACGAGCGCAAGGCC

Allele Name : Tondela
Genotype(s) : Not Available
Type(s) : ADR Inferred
Groups : G6PD deficiency
Description : Increased risk of hemolysis and hemolytic anemia.
References :

  1. Luzzatto L, Seneca E: G6PD deficiency: a classic example of pharmacogenetics with on-going clinical implications. Br J Haematol. 2014 Feb;164(4):469-80. doi: 10.1111/bjh.12665. Epub 2013 Dec 28. [PubMed:24372186 ]
  2. Aczone® (dapsone) Gel[package insert]. Irvine, California: Allergan, Inc.; 2016. [Link]

PMID: 21562256

Dapsone

By

Dapsone

Product: Kuromanin (chloride)

Identifier : DBSNPE001239
Drug : DB00250 (Dapsone)
Interacting Gene/Enzyme : Glucose-6-phosphate 1-dehydrogenase
Gene Name : G6PD
UniProt ID : P11413
Defining Change(s) :

  • 1089C->A

Allele Name : Loma Linda
Genotype(s) : Not Available
Type(s) : ADR Inferred
Groups : G6PD deficiency
Description : Increased risk of hemolysis and hemolytic anemia.
References :

  1. Luzzatto L, Seneca E: G6PD deficiency: a classic example of pharmacogenetics with on-going clinical implications. Br J Haematol. 2014 Feb;164(4):469-80. doi: 10.1111/bjh.12665. Epub 2013 Dec 28. [PubMed:24372186 ]
  2. Aczone® (dapsone) Gel[package insert]. Irvine, California: Allergan, Inc.; 2016. [Link]

PMID: 20145658

Dapsone

By

Dapsone

Product: Clofentezine

Identifier : DBSNPE001240
Drug : DB00250 (Dapsone)
Interacting Gene/Enzyme : Glucose-6-phosphate 1-dehydrogenase
Gene Name : G6PD
UniProt ID : P11413
Defining Change(s) :

  • 1089C->G

Allele Name : Aachen
Genotype(s) : Not Available
Type(s) : ADR Inferred
Groups : G6PD deficiency
Description : Increased risk of hemolysis and hemolytic anemia.
References :

  1. Luzzatto L, Seneca E: G6PD deficiency: a classic example of pharmacogenetics with on-going clinical implications. Br J Haematol. 2014 Feb;164(4):469-80. doi: 10.1111/bjh.12665. Epub 2013 Dec 28. [PubMed:24372186 ]
  2. Aczone® (dapsone) Gel[package insert]. Irvine, California: Allergan, Inc.; 2016. [Link]

PMID: 19376067

Dapsone

By

Dapsone

Product: Tolclofos-methyl

Identifier : DBSNPE001241
Drug : DB00250 (Dapsone)
Interacting Gene/Enzyme : Glucose-6-phosphate 1-dehydrogenase
Gene Name : G6PD
UniProt ID : P11413
Defining Change(s) :

  • 1096A->G

Allele Name : Tenri
Genotype(s) : Not Available
Type(s) : ADR Inferred
Groups : G6PD deficiency
Description : Increased risk of hemolysis and hemolytic anemia.
References :

  1. Luzzatto L, Seneca E: G6PD deficiency: a classic example of pharmacogenetics with on-going clinical implications. Br J Haematol. 2014 Feb;164(4):469-80. doi: 10.1111/bjh.12665. Epub 2013 Dec 28. [PubMed:24372186 ]
  2. Aczone® (dapsone) Gel[package insert]. Irvine, California: Allergan, Inc.; 2016. [Link]

PMID: 17553893

Dapsone

By

Dapsone

Product: Trifluralin

Identifier : DBSNPE001242
Drug : DB00250 (Dapsone)
Interacting Gene/Enzyme : Glucose-6-phosphate 1-dehydrogenase
Gene Name : G6PD
UniProt ID : P11413
Defining Change(s) :

  • 1132G>A

Allele Name : Montpellier
Genotype(s) : Not Available
Type(s) : ADR Inferred
Groups : G6PD deficiency
Description : Increased risk of hemolysis and hemolytic anemia.
References :

  1. Luzzatto L, Seneca E: G6PD deficiency: a classic example of pharmacogenetics with on-going clinical implications. Br J Haematol. 2014 Feb;164(4):469-80. doi: 10.1111/bjh.12665. Epub 2013 Dec 28. [PubMed:24372186 ]
  2. Aczone® (dapsone) Gel[package insert]. Irvine, California: Allergan, Inc.; 2016. [Link]

PMID: 3440204

Dapsone

By

Dapsone

Product: Fenoxaprop-P-ethyl

Identifier : DBSNPE001243
Drug : DB00250 (Dapsone)
Interacting Gene/Enzyme : Glucose-6-phosphate 1-dehydrogenase
Gene Name : G6PD
UniProt ID : P11413
Defining Change(s) :

  • 1138A->G

Allele Name : Calvo Mackenna
Genotype(s) : Not Available
Type(s) : ADR Inferred
Groups : G6PD deficiency
Description : Increased risk of hemolysis and hemolytic anemia.
References :

  1. Luzzatto L, Seneca E: G6PD deficiency: a classic example of pharmacogenetics with on-going clinical implications. Br J Haematol. 2014 Feb;164(4):469-80. doi: 10.1111/bjh.12665. Epub 2013 Dec 28. [PubMed:24372186 ]
  2. Aczone® (dapsone) Gel[package insert]. Irvine, California: Allergan, Inc.; 2016. [Link]

PMID: 6297646

Dapsone

By

Dapsone

Product: Napropamide

Identifier : DBSNPE001244
Drug : DB00250 (Dapsone)
Interacting Gene/Enzyme : Glucose-6-phosphate 1-dehydrogenase
Gene Name : G6PD
UniProt ID : P11413
Defining Change(s) :

  • 1139T->C

Allele Name : Riley
Genotype(s) : Not Available
Type(s) : ADR Inferred
Groups : G6PD deficiency
Description : Increased risk of hemolysis and hemolytic anemia.
References :

  1. Luzzatto L, Seneca E: G6PD deficiency: a classic example of pharmacogenetics with on-going clinical implications. Br J Haematol. 2014 Feb;164(4):469-80. doi: 10.1111/bjh.12665. Epub 2013 Dec 28. [PubMed:24372186 ]
  2. Aczone® (dapsone) Gel[package insert]. Irvine, California: Allergan, Inc.; 2016. [Link]

PMID: 24366261

Dapsone

By

Dapsone

Product: Cefetamet pivoxil (hydrochloride)

Identifier : DBSNPE001245
Drug : DB00250 (Dapsone)
Interacting Gene/Enzyme : Glucose-6-phosphate 1-dehydrogenase
Gene Name : G6PD
UniProt ID : P11413
Defining Change(s) :

  • 1141T->C

Allele Name : Olomouc
Genotype(s) : Not Available
Type(s) : ADR Inferred
Groups : G6PD deficiency
Description : Increased risk of hemolysis and hemolytic anemia.
References :

  1. Luzzatto L, Seneca E: G6PD deficiency: a classic example of pharmacogenetics with on-going clinical implications. Br J Haematol. 2014 Feb;164(4):469-80. doi: 10.1111/bjh.12665. Epub 2013 Dec 28. [PubMed:24372186 ]
  2. Aczone® (dapsone) Gel[package insert]. Irvine, California: Allergan, Inc.; 2016. [Link]

PMID: 21945652

Dapsone

By

Dapsone

Product: Cefpirome (sulfate)

Identifier : DBSNPE001246
Drug : DB00250 (Dapsone)
Interacting Gene/Enzyme : Glucose-6-phosphate 1-dehydrogenase
Gene Name : G6PD
UniProt ID : P11413
Defining Change(s) :

  • 1153T->C

Allele Name : Tomah
Genotype(s) : Not Available
Type(s) : ADR Inferred
Groups : G6PD deficiency
Description : Increased risk of hemolysis and hemolytic anemia.
References :

  1. Luzzatto L, Seneca E: G6PD deficiency: a classic example of pharmacogenetics with on-going clinical implications. Br J Haematol. 2014 Feb;164(4):469-80. doi: 10.1111/bjh.12665. Epub 2013 Dec 28. [PubMed:24372186 ]
  2. Aczone® (dapsone) Gel[package insert]. Irvine, California: Allergan, Inc.; 2016. [Link]

PMID: 18827927

Dapsone

By

Dapsone

Product: Leupeptin (hemisulfate)

Identifier : DBSNPE001247
Drug : DB00250 (Dapsone)
Interacting Gene/Enzyme : Glucose-6-phosphate 1-dehydrogenase
Gene Name : G6PD
UniProt ID : P11413
Defining Change(s) :

  • 1154G->T

Allele Name : Lynwood
Genotype(s) : Not Available
Type(s) : ADR Inferred
Groups : G6PD deficiency
Description : Increased risk of hemolysis and hemolytic anemia.
References :

  1. Luzzatto L, Seneca E: G6PD deficiency: a classic example of pharmacogenetics with on-going clinical implications. Br J Haematol. 2014 Feb;164(4):469-80. doi: 10.1111/bjh.12665. Epub 2013 Dec 28. [PubMed:24372186 ]
  2. Aczone® (dapsone) Gel[package insert]. Irvine, California: Allergan, Inc.; 2016. [Link]

PMID: 9517436

Dapsone

By

Dapsone

Product: Litronesib

Identifier : DBSNPE001248
Drug : DB00250 (Dapsone)
Interacting Gene/Enzyme : Glucose-6-phosphate 1-dehydrogenase
Gene Name : G6PD
UniProt ID : P11413
Defining Change(s) :

  • 1155C->G

Allele Name : Madrid
Genotype(s) : Not Available
Type(s) : ADR Inferred
Groups : G6PD deficiency
Description : Increased risk of hemolysis and hemolytic anemia.
References :

  1. Luzzatto L, Seneca E: G6PD deficiency: a classic example of pharmacogenetics with on-going clinical implications. Br J Haematol. 2014 Feb;164(4):469-80. doi: 10.1111/bjh.12665. Epub 2013 Dec 28. [PubMed:24372186 ]
  2. Aczone® (dapsone) Gel[package insert]. Irvine, California: Allergan, Inc.; 2016. [Link]

PMID: 3011168

Dapsone

By

Dapsone

Product: (S)-10-Hydroxycamptothecin

Identifier : DBSNPE001249
Drug : DB00250 (Dapsone)
Interacting Gene/Enzyme : Glucose-6-phosphate 1-dehydrogenase
Gene Name : G6PD
UniProt ID : P11413
Defining Change(s) :

  • 1156A->G

Allele Name : Iowa, Walter Reed, Springfield
Genotype(s) : Not Available
Type(s) : ADR Inferred
Groups : G6PD deficiency
Description : Increased risk of hemolysis and hemolytic anemia.
References :

  1. Luzzatto L, Seneca E: G6PD deficiency: a classic example of pharmacogenetics with on-going clinical implications. Br J Haematol. 2014 Feb;164(4):469-80. doi: 10.1111/bjh.12665. Epub 2013 Dec 28. [PubMed:24372186 ]
  2. Aczone® (dapsone) Gel[package insert]. Irvine, California: Allergan, Inc.; 2016. [Link]

PMID: 25571783

Dapsone

By

Dapsone

Product: AZ-5104

Identifier : DBSNPE001250
Drug : DB00250 (Dapsone)
Interacting Gene/Enzyme : Glucose-6-phosphate 1-dehydrogenase
Gene Name : G6PD
UniProt ID : P11413
Defining Change(s) :

  • 1160G->A

Allele Name : Beverly Hills, Genova, Iwate, Niigata, Yamaguchi
Genotype(s) : Not Available
Type(s) : ADR Inferred
Groups : G6PD deficiency
Description : Increased risk of hemolysis and hemolytic anemia.
References :

  1. Luzzatto L, Seneca E: G6PD deficiency: a classic example of pharmacogenetics with on-going clinical implications. Br J Haematol. 2014 Feb;164(4):469-80. doi: 10.1111/bjh.12665. Epub 2013 Dec 28. [PubMed:24372186 ]
  2. Aczone® (dapsone) Gel[package insert]. Irvine, California: Allergan, Inc.; 2016. [Link]

PMID: 20663957

Dapsone

By

Dapsone

Product: ORM-15341

Identifier : DBSNPE001251
Drug : DB00250 (Dapsone)
Interacting Gene/Enzyme : Glucose-6-phosphate 1-dehydrogenase
Gene Name : G6PD
UniProt ID : P11413
Defining Change(s) :

  • 1162A->G

Allele Name : Hartford
Genotype(s) : Not Available
Type(s) : ADR Inferred
Groups : G6PD deficiency
Description : Increased risk of hemolysis and hemolytic anemia.
References :

  1. Luzzatto L, Seneca E: G6PD deficiency: a classic example of pharmacogenetics with on-going clinical implications. Br J Haematol. 2014 Feb;164(4):469-80. doi: 10.1111/bjh.12665. Epub 2013 Dec 28. [PubMed:24372186 ]
  2. Aczone® (dapsone) Gel[package insert]. Irvine, California: Allergan, Inc.; 2016. [Link]

PMID: 10655521

Dapsone

By

Dapsone

Product: Quetiapine sulfoxide (dihydrochloride)

Identifier : DBSNPE001252
Drug : DB00250 (Dapsone)
Interacting Gene/Enzyme : Glucose-6-phosphate 1-dehydrogenase
Gene Name : G6PD
UniProt ID : P11413
Defining Change(s) :

  • 1166A->G

Allele Name : Praha
Genotype(s) : Not Available
Type(s) : ADR Inferred
Groups : G6PD deficiency
Description : Increased risk of hemolysis and hemolytic anemia.
References :

  1. Luzzatto L, Seneca E: G6PD deficiency: a classic example of pharmacogenetics with on-going clinical implications. Br J Haematol. 2014 Feb;164(4):469-80. doi: 10.1111/bjh.12665. Epub 2013 Dec 28. [PubMed:24372186 ]
  2. Aczone® (dapsone) Gel[package insert]. Irvine, California: Allergan, Inc.; 2016. [Link]

PMID: 2559519

Dapsone

By

Dapsone

Product: Deoxyarbutin

Identifier : DBSNPE001253
Drug : DB00250 (Dapsone)
Interacting Gene/Enzyme : Glucose-6-phosphate 1-dehydrogenase
Gene Name : G6PD
UniProt ID : P11413
Defining Change(s) :

  • 1175T>C

Allele Name : Krakow
Genotype(s) : Not Available
Type(s) : ADR Inferred
Groups : G6PD deficiency
Description : Increased risk of hemolysis and hemolytic anemia.
References :

  1. Luzzatto L, Seneca E: G6PD deficiency: a classic example of pharmacogenetics with on-going clinical implications. Br J Haematol. 2014 Feb;164(4):469-80. doi: 10.1111/bjh.12665. Epub 2013 Dec 28. [PubMed:24372186 ]
  2. Aczone® (dapsone) Gel[package insert]. Irvine, California: Allergan, Inc.; 2016. [Link]

PMID: 3982215

Dapsone

By

Dapsone

Product: AZD6738

Identifier : DBSNPE001254
Drug : DB00250 (Dapsone)
Interacting Gene/Enzyme : Glucose-6-phosphate 1-dehydrogenase
Gene Name : G6PD
UniProt ID : P11413
Defining Change(s) :

  • 1177C->G

Allele Name : Wisconsin
Genotype(s) : Not Available
Type(s) : ADR Inferred
Groups : G6PD deficiency
Description : Increased risk of hemolysis and hemolytic anemia.
References :

  1. Luzzatto L, Seneca E: G6PD deficiency: a classic example of pharmacogenetics with on-going clinical implications. Br J Haematol. 2014 Feb;164(4):469-80. doi: 10.1111/bjh.12665. Epub 2013 Dec 28. [PubMed:24372186 ]
  2. Aczone® (dapsone) Gel[package insert]. Irvine, California: Allergan, Inc.; 2016. [Link]

PMID: 26977767

Dapsone

By

Dapsone

Product: MM-102 (trifluoroacetate)

Identifier : DBSNPE001255
Drug : DB00250 (Dapsone)
Interacting Gene/Enzyme : Glucose-6-phosphate 1-dehydrogenase
Gene Name : G6PD
UniProt ID : P11413
Defining Change(s) :

  • 1178G->A

Allele Name : Nashville, Anaheim, Portici
Genotype(s) : Not Available
Type(s) : ADR Inferred
Groups : G6PD deficiency
Description : Increased risk of hemolysis and hemolytic anemia.
References :

  1. Luzzatto L, Seneca E: G6PD deficiency: a classic example of pharmacogenetics with on-going clinical implications. Br J Haematol. 2014 Feb;164(4):469-80. doi: 10.1111/bjh.12665. Epub 2013 Dec 28. [PubMed:24372186 ]
  2. Aczone® (dapsone) Gel[package insert]. Irvine, California: Allergan, Inc.; 2016. [Link]

PMID: 25852486

Dapsone

By

Dapsone

Product: Moxalactam (sodium salt)

Identifier : DBSNPE001256
Drug : DB00250 (Dapsone)
Interacting Gene/Enzyme : Glucose-6-phosphate 1-dehydrogenase
Gene Name : G6PD
UniProt ID : P11413
Defining Change(s) :

  • 1180G->C

Allele Name : Alhambra
Genotype(s) : Not Available
Type(s) : ADR Inferred
Groups : G6PD deficiency
Description : Increased risk of hemolysis and hemolytic anemia.
References :

  1. Luzzatto L, Seneca E: G6PD deficiency: a classic example of pharmacogenetics with on-going clinical implications. Br J Haematol. 2014 Feb;164(4):469-80. doi: 10.1111/bjh.12665. Epub 2013 Dec 28. [PubMed:24372186 ]
  2. Aczone® (dapsone) Gel[package insert]. Irvine, California: Allergan, Inc.; 2016. [Link]

PMID: 25673831

Dapsone

By

Dapsone

Product: Uramustine

Identifier : DBSNPE001257
Drug : DB00250 (Dapsone)
Interacting Gene/Enzyme : Glucose-6-phosphate 1-dehydrogenase
Gene Name : G6PD
UniProt ID : P11413
Defining Change(s) :

  • 1187C->T

Allele Name : Bari
Genotype(s) : Not Available
Type(s) : ADR Inferred
Groups : G6PD deficiency
Description : Increased risk of hemolysis and hemolytic anemia.
References :

  1. Luzzatto L, Seneca E: G6PD deficiency: a classic example of pharmacogenetics with on-going clinical implications. Br J Haematol. 2014 Feb;164(4):469-80. doi: 10.1111/bjh.12665. Epub 2013 Dec 28. [PubMed:24372186 ]
  2. Aczone® (dapsone) Gel[package insert]. Irvine, California: Allergan, Inc.; 2016. [Link]

PMID: 25609622

Dapsone

By

Dapsone

Product: Epiandrosterone

Identifier : DBSNPE001258
Drug : DB00250 (Dapsone)
Interacting Gene/Enzyme : Glucose-6-phosphate 1-dehydrogenase
Gene Name : G6PD
UniProt ID : P11413
Defining Change(s) :

  • 1192G->A

Allele Name : Puerto Limon
Genotype(s) : Not Available
Type(s) : ADR Inferred
Groups : G6PD deficiency
Description : Increased risk of hemolysis and hemolytic anemia.
References :

  1. Luzzatto L, Seneca E: G6PD deficiency: a classic example of pharmacogenetics with on-going clinical implications. Br J Haematol. 2014 Feb;164(4):469-80. doi: 10.1111/bjh.12665. Epub 2013 Dec 28. [PubMed:24372186 ]
  2. Aczone® (dapsone) Gel[package insert]. Irvine, California: Allergan, Inc.; 2016. [Link]

PMID: 26052670

Dapsone

By

Dapsone

Product: Cortodoxone

Identifier : DBSNPE001259
Drug : DB00250 (Dapsone)
Interacting Gene/Enzyme : Glucose-6-phosphate 1-dehydrogenase
Gene Name : G6PD
UniProt ID : P11413
Defining Change(s) :

  • 1205C>A

Allele Name : Covao do Lobo
Genotype(s) : Not Available
Type(s) : ADR Inferred
Groups : G6PD deficiency
Description : Increased risk of hemolysis and hemolytic anemia.
References :

  1. Luzzatto L, Seneca E: G6PD deficiency: a classic example of pharmacogenetics with on-going clinical implications. Br J Haematol. 2014 Feb;164(4):469-80. doi: 10.1111/bjh.12665. Epub 2013 Dec 28. [PubMed:24372186 ]
  2. Aczone® (dapsone) Gel[package insert]. Irvine, California: Allergan, Inc.; 2016. [Link]

PMID: 26174503

Dapsone

By

Dapsone

Product: Akt1 and Akt2-IN-1

Identifier : DBSNPE001260
Drug : DB00250 (Dapsone)
Interacting Gene/Enzyme : Glucose-6-phosphate 1-dehydrogenase
Gene Name : G6PD
UniProt ID : P11413
Defining Change(s) :

  • 1215G->A

Allele Name : Clinic
Genotype(s) : Not Available
Type(s) : ADR Inferred
Groups : G6PD deficiency
Description : Increased risk of hemolysis and hemolytic anemia.
References :

  1. Luzzatto L, Seneca E: G6PD deficiency: a classic example of pharmacogenetics with on-going clinical implications. Br J Haematol. 2014 Feb;164(4):469-80. doi: 10.1111/bjh.12665. Epub 2013 Dec 28. [PubMed:24372186 ]
  2. Aczone® (dapsone) Gel[package insert]. Irvine, California: Allergan, Inc.; 2016. [Link]

PMID: 26494028

Dapsone

By

Dapsone

Product: Terbutryn

Identifier : DBSNPE001261
Drug : DB00250 (Dapsone)
Interacting Gene/Enzyme : Glucose-6-phosphate 1-dehydrogenase
Gene Name : G6PD
UniProt ID : P11413
Defining Change(s) :

  • 1225C->T

Allele Name : Udivecht
Genotype(s) : Not Available
Type(s) : ADR Inferred
Groups : G6PD deficiency
Description : Increased risk of hemolysis and hemolytic anemia.
References :

  1. Luzzatto L, Seneca E: G6PD deficiency: a classic example of pharmacogenetics with on-going clinical implications. Br J Haematol. 2014 Feb;164(4):469-80. doi: 10.1111/bjh.12665. Epub 2013 Dec 28. [PubMed:24372186 ]
  2. Aczone® (dapsone) Gel[package insert]. Irvine, California: Allergan, Inc.; 2016. [Link]

PMID: 24987341

Dapsone

By

Dapsone

Product: Terbuthylazine

Identifier : DBSNPE001262
Drug : DB00250 (Dapsone)
Interacting Gene/Enzyme : Glucose-6-phosphate 1-dehydrogenase
Gene Name : G6PD
UniProt ID : P11413
Defining Change(s) :

  • 1226C->G

Allele Name : Suwalki
Genotype(s) : Not Available
Type(s) : ADR Inferred
Groups : G6PD deficiency
Description : Increased risk of hemolysis and hemolytic anemia.
References :

  1. Luzzatto L, Seneca E: G6PD deficiency: a classic example of pharmacogenetics with on-going clinical implications. Br J Haematol. 2014 Feb;164(4):469-80. doi: 10.1111/bjh.12665. Epub 2013 Dec 28. [PubMed:24372186 ]
  2. Aczone® (dapsone) Gel[package insert]. Irvine, California: Allergan, Inc.; 2016. [Link]

PMID: 24574959

Dapsone

By

Dapsone

Product: L-SelenoMethionine

Identifier : DBSNPE001263
Drug : DB00250 (Dapsone)
Interacting Gene/Enzyme : Glucose-6-phosphate 1-dehydrogenase
Gene Name : G6PD
UniProt ID : P11413
Defining Change(s) :

  • 1228G->T

Allele Name : Riverside
Genotype(s) : Not Available
Type(s) : ADR Inferred
Groups : G6PD deficiency
Description : Increased risk of hemolysis and hemolytic anemia.
References :

  1. Luzzatto L, Seneca E: G6PD deficiency: a classic example of pharmacogenetics with on-going clinical implications. Br J Haematol. 2014 Feb;164(4):469-80. doi: 10.1111/bjh.12665. Epub 2013 Dec 28. [PubMed:24372186 ]
  2. Aczone® (dapsone) Gel[package insert]. Irvine, California: Allergan, Inc.; 2016. [Link]

PMID: 23506325

Dapsone

By

Dapsone

Product: HA130

Identifier : DBSNPE001264
Drug : DB00250 (Dapsone)
Interacting Gene/Enzyme : Glucose-6-phosphate 1-dehydrogenase
Gene Name : G6PD
UniProt ID : P11413
Defining Change(s) :

  • 1229G->A

Allele Name : Japan, Shinagawa
Genotype(s) : Not Available
Type(s) : ADR Inferred
Groups : G6PD deficiency
Description : Increased risk of hemolysis and hemolytic anemia.
References :

  1. Luzzatto L, Seneca E: G6PD deficiency: a classic example of pharmacogenetics with on-going clinical implications. Br J Haematol. 2014 Feb;164(4):469-80. doi: 10.1111/bjh.12665. Epub 2013 Dec 28. [PubMed:24372186 ]
  2. Aczone® (dapsone) Gel[package insert]. Irvine, California: Allergan, Inc.; 2016. [Link]

PMID: 22752655

Dapsone

By

Dapsone

Product: CEP-28122

Identifier : DBSNPE001265
Drug : DB00250 (Dapsone)
Interacting Gene/Enzyme : Glucose-6-phosphate 1-dehydrogenase
Gene Name : G6PD
UniProt ID : P11413
Defining Change(s) :

  • 1229G->C

Allele Name : Kawasaki
Genotype(s) : Not Available
Type(s) : ADR Inferred
Groups : G6PD deficiency
Description : Increased risk of hemolysis and hemolytic anemia.
References :

  1. Luzzatto L, Seneca E: G6PD deficiency: a classic example of pharmacogenetics with on-going clinical implications. Br J Haematol. 2014 Feb;164(4):469-80. doi: 10.1111/bjh.12665. Epub 2013 Dec 28. [PubMed:24372186 ]
  2. Aczone® (dapsone) Gel[package insert]. Irvine, California: Allergan, Inc.; 2016. [Link]

PMID: 23055494

Dapsone

By

Dapsone

Product: CEP-28122 (mesylate salt)

Identifier : DBSNPE001266
Drug : DB00250 (Dapsone)
Interacting Gene/Enzyme : Glucose-6-phosphate 1-dehydrogenase
Gene Name : G6PD
UniProt ID : P11413
Defining Change(s) :

  • 1231A->G

Allele Name : Munich
Genotype(s) : Not Available
Type(s) : ADR Inferred
Groups : G6PD deficiency
Description : Increased risk of hemolysis and hemolytic anemia.
References :

  1. Luzzatto L, Seneca E: G6PD deficiency: a classic example of pharmacogenetics with on-going clinical implications. Br J Haematol. 2014 Feb;164(4):469-80. doi: 10.1111/bjh.12665. Epub 2013 Dec 28. [PubMed:24372186 ]
  2. Aczone® (dapsone) Gel[package insert]. Irvine, California: Allergan, Inc.; 2016. [Link]

PMID: 21304962

Dapsone

By

Dapsone

Product: ODM-201

Identifier : DBSNPE001267
Drug : DB00250 (Dapsone)
Interacting Gene/Enzyme : Glucose-6-phosphate 1-dehydrogenase
Gene Name : G6PD
UniProt ID : P11413
Defining Change(s) :

  • 1284C->A

Allele Name : Georgia
Genotype(s) : Not Available
Type(s) : ADR Inferred
Groups : G6PD deficiency
Description : Increased risk of hemolysis and hemolytic anemia.
References :

  1. Luzzatto L, Seneca E: G6PD deficiency: a classic example of pharmacogenetics with on-going clinical implications. Br J Haematol. 2014 Feb;164(4):469-80. doi: 10.1111/bjh.12665. Epub 2013 Dec 28. [PubMed:24372186 ]
  2. Aczone® (dapsone) Gel[package insert]. Irvine, California: Allergan, Inc.; 2016. [Link]

PMID: 20933261

Dapsone

By

Dapsone

Product: Yohimbine

Identifier : DBSNPE001268
Drug : DB00250 (Dapsone)
Interacting Gene/Enzyme : Glucose-6-phosphate 1-dehydrogenase
Gene Name : G6PD
UniProt ID : P11413
Defining Change(s) :

  • 1292T->G

Allele Name : Sumare
Genotype(s) : Not Available
Type(s) : ADR Inferred
Groups : G6PD deficiency
Description : Increased risk of hemolysis and hemolytic anemia.
References :

  1. Luzzatto L, Seneca E: G6PD deficiency: a classic example of pharmacogenetics with on-going clinical implications. Br J Haematol. 2014 Feb;164(4):469-80. doi: 10.1111/bjh.12665. Epub 2013 Dec 28. [PubMed:24372186 ]
  2. Aczone® (dapsone) Gel[package insert]. Irvine, California: Allergan, Inc.; 2016. [Link]

PMID: 19258455

Dapsone

By

Dapsone

Product: Fmoc-Val-Cit-PAB-PNP

Identifier : DBSNPE001269
Drug : DB00250 (Dapsone)
Interacting Gene/Enzyme : Glucose-6-phosphate 1-dehydrogenase
Gene Name : G6PD
UniProt ID : P11413
Defining Change(s) :

  • 1318C->T

Allele Name : Telti/Kobe
Genotype(s) : Not Available
Type(s) : ADR Inferred
Groups : G6PD deficiency
Description : Increased risk of hemolysis and hemolytic anemia.
References :

  1. Luzzatto L, Seneca E: G6PD deficiency: a classic example of pharmacogenetics with on-going clinical implications. Br J Haematol. 2014 Feb;164(4):469-80. doi: 10.1111/bjh.12665. Epub 2013 Dec 28. [PubMed:24372186 ]
  2. Aczone® (dapsone) Gel[package insert]. Irvine, California: Allergan, Inc.; 2016. [Link]

PMID: 16427017

Dapsone

By

Dapsone

Product: Val-cit-PAB-OH

Identifier : DBSNPE001270
Drug : DB00250 (Dapsone)
Interacting Gene/Enzyme : Glucose-6-phosphate 1-dehydrogenase
Gene Name : G6PD
UniProt ID : P11413
Defining Change(s) :

  • 1339G->A

Allele Name : Santiago de Cuba, Morioka
Genotype(s) : Not Available
Type(s) : ADR Inferred
Groups : G6PD deficiency
Description : Increased risk of hemolysis and hemolytic anemia.
References :

  1. Luzzatto L, Seneca E: G6PD deficiency: a classic example of pharmacogenetics with on-going clinical implications. Br J Haematol. 2014 Feb;164(4):469-80. doi: 10.1111/bjh.12665. Epub 2013 Dec 28. [PubMed:24372186 ]
  2. Aczone® (dapsone) Gel[package insert]. Irvine, California: Allergan, Inc.; 2016. [Link]

PMID: 15659595

Dapsone

By

Dapsone

Product: Fmoc-Val-Cit-PAB

Identifier : DBSNPE001271
Drug : DB00250 (Dapsone)
Interacting Gene/Enzyme : Glucose-6-phosphate 1-dehydrogenase
Gene Name : G6PD
UniProt ID : P11413
Defining Change(s) :

  • 1358T->A

Allele Name : Harima
Genotype(s) : Not Available
Type(s) : ADR Inferred
Groups : G6PD deficiency
Description : Increased risk of hemolysis and hemolytic anemia.
References :

  1. Luzzatto L, Seneca E: G6PD deficiency: a classic example of pharmacogenetics with on-going clinical implications. Br J Haematol. 2014 Feb;164(4):469-80. doi: 10.1111/bjh.12665. Epub 2013 Dec 28. [PubMed:24372186 ]
  2. Aczone® (dapsone) Gel[package insert]. Irvine, California: Allergan, Inc.; 2016. [Link]

PMID: 16183639

Dapsone

By

Dapsone

Product: Ca2+ channel agonist 1

Identifier : DBSNPE001272
Drug : DB00250 (Dapsone)
Interacting Gene/Enzyme : Glucose-6-phosphate 1-dehydrogenase
Gene Name : G6PD
UniProt ID : P11413
Defining Change(s) :

  • 1366G->C

Allele Name : Figuera da Foz
Genotype(s) : Not Available
Type(s) : ADR Inferred
Groups : G6PD deficiency
Description : Increased risk of hemolysis and hemolytic anemia.
References :

  1. Luzzatto L, Seneca E: G6PD deficiency: a classic example of pharmacogenetics with on-going clinical implications. Br J Haematol. 2014 Feb;164(4):469-80. doi: 10.1111/bjh.12665. Epub 2013 Dec 28. [PubMed:24372186 ]
  2. Aczone® (dapsone) Gel[package insert]. Irvine, California: Allergan, Inc.; 2016. [Link]

PMID: 10391452

Dapsone

By

Dapsone

Product: Carbosulfan

Identifier : DBSNPE001273
Drug : DB00250 (Dapsone)
Interacting Gene/Enzyme : Glucose-6-phosphate 1-dehydrogenase
Gene Name : G6PD
UniProt ID : P11413
Defining Change(s) :

  • 1367A>T

Allele Name : Amiens
Genotype(s) : Not Available
Type(s) : ADR Inferred
Groups : G6PD deficiency
Description : Increased risk of hemolysis and hemolytic anemia.
References :

  1. Luzzatto L, Seneca E: G6PD deficiency: a classic example of pharmacogenetics with on-going clinical implications. Br J Haematol. 2014 Feb;164(4):469-80. doi: 10.1111/bjh.12665. Epub 2013 Dec 28. [PubMed:24372186 ]
  2. Aczone® (dapsone) Gel[package insert]. Irvine, California: Allergan, Inc.; 2016. [Link]

PMID: 10347239

Dapsone

By

Dapsone

Product: Emamectin (Benzoate)

Identifier : DBSNPE001274
Drug : DB00250 (Dapsone)
Interacting Gene/Enzyme : Glucose-6-phosphate 1-dehydrogenase
Gene Name : G6PD
UniProt ID : P11413
Defining Change(s) :

  • 1376G->T, 1502T->G

Allele Name : Bangkok Noi
Genotype(s) : Not Available
Type(s) : ADR Inferred
Groups : G6PD deficiency
Description : Increased risk of hemolysis and hemolytic anemia.
References :

  1. Luzzatto L, Seneca E: G6PD deficiency: a classic example of pharmacogenetics with on-going clinical implications. Br J Haematol. 2014 Feb;164(4):469-80. doi: 10.1111/bjh.12665. Epub 2013 Dec 28. [PubMed:24372186 ]
  2. Aczone® (dapsone) Gel[package insert]. Irvine, California: Allergan, Inc.; 2016. [Link]

PMID: 20355712

Dapsone

By

Dapsone

Product: Dinotefuran

Identifier : DBSNPE001275
Drug : DB00250 (Dapsone)
Interacting Gene/Enzyme : Glucose-6-phosphate 1-dehydrogenase
Gene Name : G6PD
UniProt ID : P11413
Defining Change(s) :

  • 1462G->A

Allele Name : Fukaya
Genotype(s) : Not Available
Type(s) : ADR Inferred
Groups : G6PD deficiency
Description : Increased risk of hemolysis and hemolytic anemia.
References :

  1. Luzzatto L, Seneca E: G6PD deficiency: a classic example of pharmacogenetics with on-going clinical implications. Br J Haematol. 2014 Feb;164(4):469-80. doi: 10.1111/bjh.12665. Epub 2013 Dec 28. [PubMed:24372186 ]
  2. Aczone® (dapsone) Gel[package insert]. Irvine, California: Allergan, Inc.; 2016. [Link]

PMID: 26755241

Dapsone

By

Dapsone

Product: Spirodiclofen

Identifier : DBSNPE001276
Drug : DB00250 (Dapsone)
Interacting Gene/Enzyme : Glucose-6-phosphate 1-dehydrogenase
Gene Name : G6PD
UniProt ID : P11413
Defining Change(s) :

  • 1463G->T

Allele Name : Campinas
Genotype(s) : Not Available
Type(s) : ADR Inferred
Groups : G6PD deficiency
Description : Increased risk of hemolysis and hemolytic anemia.
References :

  1. Luzzatto L, Seneca E: G6PD deficiency: a classic example of pharmacogenetics with on-going clinical implications. Br J Haematol. 2014 Feb;164(4):469-80. doi: 10.1111/bjh.12665. Epub 2013 Dec 28. [PubMed:24372186 ]
  2. Aczone® (dapsone) Gel[package insert]. Irvine, California: Allergan, Inc.; 2016. [Link]

PMID: 9886084

Dapsone

By

Dapsone

Product: Avibactam (sodium hydrate)

Identifier : DBSNPE001277
Drug : DB00250 (Dapsone)
Interacting Gene/Enzyme : Glucose-6-phosphate 1-dehydrogenase
Gene Name : G6PD
UniProt ID : P11413
Defining Change(s) :

  • 1465C>T

Allele Name : Buenos Aires
Genotype(s) : Not Available
Type(s) : ADR Inferred
Groups : G6PD deficiency
Description : Increased risk of hemolysis and hemolytic anemia.
References :

  1. Luzzatto L, Seneca E: G6PD deficiency: a classic example of pharmacogenetics with on-going clinical implications. Br J Haematol. 2014 Feb;164(4):469-80. doi: 10.1111/bjh.12665. Epub 2013 Dec 28. [PubMed:24372186 ]
  2. Aczone® (dapsone) Gel[package insert]. Irvine, California: Allergan, Inc.; 2016. [Link]

PMID: 7582470

Dapsone

By

Dapsone

Product: PX-478

Identifier : DBSNPE001278
Drug : DB00250 (Dapsone)
Interacting Gene/Enzyme : Glucose-6-phosphate 1-dehydrogenase
Gene Name : G6PD
UniProt ID : P11413
Defining Change(s) :

  • 1466C->T

Allele Name : Arakawa
Genotype(s) : Not Available
Type(s) : ADR Inferred
Groups : G6PD deficiency
Description : Increased risk of hemolysis and hemolytic anemia.
References :

  1. Luzzatto L, Seneca E: G6PD deficiency: a classic example of pharmacogenetics with on-going clinical implications. Br J Haematol. 2014 Feb;164(4):469-80. doi: 10.1111/bjh.12665. Epub 2013 Dec 28. [PubMed:24372186 ]
  2. Aczone® (dapsone) Gel[package insert]. Irvine, California: Allergan, Inc.; 2016. [Link]

PMID: 1317428

Dapsone

By

Dapsone

Product: Tranylcypromine (hemisulfate)

Identifier : DBSNPE001279
Drug : DB00250 (Dapsone)
Interacting Gene/Enzyme : Glucose-6-phosphate 1-dehydrogenase
Gene Name : G6PD
UniProt ID : P11413
Defining Change(s) :

  • 1488_1490delGAA

Allele Name : Brighton
Genotype(s) : Not Available
Type(s) : ADR Inferred
Groups : G6PD deficiency
Description : Increased risk of hemolysis and hemolytic anemia.
References :

  1. Luzzatto L, Seneca E: G6PD deficiency: a classic example of pharmacogenetics with on-going clinical implications. Br J Haematol. 2014 Feb;164(4):469-80. doi: 10.1111/bjh.12665. Epub 2013 Dec 28. [PubMed:24372186 ]
  2. Aczone® (dapsone) Gel[package insert]. Irvine, California: Allergan, Inc.; 2016. [Link]

PMID: 26171253

Dapsone

By

Dapsone

Product: Tolmetin (sodium dihydrate)

Identifier : DBSNPE001280
Drug : DB00250 (Dapsone)
Interacting Gene/Enzyme : Glucose-6-phosphate 1-dehydrogenase
Gene Name : G6PD
UniProt ID : P11413
Defining Change(s) :

  • 159G->C

Allele Name : Kozukata
Genotype(s) : Not Available
Type(s) : ADR Inferred
Groups : G6PD deficiency
Description : Increased risk of hemolysis and hemolytic anemia.
References :

  1. Luzzatto L, Seneca E: G6PD deficiency: a classic example of pharmacogenetics with on-going clinical implications. Br J Haematol. 2014 Feb;164(4):469-80. doi: 10.1111/bjh.12665. Epub 2013 Dec 28. [PubMed:24372186 ]
  2. Aczone® (dapsone) Gel[package insert]. Irvine, California: Allergan, Inc.; 2016. [Link]

PMID: 26416972

Dapsone

By

Dapsone

Product: Deoxycorticosterone (acetate)

Identifier : DBSNPE001281
Drug : DB00250 (Dapsone)
Interacting Gene/Enzyme : Glucose-6-phosphate 1-dehydrogenase
Gene Name : G6PD
UniProt ID : P11413
Defining Change(s) :

  • 180_182delTCT

Allele Name : Amsterdam
Genotype(s) : Not Available
Type(s) : ADR Inferred
Groups : G6PD deficiency
Description : Increased risk of hemolysis and hemolytic anemia.
References :

  1. Luzzatto L, Seneca E: G6PD deficiency: a classic example of pharmacogenetics with on-going clinical implications. Br J Haematol. 2014 Feb;164(4):469-80. doi: 10.1111/bjh.12665. Epub 2013 Dec 28. [PubMed:24372186 ]
  2. Aczone® (dapsone) Gel[package insert]. Irvine, California: Allergan, Inc.; 2016. [Link]

PMID: 24899721

Dapsone

By

Dapsone

Product: Azaperone

Identifier : DBSNPE001282
Drug : DB00250 (Dapsone)
Interacting Gene/Enzyme : Glucose-6-phosphate 1-dehydrogenase
Gene Name : G6PD
UniProt ID : P11413
Defining Change(s) :

  • 202G->A, 376A->G, 1264C>G

Allele Name : No name
Genotype(s) : Not Available
Type(s) : ADR Inferred
Groups : G6PD deficiency
Description : Increased risk of hemolysis and hemolytic anemia.
References :

  1. Luzzatto L, Seneca E: G6PD deficiency: a classic example of pharmacogenetics with on-going clinical implications. Br J Haematol. 2014 Feb;164(4):469-80. doi: 10.1111/bjh.12665. Epub 2013 Dec 28. [PubMed:24372186 ]
  2. Aczone® (dapsone) Gel[package insert]. Irvine, California: Allergan, Inc.; 2016. [Link]

PMID: 25134715

Dapsone

By

Dapsone

Product: Isosorbide

Identifier : DBSNPE001283
Drug : DB00250 (Dapsone)
Interacting Gene/Enzyme : Glucose-6-phosphate 1-dehydrogenase
Gene Name : G6PD
UniProt ID : P11413
Defining Change(s) :

  • 224T->C

Allele Name : Swansea
Genotype(s) : Not Available
Type(s) : ADR Inferred
Groups : G6PD deficiency
Description : Increased risk of hemolysis and hemolytic anemia.
References :

  1. Luzzatto L, Seneca E: G6PD deficiency: a classic example of pharmacogenetics with on-going clinical implications. Br J Haematol. 2014 Feb;164(4):469-80. doi: 10.1111/bjh.12665. Epub 2013 Dec 28. [PubMed:24372186 ]
  2. Aczone® (dapsone) Gel[package insert]. Irvine, California: Allergan, Inc.; 2016. [Link]

PMID: 24118191

Dapsone

By

Dapsone

Product: Domiphen (bromide)

Identifier : DBSNPE001284
Drug : DB00250 (Dapsone)
Interacting Gene/Enzyme : Glucose-6-phosphate 1-dehydrogenase
Gene Name : G6PD
UniProt ID : P11413
Defining Change(s) :

  • 281_283delAGA

Allele Name : Urayasu
Genotype(s) : Not Available
Type(s) : ADR Inferred
Groups : G6PD deficiency
Description : Increased risk of hemolysis and hemolytic anemia.
References :

  1. Luzzatto L, Seneca E: G6PD deficiency: a classic example of pharmacogenetics with on-going clinical implications. Br J Haematol. 2014 Feb;164(4):469-80. doi: 10.1111/bjh.12665. Epub 2013 Dec 28. [PubMed:24372186 ]
  2. Aczone® (dapsone) Gel[package insert]. Irvine, California: Allergan, Inc.; 2016. [Link]

PMID: 24559677

Dapsone

By

Dapsone

Product: Chlorzoxazone

Identifier : DBSNPE001285
Drug : DB00250 (Dapsone)
Interacting Gene/Enzyme : Glucose-6-phosphate 1-dehydrogenase
Gene Name : G6PD
UniProt ID : P11413
Defining Change(s) :

  • 317C->G544C->T592C->T

Allele Name : Vancouver
Genotype(s) : Not Available
Type(s) : ADR Inferred
Groups : G6PD deficiency
Description : Increased risk of hemolysis and hemolytic anemia.
References :

  1. Luzzatto L, Seneca E: G6PD deficiency: a classic example of pharmacogenetics with on-going clinical implications. Br J Haematol. 2014 Feb;164(4):469-80. doi: 10.1111/bjh.12665. Epub 2013 Dec 28. [PubMed:24372186 ]
  2. Aczone® (dapsone) Gel[package insert]. Irvine, California: Allergan, Inc.; 2016. [Link]

PMID: 23303956

Dapsone

By

Dapsone

Product: Levobetaxolol (hydrochloride)

Identifier : DBSNPE001286
Drug : DB00250 (Dapsone)
Interacting Gene/Enzyme : Glucose-6-phosphate 1-dehydrogenase
Gene Name : G6PD
UniProt ID : P11413
Defining Change(s) :

  • 376A->G, 1159C->T

Allele Name : Mt Sinai
Genotype(s) : Not Available
Type(s) : ADR Inferred
Groups : G6PD deficiency
Description : Increased risk of hemolysis and hemolytic anemia.
References :

  1. Luzzatto L, Seneca E: G6PD deficiency: a classic example of pharmacogenetics with on-going clinical implications. Br J Haematol. 2014 Feb;164(4):469-80. doi: 10.1111/bjh.12665. Epub 2013 Dec 28. [PubMed:24372186 ]
  2. Aczone® (dapsone) Gel[package insert]. Irvine, California: Allergan, Inc.; 2016. [Link]

PMID: 23897824

Dapsone

By

Dapsone

Product: Uridin

Identifier : DBSNPE001287
Drug : DB00250 (Dapsone)
Interacting Gene/Enzyme : Glucose-6-phosphate 1-dehydrogenase
Gene Name : G6PD
UniProt ID : P11413
Defining Change(s) :

  • 488G->A

Allele Name : Plymouth
Genotype(s) : Not Available
Type(s) : ADR Inferred
Groups : G6PD deficiency
Description : Increased risk of hemolysis and hemolytic anemia.
References :

  1. Luzzatto L, Seneca E: G6PD deficiency: a classic example of pharmacogenetics with on-going clinical implications. Br J Haematol. 2014 Feb;164(4):469-80. doi: 10.1111/bjh.12665. Epub 2013 Dec 28. [PubMed:24372186 ]
  2. Aczone® (dapsone) Gel[package insert]. Irvine, California: Allergan, Inc.; 2016. [Link]

PMID: 23049481

Dapsone

By

Dapsone

Product: Benidipine (hydrochloride)

Identifier : DBSNPE001288
Drug : DB00250 (Dapsone)
Interacting Gene/Enzyme : Glucose-6-phosphate 1-dehydrogenase
Gene Name : G6PD
UniProt ID : P11413
Defining Change(s) :

  • 514C->T

Allele Name : Volendam
Genotype(s) : Not Available
Type(s) : ADR Inferred
Groups : G6PD deficiency
Description : Increased risk of hemolysis and hemolytic anemia.
References :

  1. Luzzatto L, Seneca E: G6PD deficiency: a classic example of pharmacogenetics with on-going clinical implications. Br J Haematol. 2014 Feb;164(4):469-80. doi: 10.1111/bjh.12665. Epub 2013 Dec 28. [PubMed:24372186 ]
  2. Aczone® (dapsone) Gel[package insert]. Irvine, California: Allergan, Inc.; 2016. [Link]

PMID: 22745478

Dapsone

By

Dapsone

Product: Isoconazole (nitrate)

Identifier : DBSNPE001289
Drug : DB00250 (Dapsone)
Interacting Gene/Enzyme : Glucose-6-phosphate 1-dehydrogenase
Gene Name : G6PD
UniProt ID : P11413
Defining Change(s) :

  • 527A->G

Allele Name : Shinshu
Genotype(s) : Not Available
Type(s) : ADR Inferred
Groups : G6PD deficiency
Description : Increased risk of hemolysis and hemolytic anemia.
References :

  1. Luzzatto L, Seneca E: G6PD deficiency: a classic example of pharmacogenetics with on-going clinical implications. Br J Haematol. 2014 Feb;164(4):469-80. doi: 10.1111/bjh.12665. Epub 2013 Dec 28. [PubMed:24372186 ]
  2. Aczone® (dapsone) Gel[package insert]. Irvine, California: Allergan, Inc.; 2016. [Link]

PMID: 22723692

Dapsone

By

Dapsone

Product: D-Pantothenic acid (sodium)

Identifier : DBSNPE001290
Drug : DB00250 (Dapsone)
Interacting Gene/Enzyme : Glucose-6-phosphate 1-dehydrogenase
Gene Name : G6PD
UniProt ID : P11413
Defining Change(s) :

  • 535A->T

Allele Name : Chikugo
Genotype(s) : Not Available
Type(s) : ADR Inferred
Groups : G6PD deficiency
Description : Increased risk of hemolysis and hemolytic anemia.
References :

  1. Luzzatto L, Seneca E: G6PD deficiency: a classic example of pharmacogenetics with on-going clinical implications. Br J Haematol. 2014 Feb;164(4):469-80. doi: 10.1111/bjh.12665. Epub 2013 Dec 28. [PubMed:24372186 ]
  2. Aczone® (dapsone) Gel[package insert]. Irvine, California: Allergan, Inc.; 2016. [Link]

PMID: 22505720

Dapsone

By

Dapsone

Product: ACY-738

Identifier : DBSNPE001291
Drug : DB00250 (Dapsone)
Interacting Gene/Enzyme : Glucose-6-phosphate 1-dehydrogenase
Gene Name : G6PD
UniProt ID : P11413
Defining Change(s) :

  • 561_563delCTC

Allele Name : Tsukui
Genotype(s) : Not Available
Type(s) : ADR Inferred
Groups : G6PD deficiency
Description : Increased risk of hemolysis and hemolytic anemia.
References :

  1. Luzzatto L, Seneca E: G6PD deficiency: a classic example of pharmacogenetics with on-going clinical implications. Br J Haematol. 2014 Feb;164(4):469-80. doi: 10.1111/bjh.12665. Epub 2013 Dec 28. [PubMed:24372186 ]
  2. Aczone® (dapsone) Gel[package insert]. Irvine, California: Allergan, Inc.; 2016. [Link]

PMID: 23111145

Dapsone

By

Dapsone

Product: ETC-159

Identifier : DBSNPE001292
Drug : DB00250 (Dapsone)
Interacting Gene/Enzyme : Glucose-6-phosphate 1-dehydrogenase
Gene Name : G6PD
UniProt ID : P11413
Defining Change(s) :

  • 573C>G

Allele Name : Pedoplis-Ckaro
Genotype(s) : Not Available
Type(s) : ADR Inferred
Groups : G6PD deficiency
Description : Increased risk of hemolysis and hemolytic anemia.
References :

  1. Luzzatto L, Seneca E: G6PD deficiency: a classic example of pharmacogenetics with on-going clinical implications. Br J Haematol. 2014 Feb;164(4):469-80. doi: 10.1111/bjh.12665. Epub 2013 Dec 28. [PubMed:24372186 ]
  2. Aczone® (dapsone) Gel[package insert]. Irvine, California: Allergan, Inc.; 2016. [Link]

PMID: 21994388

Dapsone

By

Dapsone

Product: NSC305787

Identifier : DBSNPE001293
Drug : DB00250 (Dapsone)
Interacting Gene/Enzyme : Glucose-6-phosphate 1-dehydrogenase
Gene Name : G6PD
UniProt ID : P11413
Defining Change(s) :

  • 593G->C

Allele Name : Santiago
Genotype(s) : Not Available
Type(s) : ADR Inferred
Groups : G6PD deficiency
Description : Increased risk of hemolysis and hemolytic anemia.
References :

  1. Luzzatto L, Seneca E: G6PD deficiency: a classic example of pharmacogenetics with on-going clinical implications. Br J Haematol. 2014 Feb;164(4):469-80. doi: 10.1111/bjh.12665. Epub 2013 Dec 28. [PubMed:24372186 ]
  2. Aczone® (dapsone) Gel[package insert]. Irvine, California: Allergan, Inc.; 2016. [Link]

PMID: 21857658

Dapsone

By

Dapsone

Product: NU6300

Identifier : DBSNPE001294
Drug : DB00250 (Dapsone)
Interacting Gene/Enzyme : Glucose-6-phosphate 1-dehydrogenase
Gene Name : G6PD
UniProt ID : P11413
Defining Change(s) :

  • 637G->T

Allele Name : Minnesota, Marion, Gastonia, LeJeune
Genotype(s) : Not Available
Type(s) : ADR Inferred
Groups : G6PD deficiency
Description : Increased risk of hemolysis and hemolytic anemia.
References :

  1. Luzzatto L, Seneca E: G6PD deficiency: a classic example of pharmacogenetics with on-going clinical implications. Br J Haematol. 2014 Feb;164(4):469-80. doi: 10.1111/bjh.12665. Epub 2013 Dec 28. [PubMed:24372186 ]
  2. Aczone® (dapsone) Gel[package insert]. Irvine, California: Allergan, Inc.; 2016. [Link]

PMID: 20133656

Dapsone

By

Dapsone

Product: PAK4-IN-1

Identifier : DBSNPE001295
Drug : DB00250 (Dapsone)
Interacting Gene/Enzyme : Glucose-6-phosphate 1-dehydrogenase
Gene Name : G6PD
UniProt ID : P11413
Defining Change(s) :

  • 637G->T, 1037A->T

Allele Name : Cincinnati
Genotype(s) : Not Available
Type(s) : ADR Inferred
Groups : G6PD deficiency
Description : Increased risk of hemolysis and hemolytic anemia.
References :

  1. Luzzatto L, Seneca E: G6PD deficiency: a classic example of pharmacogenetics with on-going clinical implications. Br J Haematol. 2014 Feb;164(4):469-80. doi: 10.1111/bjh.12665. Epub 2013 Dec 28. [PubMed:24372186 ]
  2. Aczone® (dapsone) Gel[package insert]. Irvine, California: Allergan, Inc.; 2016. [Link]

PMID: 20085645

Dapsone

By

Dapsone

Product: CB1-IN-1

Identifier : DBSNPE001296
Drug : DB00250 (Dapsone)
Interacting Gene/Enzyme : Glucose-6-phosphate 1-dehydrogenase
Gene Name : G6PD
UniProt ID : P11413
Defining Change(s) :

  • 648T->G

Allele Name : Harilaou
Genotype(s) : Not Available
Type(s) : ADR Inferred
Groups : G6PD deficiency
Description : Increased risk of hemolysis and hemolytic anemia.
References :

  1. Luzzatto L, Seneca E: G6PD deficiency: a classic example of pharmacogenetics with on-going clinical implications. Br J Haematol. 2014 Feb;164(4):469-80. doi: 10.1111/bjh.12665. Epub 2013 Dec 28. [PubMed:24372186 ]
  2. Aczone® (dapsone) Gel[package insert]. Irvine, California: Allergan, Inc.; 2016. [Link]

PMID: 19357231

Dapsone

By

Dapsone

Product: A-1210477

Identifier : DBSNPE001297
Drug : DB00250 (Dapsone)
Interacting Gene/Enzyme : Glucose-6-phosphate 1-dehydrogenase
Gene Name : G6PD
UniProt ID : P11413
Defining Change(s) :

  • 683_685delACA

Allele Name : North Dallas
Genotype(s) : Not Available
Type(s) : ADR Inferred
Groups : G6PD deficiency
Description : Increased risk of hemolysis and hemolytic anemia.
References :

  1. Luzzatto L, Seneca E: G6PD deficiency: a classic example of pharmacogenetics with on-going clinical implications. Br J Haematol. 2014 Feb;164(4):469-80. doi: 10.1111/bjh.12665. Epub 2013 Dec 28. [PubMed:24372186 ]
  2. Aczone® (dapsone) Gel[package insert]. Irvine, California: Allergan, Inc.; 2016. [Link]

PMID: 18579741

Dapsone

By

Dapsone

Product: Perphenazine

Identifier : DBSNPE001298
Drug : DB00250 (Dapsone)
Interacting Gene/Enzyme : Glucose-6-phosphate 1-dehydrogenase
Gene Name : G6PD
UniProt ID : P11413
Defining Change(s) :

  • 695G->A

Allele Name : Asahikawa
Genotype(s) : Not Available
Type(s) : ADR Inferred
Groups : G6PD deficiency
Description : Increased risk of hemolysis and hemolytic anemia.
References :

  1. Luzzatto L, Seneca E: G6PD deficiency: a classic example of pharmacogenetics with on-going clinical implications. Br J Haematol. 2014 Feb;164(4):469-80. doi: 10.1111/bjh.12665. Epub 2013 Dec 28. [PubMed:24372186 ]
  2. Aczone® (dapsone) Gel[package insert]. Irvine, California: Allergan, Inc.; 2016. [Link]

PMID: 16199519

Dapsone

By

Dapsone

Product: Imidazole

Identifier : DBSNPE001299
Drug : DB00250 (Dapsone)
Interacting Gene/Enzyme : Glucose-6-phosphate 1-dehydrogenase
Gene Name : G6PD
UniProt ID : P11413
Defining Change(s) :

  • 713A->G

Allele Name : Durham
Genotype(s) : Not Available
Type(s) : ADR Inferred
Groups : G6PD deficiency
Description : Increased risk of hemolysis and hemolytic anemia.
References :

  1. Luzzatto L, Seneca E: G6PD deficiency: a classic example of pharmacogenetics with on-going clinical implications. Br J Haematol. 2014 Feb;164(4):469-80. doi: 10.1111/bjh.12665. Epub 2013 Dec 28. [PubMed:24372186 ]
  2. Aczone® (dapsone) Gel[package insert]. Irvine, California: Allergan, Inc.; 2016. [Link]

PMID: 15100159

Dapsone

By

Dapsone

Product: Sodium orthovanadate

Identifier : DBSNPE001300
Drug : DB00250 (Dapsone)
Interacting Gene/Enzyme : Glucose-6-phosphate 1-dehydrogenase
Gene Name : G6PD
UniProt ID : P11413
Defining Change(s) :

  • 724_729delGGCACT

Allele Name : Stonybrook
Genotype(s) : Not Available
Type(s) : ADR Inferred
Groups : G6PD deficiency
Description : Increased risk of hemolysis and hemolytic anemia.
References :

  1. Luzzatto L, Seneca E: G6PD deficiency: a classic example of pharmacogenetics with on-going clinical implications. Br J Haematol. 2014 Feb;164(4):469-80. doi: 10.1111/bjh.12665. Epub 2013 Dec 28. [PubMed:24372186 ]
  2. Aczone® (dapsone) Gel[package insert]. Irvine, California: Allergan, Inc.; 2016. [Link]

PMID: 25887256

Dapsone

By

Dapsone

Product: Sodium molybdate

Identifier : DBSNPE001301
Drug : DB00250 (Dapsone)
Interacting Gene/Enzyme : Glucose-6-phosphate 1-dehydrogenase
Gene Name : G6PD
UniProt ID : P11413
Defining Change(s) :

  • 769C->G

Allele Name : Wayne
Genotype(s) : Not Available
Type(s) : ADR Inferred
Groups : G6PD deficiency
Description : Increased risk of hemolysis and hemolytic anemia.
References :

  1. Luzzatto L, Seneca E: G6PD deficiency: a classic example of pharmacogenetics with on-going clinical implications. Br J Haematol. 2014 Feb;164(4):469-80. doi: 10.1111/bjh.12665. Epub 2013 Dec 28. [PubMed:24372186 ]
  2. Aczone® (dapsone) Gel[package insert]. Irvine, California: Allergan, Inc.; 2016. [Link]

PMID: 22691495

Dapsone

By

Dapsone

Product: Tartaric acid (disodium dihydrate)

Identifier : DBSNPE001302
Drug : DB00250 (Dapsone)
Interacting Gene/Enzyme : Glucose-6-phosphate 1-dehydrogenase
Gene Name : G6PD
UniProt ID : P11413
Defining Change(s) :

  • 806G->A

Allele Name : Aveiro
Genotype(s) : Not Available
Type(s) : ADR Inferred
Groups : G6PD deficiency
Description : Increased risk of hemolysis and hemolytic anemia.
References :

  1. Luzzatto L, Seneca E: G6PD deficiency: a classic example of pharmacogenetics with on-going clinical implications. Br J Haematol. 2014 Feb;164(4):469-80. doi: 10.1111/bjh.12665. Epub 2013 Dec 28. [PubMed:24372186 ]
  2. Aczone® (dapsone) Gel[package insert]. Irvine, California: Allergan, Inc.; 2016. [Link]

PMID: 17218350

Dapsone

By

Dapsone

Product: Sodium Fluoride

Identifier : DBSNPE001303
Drug : DB00250 (Dapsone)
Interacting Gene/Enzyme : Glucose-6-phosphate 1-dehydrogenase
Gene Name : G6PD
UniProt ID : P11413
Defining Change(s) :

  • 820G->A

Allele Name : Cleveland Corum
Genotype(s) : Not Available
Type(s) : ADR Inferred
Groups : G6PD deficiency
Description : Increased risk of hemolysis and hemolytic anemia.
References :

  1. Luzzatto L, Seneca E: G6PD deficiency: a classic example of pharmacogenetics with on-going clinical implications. Br J Haematol. 2014 Feb;164(4):469-80. doi: 10.1111/bjh.12665. Epub 2013 Dec 28. [PubMed:24372186 ]
  2. Aczone® (dapsone) Gel[package insert]. Irvine, California: Allergan, Inc.; 2016. [Link]

PMID: 8831109

Dapsone

By

Dapsone

Product: Lumefantrine

Identifier : DBSNPE001305
Drug : DB00250 (Dapsone)
Interacting Gene/Enzyme : Glucose-6-phosphate 1-dehydrogenase
Gene Name : G6PD
UniProt ID : P11413
Defining Change(s) :

  • 825G>C

Allele Name : Bangkok
Genotype(s) : Not Available
Type(s) : ADR Inferred
Groups : G6PD deficiency
Description : Increased risk of hemolysis and hemolytic anemia.
References :

  1. Luzzatto L, Seneca E: G6PD deficiency: a classic example of pharmacogenetics with on-going clinical implications. Br J Haematol. 2014 Feb;164(4):469-80. doi: 10.1111/bjh.12665. Epub 2013 Dec 28. [PubMed:24372186 ]
  2. Aczone® (dapsone) Gel[package insert]. Irvine, California: Allergan, Inc.; 2016. [Link]

PMID: 3022866

Dapsone

By

Dapsone

Product: NADPH (tetracyclohexanamine)

Identifier : DBSNPE001306
Drug : DB00250 (Dapsone)
Interacting Gene/Enzyme : Glucose-6-phosphate 1-dehydrogenase
Gene Name : G6PD
UniProt ID : P11413
Defining Change(s) :

  • 826C->T

Allele Name : Sugao
Genotype(s) : Not Available
Type(s) : ADR Inferred
Groups : G6PD deficiency
Description : Increased risk of hemolysis and hemolytic anemia.
References :

  1. Luzzatto L, Seneca E: G6PD deficiency: a classic example of pharmacogenetics with on-going clinical implications. Br J Haematol. 2014 Feb;164(4):469-80. doi: 10.1111/bjh.12665. Epub 2013 Dec 28. [PubMed:24372186 ]
  2. Aczone® (dapsone) Gel[package insert]. Irvine, California: Allergan, Inc.; 2016. [Link]

PMID: 26730407

Dapsone

By

Dapsone

Product: β-Nicotinamide mononucleotide

Identifier : DBSNPE001307
Drug : DB00250 (Dapsone)
Interacting Gene/Enzyme : Glucose-6-phosphate 1-dehydrogenase
Gene Name : G6PD
UniProt ID : P11413
Defining Change(s) :

  • 832T->C

Allele Name : La Jolla
Genotype(s) : Not Available
Type(s) : ADR Inferred
Groups : G6PD deficiency
Description : Increased risk of hemolysis and hemolytic anemia.
References :

  1. Luzzatto L, Seneca E: G6PD deficiency: a classic example of pharmacogenetics with on-going clinical implications. Br J Haematol. 2014 Feb;164(4):469-80. doi: 10.1111/bjh.12665. Epub 2013 Dec 28. [PubMed:24372186 ]
  2. Aczone® (dapsone) Gel[package insert]. Irvine, California: Allergan, Inc.; 2016. [Link]

PMID: 25926446

Dapsone

By

Dapsone

Product: Bafetinib

Identifier : DBSNPE001308
Drug : DB00250 (Dapsone)
Interacting Gene/Enzyme : Glucose-6-phosphate 1-dehydrogenase
Gene Name : G6PD
UniProt ID : P11413
Defining Change(s) :

  • 833C->T

Allele Name : Wexham
Genotype(s) : Not Available
Type(s) : ADR Inferred
Groups : G6PD deficiency
Description : Increased risk of hemolysis and hemolytic anemia.
References :

  1. Luzzatto L, Seneca E: G6PD deficiency: a classic example of pharmacogenetics with on-going clinical implications. Br J Haematol. 2014 Feb;164(4):469-80. doi: 10.1111/bjh.12665. Epub 2013 Dec 28. [PubMed:24372186 ]
  2. Aczone® (dapsone) Gel[package insert]. Irvine, California: Allergan, Inc.; 2016. [Link]

PMID: 26627643

Dapsone

By

Dapsone

Product: ITE

Identifier : DBSNPE001309
Drug : DB00250 (Dapsone)
Interacting Gene/Enzyme : Glucose-6-phosphate 1-dehydrogenase
Gene Name : G6PD
UniProt ID : P11413
Defining Change(s) :

  • 851T>C

Allele Name : Piodivkow
Genotype(s) : Not Available
Type(s) : ADR Inferred
Groups : G6PD deficiency
Description : Increased risk of hemolysis and hemolytic anemia.
References :

  1. Luzzatto L, Seneca E: G6PD deficiency: a classic example of pharmacogenetics with on-going clinical implications. Br J Haematol. 2014 Feb;164(4):469-80. doi: 10.1111/bjh.12665. Epub 2013 Dec 28. [PubMed:24372186 ]
  2. Aczone® (dapsone) Gel[package insert]. Irvine, California: Allergan, Inc.; 2016. [Link]

PMID: 25918499

Dapsone

By

Dapsone

Product: Citarinostat

Identifier : DBSNPE001310
Drug : DB00250 (Dapsone)
Interacting Gene/Enzyme : Glucose-6-phosphate 1-dehydrogenase
Gene Name : G6PD
UniProt ID : P11413
Defining Change(s) :

  • 910G->T

Allele Name : West Virginia
Genotype(s) : Not Available
Type(s) : ADR Inferred
Groups : G6PD deficiency
Description : Increased risk of hemolysis and hemolytic anemia.
References :

  1. Luzzatto L, Seneca E: G6PD deficiency: a classic example of pharmacogenetics with on-going clinical implications. Br J Haematol. 2014 Feb;164(4):469-80. doi: 10.1111/bjh.12665. Epub 2013 Dec 28. [PubMed:24372186 ]
  2. Aczone® (dapsone) Gel[package insert]. Irvine, California: Allergan, Inc.; 2016. [Link]

PMID: 25824291

Dapsone

By

Dapsone

Product: hPGDS-IN-1

Identifier : DBSNPE001311
Drug : DB00250 (Dapsone)
Interacting Gene/Enzyme : Glucose-6-phosphate 1-dehydrogenase
Gene Name : G6PD
UniProt ID : P11413
Defining Change(s) :

  • 921G->C

Allele Name : Omiya
Genotype(s) : Not Available
Type(s) : ADR Inferred
Groups : G6PD deficiency
Description : Increased risk of hemolysis and hemolytic anemia.
References :

  1. Luzzatto L, Seneca E: G6PD deficiency: a classic example of pharmacogenetics with on-going clinical implications. Br J Haematol. 2014 Feb;164(4):469-80. doi: 10.1111/bjh.12665. Epub 2013 Dec 28. [PubMed:24372186 ]
  2. Aczone® (dapsone) Gel[package insert]. Irvine, California: Allergan, Inc.; 2016. [Link]

PMID: 26300729

Dapsone

By

Dapsone

Product: Berbamine (dihydrochloride)

Identifier : DBSNPE001312
Drug : DB00250 (Dapsone)
Interacting Gene/Enzyme : Glucose-6-phosphate 1-dehydrogenase
Gene Name : G6PD
UniProt ID : P11413
Defining Change(s) :

  • 953_976delCCACCAAAGGGTACCTGGAC GACC

Allele Name : Nara
Genotype(s) : Not Available
Type(s) : ADR Inferred
Groups : G6PD deficiency
Description : Increased risk of hemolysis and hemolytic anemia.
References :

  1. Luzzatto L, Seneca E: G6PD deficiency: a classic example of pharmacogenetics with on-going clinical implications. Br J Haematol. 2014 Feb;164(4):469-80. doi: 10.1111/bjh.12665. Epub 2013 Dec 28. [PubMed:24372186 ]
  2. Aczone® (dapsone) Gel[package insert]. Irvine, California: Allergan, Inc.; 2016. [Link]

PMID: 25988808

Dapsone

By

Dapsone

Product: Cantharidin

Identifier : DBSNPE001313
Drug : DB00250 (Dapsone)
Interacting Gene/Enzyme : Glucose-6-phosphate 1-dehydrogenase
Gene Name : G6PD
UniProt ID : P11413
Defining Change(s) :

  • 962G->A

Allele Name : Manhattan
Genotype(s) : Not Available
Type(s) : ADR Inferred
Groups : G6PD deficiency
Description : Increased risk of hemolysis and hemolytic anemia.
References :

  1. Luzzatto L, Seneca E: G6PD deficiency: a classic example of pharmacogenetics with on-going clinical implications. Br J Haematol. 2014 Feb;164(4):469-80. doi: 10.1111/bjh.12665. Epub 2013 Dec 28. [PubMed:24372186 ]
  2. Aczone® (dapsone) Gel[package insert]. Irvine, California: Allergan, Inc.; 2016. [Link]

PMID: 26379493

Dapsone

By

Dapsone

Product: Nylidrin (hydrochloride)

Identifier : DBSNPE001314
Drug : DB00250 (Dapsone)
Interacting Gene/Enzyme : Glucose-6-phosphate 1-dehydrogenase
Gene Name : G6PD
UniProt ID : P11413
Defining Change(s) :

  • 964T->C

Allele Name : Rehevot
Genotype(s) : Not Available
Type(s) : ADR Inferred
Groups : G6PD deficiency
Description : Increased risk of hemolysis and hemolytic anemia.
References :

  1. Luzzatto L, Seneca E: G6PD deficiency: a classic example of pharmacogenetics with on-going clinical implications. Br J Haematol. 2014 Feb;164(4):469-80. doi: 10.1111/bjh.12665. Epub 2013 Dec 28. [PubMed:24372186 ]
  2. Aczone® (dapsone) Gel[package insert]. Irvine, California: Allergan, Inc.; 2016. [Link]

PMID: 26619789

Dapsone

By

Dapsone

Product: GR79236

Identifier : DBSNPE001315
Drug : DB00250 (Dapsone)
Interacting Gene/Enzyme : Glucose-6-phosphate 1-dehydrogenase
Gene Name : G6PD
UniProt ID : P11413
Defining Change(s) :

  • 99A->G
  • 1360C->T

Allele Name : Honiara
Genotype(s) : Not Available
Type(s) : ADR Inferred
Groups : G6PD deficiency
Description : Increased risk of hemolysis and hemolytic anemia.
References :

  1. Luzzatto L, Seneca E: G6PD deficiency: a classic example of pharmacogenetics with on-going clinical implications. Br J Haematol. 2014 Feb;164(4):469-80. doi: 10.1111/bjh.12665. Epub 2013 Dec 28. [PubMed:24372186 ]
  2. Aczone® (dapsone) Gel[package insert]. Irvine, California: Allergan, Inc.; 2016. [Link]

PMID: 26043076

Dapsone

By

Dapsone

Product: Aldose reductase-IN-1

Identifier : DBSNPE001316
Drug : DB00250 (Dapsone)
Interacting Gene/Enzyme : Glucose-6-phosphate 1-dehydrogenase
Gene Name : G6PD
UniProt ID : P11413
Defining Change(s) :

  • 1246G->A

Allele Name : Tokyo, Fukushima
Genotype(s) : Not Available
Type(s) : ADR Inferred
Groups : G6PD deficiency
Description : Increased risk of hemolysis and hemolytic anemia.
References :

  1. Luzzatto L, Seneca E: G6PD deficiency: a classic example of pharmacogenetics with on-going clinical implications. Br J Haematol. 2014 Feb;164(4):469-80. doi: 10.1111/bjh.12665. Epub 2013 Dec 28. [PubMed:24372186 ]
  2. Aczone® (dapsone) Gel[package insert]. Irvine, California: Allergan, Inc.; 2016. [Link]

PMID: 24572089

Dapsone

By

Dapsone

Product: Ivosidenib

Identifier : DBSNPE001317
Drug : DB00250 (Dapsone)
Interacting Gene/Enzyme : Glucose-6-phosphate 1-dehydrogenase
Gene Name : G6PD
UniProt ID : P11413
Defining Change(s) :

  • 1003G->A

Allele Name : Chatham
Genotype(s) : Not Available
Type(s) : ADR Inferred
Groups : G6PD deficiency
Description : Increased risk of hemolysis and hemolytic anemia.
References :

  1. Luzzatto L, Seneca E: G6PD deficiency: a classic example of pharmacogenetics with on-going clinical implications. Br J Haematol. 2014 Feb;164(4):469-80. doi: 10.1111/bjh.12665. Epub 2013 Dec 28. [PubMed:24372186 ]
  2. Aczone® (dapsone) Gel[package insert]. Irvine, California: Allergan, Inc.; 2016. [Link]

PMID: 24478358

Dapsone

By

Dapsone

Product: EPZ011989 (trifluoroacetate)

Identifier : DBSNPE001318
Drug : DB00250 (Dapsone)
Interacting Gene/Enzyme : Glucose-6-phosphate 1-dehydrogenase
Gene Name : G6PD
UniProt ID : P11413
Defining Change(s) :

  • 1004C->A

Allele Name : Fushan
Genotype(s) : Not Available
Type(s) : ADR Inferred
Groups : G6PD deficiency
Description : Increased risk of hemolysis and hemolytic anemia.
References :

  1. Luzzatto L, Seneca E: G6PD deficiency: a classic example of pharmacogenetics with on-going clinical implications. Br J Haematol. 2014 Feb;164(4):469-80. doi: 10.1111/bjh.12665. Epub 2013 Dec 28. [PubMed:24372186 ]
  2. Aczone® (dapsone) Gel[package insert]. Irvine, California: Allergan, Inc.; 2016. [Link]

PMID: 24474905

Dapsone

By

Dapsone

Product: Quinagolide (hydrochloride)

Identifier : DBSNPE001319
Drug : DB00250 (Dapsone)
Interacting Gene/Enzyme : Glucose-6-phosphate 1-dehydrogenase
Gene Name : G6PD
UniProt ID : P11413
Defining Change(s) :

  • 1052G->T

Allele Name : Partenope
Genotype(s) : Not Available
Type(s) : ADR Inferred
Groups : G6PD deficiency
Description : Increased risk of hemolysis and hemolytic anemia.
References :

  1. Luzzatto L, Seneca E: G6PD deficiency: a classic example of pharmacogenetics with on-going clinical implications. Br J Haematol. 2014 Feb;164(4):469-80. doi: 10.1111/bjh.12665. Epub 2013 Dec 28. [PubMed:24372186 ]
  2. Aczone® (dapsone) Gel[package insert]. Irvine, California: Allergan, Inc.; 2016. [Link]

PMID: 25202237

Dapsone

By

Dapsone

Product: JNJ-7777120

Identifier : DBSNPE001320
Drug : DB00250 (Dapsone)
Interacting Gene/Enzyme : Glucose-6-phosphate 1-dehydrogenase
Gene Name : G6PD
UniProt ID : P11413
Defining Change(s) :

  • 1057C->T

Allele Name : Ierapediva
Genotype(s) : Not Available
Type(s) : ADR Inferred
Groups : G6PD deficiency
Description : Increased risk of hemolysis and hemolytic anemia.
References :

  1. Luzzatto L, Seneca E: G6PD deficiency: a classic example of pharmacogenetics with on-going clinical implications. Br J Haematol. 2014 Feb;164(4):469-80. doi: 10.1111/bjh.12665. Epub 2013 Dec 28. [PubMed:24372186 ]
  2. Aczone® (dapsone) Gel[package insert]. Irvine, California: Allergan, Inc.; 2016. [Link]

PMID: 25140704

Dapsone

By

Dapsone

Product: (-)-Blebbistatin

Identifier : DBSNPE001321
Drug : DB00250 (Dapsone)
Interacting Gene/Enzyme : Glucose-6-phosphate 1-dehydrogenase
Gene Name : G6PD
UniProt ID : P11413
Defining Change(s) :

  • 1193A->G

Allele Name : Anadia
Genotype(s) : Not Available
Type(s) : ADR Inferred
Groups : G6PD deficiency
Description : Increased risk of hemolysis and hemolytic anemia.
References :

  1. Luzzatto L, Seneca E: G6PD deficiency: a classic example of pharmacogenetics with on-going clinical implications. Br J Haematol. 2014 Feb;164(4):469-80. doi: 10.1111/bjh.12665. Epub 2013 Dec 28. [PubMed:24372186 ]
  2. Aczone® (dapsone) Gel[package insert]. Irvine, California: Allergan, Inc.; 2016. [Link]

PMID: 23047654

Dapsone

By

Dapsone

Product: NU2058

Identifier : DBSNPE001322
Drug : DB00250 (Dapsone)
Interacting Gene/Enzyme : Glucose-6-phosphate 1-dehydrogenase
Gene Name : G6PD
UniProt ID : P11413
Defining Change(s) :

  • 1220A->C

Allele Name : Abeno
Genotype(s) : Not Available
Type(s) : ADR Inferred
Groups : G6PD deficiency
Description : Increased risk of hemolysis and hemolytic anemia.
References :

  1. Luzzatto L, Seneca E: G6PD deficiency: a classic example of pharmacogenetics with on-going clinical implications. Br J Haematol. 2014 Feb;164(4):469-80. doi: 10.1111/bjh.12665. Epub 2013 Dec 28. [PubMed:24372186 ]
  2. Aczone® (dapsone) Gel[package insert]. Irvine, California: Allergan, Inc.; 2016. [Link]

PMID: 23835499

Dapsone

By

Dapsone

Product: LLY-507

Identifier : DBSNPE001323
Drug : DB00250 (Dapsone)
Interacting Gene/Enzyme : Glucose-6-phosphate 1-dehydrogenase
Gene Name : G6PD
UniProt ID : P11413
Defining Change(s) :

  • 1291G->A

Allele Name : Surabaya
Genotype(s) : Not Available
Type(s) : ADR Inferred
Groups : G6PD deficiency
Description : Increased risk of hemolysis and hemolytic anemia.
References :

  1. Luzzatto L, Seneca E: G6PD deficiency: a classic example of pharmacogenetics with on-going clinical implications. Br J Haematol. 2014 Feb;164(4):469-80. doi: 10.1111/bjh.12665. Epub 2013 Dec 28. [PubMed:24372186 ]
  2. Aczone® (dapsone) Gel[package insert]. Irvine, California: Allergan, Inc.; 2016. [Link]

PMID: 24005292

Dapsone

By

Dapsone

Product: Sulfaclozine

Identifier : DBSNPE001324
Drug : DB00250 (Dapsone)
Interacting Gene/Enzyme : Glucose-6-phosphate 1-dehydrogenase
Gene Name : G6PD
UniProt ID : P11413
Defining Change(s) :

  • 1316G->C

Allele Name : Pawnee
Genotype(s) : Not Available
Type(s) : ADR Inferred
Groups : G6PD deficiency
Description : Increased risk of hemolysis and hemolytic anemia.
References :

  1. Luzzatto L, Seneca E: G6PD deficiency: a classic example of pharmacogenetics with on-going clinical implications. Br J Haematol. 2014 Feb;164(4):469-80. doi: 10.1111/bjh.12665. Epub 2013 Dec 28. [PubMed:24372186 ]
  2. Aczone® (dapsone) Gel[package insert]. Irvine, California: Allergan, Inc.; 2016. [Link]

PMID: 22792490

Dapsone

By

Dapsone

Product: PLX7904

Identifier : DBSNPE001325
Drug : DB00250 (Dapsone)
Interacting Gene/Enzyme : Glucose-6-phosphate 1-dehydrogenase
Gene Name : G6PD
UniProt ID : P11413
Defining Change(s) :

  • 1342A->G

Allele Name : S. Antioco
Genotype(s) : Not Available
Type(s) : ADR Inferred
Groups : G6PD deficiency
Description : Increased risk of hemolysis and hemolytic anemia.
References :

  1. Luzzatto L, Seneca E: G6PD deficiency: a classic example of pharmacogenetics with on-going clinical implications. Br J Haematol. 2014 Feb;164(4):469-80. doi: 10.1111/bjh.12665. Epub 2013 Dec 28. [PubMed:24372186 ]
  2. Aczone® (dapsone) Gel[package insert]. Irvine, California: Allergan, Inc.; 2016. [Link]

PMID: 22235322

Dapsone

By

Dapsone

Product: Adjudin

Identifier : DBSNPE001326
Drug : DB00250 (Dapsone)
Interacting Gene/Enzyme : Glucose-6-phosphate 1-dehydrogenase
Gene Name : G6PD
UniProt ID : P11413
Defining Change(s) :

  • 1347G->C

Allele Name : Cassano
Genotype(s) : Not Available
Type(s) : ADR Inferred
Groups : G6PD deficiency
Description : Increased risk of hemolysis and hemolytic anemia.
References :

  1. Luzzatto L, Seneca E: G6PD deficiency: a classic example of pharmacogenetics with on-going clinical implications. Br J Haematol. 2014 Feb;164(4):469-80. doi: 10.1111/bjh.12665. Epub 2013 Dec 28. [PubMed:24372186 ]
  2. Aczone® (dapsone) Gel[package insert]. Irvine, California: Allergan, Inc.; 2016. [Link]

PMID: 22726616

Dapsone

By

Dapsone

Product: Indiplon

Identifier : DBSNPE001327
Drug : DB00250 (Dapsone)
Interacting Gene/Enzyme : Glucose-6-phosphate 1-dehydrogenase
Gene Name : G6PD
UniProt ID : P11413
Defining Change(s) :

  • 1347G->C
  • 1360C->T

Allele Name : Hermoupolis
Genotype(s) : Not Available
Type(s) : ADR Inferred
Groups : G6PD deficiency
Description : Increased risk of hemolysis and hemolytic anemia.
References :

  1. Luzzatto L, Seneca E: G6PD deficiency: a classic example of pharmacogenetics with on-going clinical implications. Br J Haematol. 2014 Feb;164(4):469-80. doi: 10.1111/bjh.12665. Epub 2013 Dec 28. [PubMed:24372186 ]
  2. Aczone® (dapsone) Gel[package insert]. Irvine, California: Allergan, Inc.; 2016. [Link]

PMID: 22276158

Dapsone

By

Dapsone

Product: Anisomycin

Identifier : DBSNPE001328
Drug : DB00250 (Dapsone)
Interacting Gene/Enzyme : Glucose-6-phosphate 1-dehydrogenase
Gene Name : G6PD
UniProt ID : P11413
Defining Change(s) :

  • 1360C->T

Allele Name : Union,Maewo, Chinese-2, Kalo
Genotype(s) : Not Available
Type(s) : ADR Inferred
Groups : G6PD deficiency
Description : Increased risk of hemolysis and hemolytic anemia.
References :

  1. Luzzatto L, Seneca E: G6PD deficiency: a classic example of pharmacogenetics with on-going clinical implications. Br J Haematol. 2014 Feb;164(4):469-80. doi: 10.1111/bjh.12665. Epub 2013 Dec 28. [PubMed:24372186 ]
  2. Aczone® (dapsone) Gel[package insert]. Irvine, California: Allergan, Inc.; 2016. [Link]

PMID: 21602822

Dapsone

By

Dapsone

Product: PLX8394

Identifier : DBSNPE001329
Drug : DB00250 (Dapsone)
Interacting Gene/Enzyme : Glucose-6-phosphate 1-dehydrogenase
Gene Name : G6PD
UniProt ID : P11413
Defining Change(s) :

  • 1361G->A

Allele Name : Andalus
Genotype(s) : Not Available
Type(s) : ADR Inferred
Groups : G6PD deficiency
Description : Increased risk of hemolysis and hemolytic anemia.
References :

  1. Luzzatto L, Seneca E: G6PD deficiency: a classic example of pharmacogenetics with on-going clinical implications. Br J Haematol. 2014 Feb;164(4):469-80. doi: 10.1111/bjh.12665. Epub 2013 Dec 28. [PubMed:24372186 ]
  2. Aczone® (dapsone) Gel[package insert]. Irvine, California: Allergan, Inc.; 2016. [Link]

PMID: 21712833

Dapsone

By

Dapsone

Product: MG-101

Identifier : DBSNPE001330
Drug : DB00250 (Dapsone)
Interacting Gene/Enzyme : Glucose-6-phosphate 1-dehydrogenase
Gene Name : G6PD
UniProt ID : P11413
Defining Change(s) :

  • 1376G->C

Allele Name : Cosenza
Genotype(s) : Not Available
Type(s) : ADR Inferred
Groups : G6PD deficiency
Description : Increased risk of hemolysis and hemolytic anemia.
References :

  1. Luzzatto L, Seneca E: G6PD deficiency: a classic example of pharmacogenetics with on-going clinical implications. Br J Haematol. 2014 Feb;164(4):469-80. doi: 10.1111/bjh.12665. Epub 2013 Dec 28. [PubMed:24372186 ]
  2. Aczone® (dapsone) Gel[package insert]. Irvine, California: Allergan, Inc.; 2016. [Link]

PMID: 21734104

Dapsone

By

Dapsone

Product: JH-II-127

Identifier : DBSNPE001331
Drug : DB00250 (Dapsone)
Interacting Gene/Enzyme : Glucose-6-phosphate 1-dehydrogenase
Gene Name : G6PD
UniProt ID : P11413
Defining Change(s) :

  • 1376G->T

Allele Name : Canton, Taiwan- Hakka, Gifu-like, Agrigento-like
Genotype(s) : Not Available
Type(s) : ADR Inferred
Groups : G6PD deficiency
Description : Increased risk of hemolysis and hemolytic anemia.
References :

  1. Luzzatto L, Seneca E: G6PD deficiency: a classic example of pharmacogenetics with on-going clinical implications. Br J Haematol. 2014 Feb;164(4):469-80. doi: 10.1111/bjh.12665. Epub 2013 Dec 28. [PubMed:24372186 ]
  2. Aczone® (dapsone) Gel[package insert]. Irvine, California: Allergan, Inc.; 2016. [Link]

PMID: 20644244

Dapsone

By

Dapsone

Product: Vercirnon

Identifier : DBSNPE001332
Drug : DB00250 (Dapsone)
Interacting Gene/Enzyme : Glucose-6-phosphate 1-dehydrogenase
Gene Name : G6PD
UniProt ID : P11413
Defining Change(s) :

  • 1387C->A

Allele Name : Flores
Genotype(s) : Not Available
Type(s) : ADR Inferred
Groups : G6PD deficiency
Description : Increased risk of hemolysis and hemolytic anemia.
References :

  1. Luzzatto L, Seneca E: G6PD deficiency: a classic example of pharmacogenetics with on-going clinical implications. Br J Haematol. 2014 Feb;164(4):469-80. doi: 10.1111/bjh.12665. Epub 2013 Dec 28. [PubMed:24372186 ]
  2. Aczone® (dapsone) Gel[package insert]. Irvine, California: Allergan, Inc.; 2016. [Link]

PMID: 20107056

Dapsone

By

Dapsone

Product: AZD-8835

Identifier : DBSNPE001333
Drug : DB00250 (Dapsone)
Interacting Gene/Enzyme : Glucose-6-phosphate 1-dehydrogenase
Gene Name : G6PD
UniProt ID : P11413
Defining Change(s) :

  • 1388G->A

Allele Name : Kaiping, Anant, Dhon, Sapporo-like, Wosera
Genotype(s) : Not Available
Type(s) : ADR Inferred
Groups : G6PD deficiency
Description : Increased risk of hemolysis and hemolytic anemia.
References :

  1. Luzzatto L, Seneca E: G6PD deficiency: a classic example of pharmacogenetics with on-going clinical implications. Br J Haematol. 2014 Feb;164(4):469-80. doi: 10.1111/bjh.12665. Epub 2013 Dec 28. [PubMed:24372186 ]
  2. Aczone® (dapsone) Gel[package insert]. Irvine, California: Allergan, Inc.; 2016. [Link]

PMID: 21084622

Dapsone

By

Dapsone

Product: IC261

Identifier : DBSNPE001334
Drug : DB00250 (Dapsone)
Interacting Gene/Enzyme : Glucose-6-phosphate 1-dehydrogenase
Gene Name : G6PD
UniProt ID : P11413
Defining Change(s) :

  • 169C->T

Allele Name : Kamogawa
Genotype(s) : Not Available
Type(s) : ADR Inferred
Groups : G6PD deficiency
Description : Increased risk of hemolysis and hemolytic anemia.
References :

  1. Luzzatto L, Seneca E: G6PD deficiency: a classic example of pharmacogenetics with on-going clinical implications. Br J Haematol. 2014 Feb;164(4):469-80. doi: 10.1111/bjh.12665. Epub 2013 Dec 28. [PubMed:24372186 ]
  2. Aczone® (dapsone) Gel[package insert]. Irvine, California: Allergan, Inc.; 2016. [Link]

PMID: 20582276

Dapsone

By

Dapsone

Product: Cycloheximide

Identifier : DBSNPE001335
Drug : DB00250 (Dapsone)
Interacting Gene/Enzyme : Glucose-6-phosphate 1-dehydrogenase
Gene Name : G6PD
UniProt ID : P11413
Defining Change(s) :

  • 179T>C

Allele Name : Costanzo
Genotype(s) : Not Available
Type(s) : ADR Inferred
Groups : G6PD deficiency
Description : Increased risk of hemolysis and hemolytic anemia.
References :

  1. Luzzatto L, Seneca E: G6PD deficiency: a classic example of pharmacogenetics with on-going clinical implications. Br J Haematol. 2014 Feb;164(4):469-80. doi: 10.1111/bjh.12665. Epub 2013 Dec 28. [PubMed:24372186 ]
  2. Aczone® (dapsone) Gel[package insert]. Irvine, California: Allergan, Inc.; 2016. [Link]

PMID: 18799598

Dapsone

By

Dapsone

Product: Cardiogenol C (hydrochloride)

Identifier : DBSNPE001336
Drug : DB00250 (Dapsone)
Interacting Gene/Enzyme : Glucose-6-phosphate 1-dehydrogenase
Gene Name : G6PD
UniProt ID : P11413
Defining Change(s) :

  • 185C->A

Allele Name : Amazonia
Genotype(s) : Not Available
Type(s) : ADR Inferred
Groups : G6PD deficiency
Description : Increased risk of hemolysis and hemolytic anemia.
References :

  1. Luzzatto L, Seneca E: G6PD deficiency: a classic example of pharmacogenetics with on-going clinical implications. Br J Haematol. 2014 Feb;164(4):469-80. doi: 10.1111/bjh.12665. Epub 2013 Dec 28. [PubMed:24372186 ]
  2. Aczone® (dapsone) Gel[package insert]. Irvine, California: Allergan, Inc.; 2016. [Link]

PMID: 18222937

Dapsone

By

Dapsone

Product: Tedizolid (phosphate)

Identifier : DBSNPE001337
Drug : DB00250 (Dapsone)
Interacting Gene/Enzyme : Glucose-6-phosphate 1-dehydrogenase
Gene Name : G6PD
UniProt ID : P11413
Defining Change(s) :

  • 196T->A

Allele Name : Songklanagarind
Genotype(s) : Not Available
Type(s) : ADR Inferred
Groups : G6PD deficiency
Description : Increased risk of hemolysis and hemolytic anemia.
References :

  1. Luzzatto L, Seneca E: G6PD deficiency: a classic example of pharmacogenetics with on-going clinical implications. Br J Haematol. 2014 Feb;164(4):469-80. doi: 10.1111/bjh.12665. Epub 2013 Dec 28. [PubMed:24372186 ]
  2. Aczone® (dapsone) Gel[package insert]. Irvine, California: Allergan, Inc.; 2016. [Link]

PMID: 16162832

Dapsone

By

Dapsone

Product: SAR405838

Identifier : DBSNPE001338
Drug : DB00250 (Dapsone)
Interacting Gene/Enzyme : Glucose-6-phosphate 1-dehydrogenase
Gene Name : G6PD
UniProt ID : P11413
Defining Change(s) :

  • 202G->A
  • 871G->A

Allele Name : Hechi
Genotype(s) : Not Available
Type(s) : ADR Inferred
Groups : G6PD deficiency
Description : Increased risk of hemolysis and hemolytic anemia.
References :

  1. Luzzatto L, Seneca E: G6PD deficiency: a classic example of pharmacogenetics with on-going clinical implications. Br J Haematol. 2014 Feb;164(4):469-80. doi: 10.1111/bjh.12665. Epub 2013 Dec 28. [PubMed:24372186 ]
  2. Aczone® (dapsone) Gel[package insert]. Irvine, California: Allergan, Inc.; 2016. [Link]

PMID: 12665615

Dapsone

By

Dapsone

Product: RO8994

Identifier : DBSNPE001339
Drug : DB00250 (Dapsone)
Interacting Gene/Enzyme : Glucose-6-phosphate 1-dehydrogenase
Gene Name : G6PD
UniProt ID : P11413
Defining Change(s) :

  • 208T->C

Allele Name : Namouru
Genotype(s) : Not Available
Type(s) : ADR Inferred
Groups : G6PD deficiency
Description : Increased risk of hemolysis and hemolytic anemia.
References :

  1. Luzzatto L, Seneca E: G6PD deficiency: a classic example of pharmacogenetics with on-going clinical implications. Br J Haematol. 2014 Feb;164(4):469-80. doi: 10.1111/bjh.12665. Epub 2013 Dec 28. [PubMed:24372186 ]
  2. Aczone® (dapsone) Gel[package insert]. Irvine, California: Allergan, Inc.; 2016. [Link]

PMID: 12747794

Dapsone

By

Dapsone

Product: NADH (disodium salt)

Identifier : DBSNPE001341
Drug : DB00250 (Dapsone)
Interacting Gene/Enzyme : Glucose-6-phosphate 1-dehydrogenase
Gene Name : G6PD
UniProt ID : P11413
Defining Change(s) :

  • 375G->T, 379G->T383T->C384C>T

Allele Name : Crispim
Genotype(s) : Not Available
Type(s) : ADR Inferred
Groups : G6PD deficiency
Description : Increased risk of hemolysis and hemolytic anemia.
References :

  1. Luzzatto L, Seneca E: G6PD deficiency: a classic example of pharmacogenetics with on-going clinical implications. Br J Haematol. 2014 Feb;164(4):469-80. doi: 10.1111/bjh.12665. Epub 2013 Dec 28. [PubMed:24372186 ]
  2. Aczone® (dapsone) Gel[package insert]. Irvine, California: Allergan, Inc.; 2016. [Link]

PMID: 22732440

Dapsone

By

Dapsone

Product: NADP (sodium salt)

Identifier : DBSNPE001342
Drug : DB00250 (Dapsone)
Interacting Gene/Enzyme : Glucose-6-phosphate 1-dehydrogenase
Gene Name : G6PD
UniProt ID : P11413
Defining Change(s) :

  • 376A->G
  • 463C->G

Allele Name : Acrokorinthos
Genotype(s) : Not Available
Type(s) : ADR Inferred
Groups : G6PD deficiency
Description : Increased risk of hemolysis and hemolytic anemia.
References :

  1. Luzzatto L, Seneca E: G6PD deficiency: a classic example of pharmacogenetics with on-going clinical implications. Br J Haematol. 2014 Feb;164(4):469-80. doi: 10.1111/bjh.12665. Epub 2013 Dec 28. [PubMed:24372186 ]
  2. Aczone® (dapsone) Gel[package insert]. Irvine, California: Allergan, Inc.; 2016. [Link]

PMID: 12646280

Dapsone

By

Dapsone

Product: NADP (disodium salt)

Identifier : DBSNPE001343
Drug : DB00250 (Dapsone)
Interacting Gene/Enzyme : Glucose-6-phosphate 1-dehydrogenase
Gene Name : G6PD
UniProt ID : P11413
Defining Change(s) :

  • 376A->G
  • 542A->T

Allele Name : Santa Maria
Genotype(s) : Not Available
Type(s) : ADR Inferred
Groups : G6PD deficiency
Description : Increased risk of hemolysis and hemolytic anemia.
References :

  1. Luzzatto L, Seneca E: G6PD deficiency: a classic example of pharmacogenetics with on-going clinical implications. Br J Haematol. 2014 Feb;164(4):469-80. doi: 10.1111/bjh.12665. Epub 2013 Dec 28. [PubMed:24372186 ]
  2. Aczone® (dapsone) Gel[package insert]. Irvine, California: Allergan, Inc.; 2016. [Link]

PMID: 7531762

Dapsone

By

Dapsone

Product: NADPH (tetrasodium salt)

Identifier : DBSNPE001344
Drug : DB00250 (Dapsone)
Interacting Gene/Enzyme : Glucose-6-phosphate 1-dehydrogenase
Gene Name : G6PD
UniProt ID : P11413
Defining Change(s) :

  • 376A->G
  • 871G->A

Allele Name : Ananindeua
Genotype(s) : Not Available
Type(s) : ADR Inferred
Groups : G6PD deficiency
Description : Increased risk of hemolysis and hemolytic anemia.
References :

  1. Luzzatto L, Seneca E: G6PD deficiency: a classic example of pharmacogenetics with on-going clinical implications. Br J Haematol. 2014 Feb;164(4):469-80. doi: 10.1111/bjh.12665. Epub 2013 Dec 28. [PubMed:24372186 ]
  2. Aczone® (dapsone) Gel[package insert]. Irvine, California: Allergan, Inc.; 2016. [Link]

PMID: 8232235

Dapsone

By

Dapsone

Product: Alda-1

Identifier : DBSNPE001345
Drug : DB00250 (Dapsone)
Interacting Gene/Enzyme : Glucose-6-phosphate 1-dehydrogenase
Gene Name : G6PD
UniProt ID : P11413
Defining Change(s) :

  • 383T->C

Allele Name : Vanua Lava
Genotype(s) : Not Available
Type(s) : ADR Inferred
Groups : G6PD deficiency
Description : Increased risk of hemolysis and hemolytic anemia.
References :

  1. Luzzatto L, Seneca E: G6PD deficiency: a classic example of pharmacogenetics with on-going clinical implications. Br J Haematol. 2014 Feb;164(4):469-80. doi: 10.1111/bjh.12665. Epub 2013 Dec 28. [PubMed:24372186 ]
  2. Aczone® (dapsone) Gel[package insert]. Irvine, California: Allergan, Inc.; 2016. [Link]

PMID: 23624119

Dapsone

By

Dapsone

Product: VR23

Identifier : DBSNPE001346
Drug : DB00250 (Dapsone)
Interacting Gene/Enzyme : Glucose-6-phosphate 1-dehydrogenase
Gene Name : G6PD
UniProt ID : P11413
Defining Change(s) :

  • 406C->T

Allele Name : Valladolid
Genotype(s) : Not Available
Type(s) : ADR Inferred
Groups : G6PD deficiency
Description : Increased risk of hemolysis and hemolytic anemia.
References :

  1. Luzzatto L, Seneca E: G6PD deficiency: a classic example of pharmacogenetics with on-going clinical implications. Br J Haematol. 2014 Feb;164(4):469-80. doi: 10.1111/bjh.12665. Epub 2013 Dec 28. [PubMed:24372186 ]
  2. Aczone® (dapsone) Gel[package insert]. Irvine, California: Allergan, Inc.; 2016. [Link]

PMID: 15249420

Dapsone

By

Dapsone

Product: KML29

Identifier : DBSNPE001347
Drug : DB00250 (Dapsone)
Interacting Gene/Enzyme : Glucose-6-phosphate 1-dehydrogenase
Gene Name : G6PD
UniProt ID : P11413
Defining Change(s) :

  • 409C->T

Allele Name : Belem
Genotype(s) : Not Available
Type(s) : ADR Inferred
Groups : G6PD deficiency
Description : Increased risk of hemolysis and hemolytic anemia.
References :

  1. Luzzatto L, Seneca E: G6PD deficiency: a classic example of pharmacogenetics with on-going clinical implications. Br J Haematol. 2014 Feb;164(4):469-80. doi: 10.1111/bjh.12665. Epub 2013 Dec 28. [PubMed:24372186 ]
  2. Aczone® (dapsone) Gel[package insert]. Irvine, California: Allergan, Inc.; 2016. [Link]

PMID: 18791060

Dapsone

By

Dapsone

Product: CPDA

Identifier : DBSNPE001348
Drug : DB00250 (Dapsone)
Interacting Gene/Enzyme : Glucose-6-phosphate 1-dehydrogenase
Gene Name : G6PD
UniProt ID : P11413
Defining Change(s) :

  • 442G->A

Allele Name : Liuzhou
Genotype(s) : Not Available
Type(s) : ADR Inferred
Groups : G6PD deficiency
Description : Increased risk of hemolysis and hemolytic anemia.
References :

  1. Luzzatto L, Seneca E: G6PD deficiency: a classic example of pharmacogenetics with on-going clinical implications. Br J Haematol. 2014 Feb;164(4):469-80. doi: 10.1111/bjh.12665. Epub 2013 Dec 28. [PubMed:24372186 ]
  2. Aczone® (dapsone) Gel[package insert]. Irvine, California: Allergan, Inc.; 2016. [Link]

PMID: 7473156

Dapsone

By

Dapsone

Product: PF-04418948

Identifier : DBSNPE001349
Drug : DB00250 (Dapsone)
Interacting Gene/Enzyme : Glucose-6-phosphate 1-dehydrogenase
Gene Name : G6PD
UniProt ID : P11413
Defining Change(s) :

  • 473G>A

Allele Name : Shenzen
Genotype(s) : Not Available
Type(s) : ADR Inferred
Groups : G6PD deficiency
Description : Increased risk of hemolysis and hemolytic anemia.
References :

  1. Luzzatto L, Seneca E: G6PD deficiency: a classic example of pharmacogenetics with on-going clinical implications. Br J Haematol. 2014 Feb;164(4):469-80. doi: 10.1111/bjh.12665. Epub 2013 Dec 28. [PubMed:24372186 ]
  2. Aczone® (dapsone) Gel[package insert]. Irvine, California: Allergan, Inc.; 2016. [Link]

PMID: 2575813

Dapsone

By

Dapsone

Product: Afloqualone

Identifier : DBSNPE001350
Drug : DB00250 (Dapsone)
Interacting Gene/Enzyme : Glucose-6-phosphate 1-dehydrogenase
Gene Name : G6PD
UniProt ID : P11413
Defining Change(s) :

  • 493A->G

Allele Name : Taipei “Chinese- 3”
Genotype(s) : Not Available
Type(s) : ADR Inferred
Groups : G6PD deficiency
Description : Increased risk of hemolysis and hemolytic anemia.
References :

  1. Luzzatto L, Seneca E: G6PD deficiency: a classic example of pharmacogenetics with on-going clinical implications. Br J Haematol. 2014 Feb;164(4):469-80. doi: 10.1111/bjh.12665. Epub 2013 Dec 28. [PubMed:24372186 ]
  2. Aczone® (dapsone) Gel[package insert]. Irvine, California: Allergan, Inc.; 2016. [Link]

PMID: 3014522

Dapsone

By

Dapsone

Product: INT-767

Identifier : DBSNPE001351
Drug : DB00250 (Dapsone)
Interacting Gene/Enzyme : Glucose-6-phosphate 1-dehydrogenase
Gene Name : G6PD
UniProt ID : P11413
Defining Change(s) :

  • 496C>T

Allele Name : Toledo
Genotype(s) : Not Available
Type(s) : ADR Inferred
Groups : G6PD deficiency
Description : Increased risk of hemolysis and hemolytic anemia.
References :

  1. Luzzatto L, Seneca E: G6PD deficiency: a classic example of pharmacogenetics with on-going clinical implications. Br J Haematol. 2014 Feb;164(4):469-80. doi: 10.1111/bjh.12665. Epub 2013 Dec 28. [PubMed:24372186 ]
  2. Aczone® (dapsone) Gel[package insert]. Irvine, California: Allergan, Inc.; 2016. [Link]

PMID: 1981266

Dapsone

By

Dapsone

Product: EPZ020411

Identifier : DBSNPE001352
Drug : DB00250 (Dapsone)
Interacting Gene/Enzyme : Glucose-6-phosphate 1-dehydrogenase
Gene Name : G6PD
UniProt ID : P11413
Defining Change(s) :

  • 497G->A

Allele Name : Naone
Genotype(s) : Not Available
Type(s) : ADR Inferred
Groups : G6PD deficiency
Description : Increased risk of hemolysis and hemolytic anemia.
References :

  1. Luzzatto L, Seneca E: G6PD deficiency: a classic example of pharmacogenetics with on-going clinical implications. Br J Haematol. 2014 Feb;164(4):469-80. doi: 10.1111/bjh.12665. Epub 2013 Dec 28. [PubMed:24372186 ]
  2. Aczone® (dapsone) Gel[package insert]. Irvine, California: Allergan, Inc.; 2016. [Link]

PMID: 2563294

Dapsone

By

Dapsone

Product: 1,2,3,4,6-Penta-O-galloyl-beta-D-glucopyranose

Identifier : DBSNPE001353
Drug : DB00250 (Dapsone)
Interacting Gene/Enzyme : Glucose-6-phosphate 1-dehydrogenase
Gene Name : G6PD
UniProt ID : P11413
Defining Change(s) :

  • 517T->C

Allele Name : Nankang
Genotype(s) : Not Available
Type(s) : ADR Inferred
Groups : G6PD deficiency
Description : Increased risk of hemolysis and hemolytic anemia.
References :

  1. Luzzatto L, Seneca E: G6PD deficiency: a classic example of pharmacogenetics with on-going clinical implications. Br J Haematol. 2014 Feb;164(4):469-80. doi: 10.1111/bjh.12665. Epub 2013 Dec 28. [PubMed:24372186 ]
  2. Aczone® (dapsone) Gel[package insert]. Irvine, California: Allergan, Inc.; 2016. [Link]

PMID: 2893398

Dapsone

By

Dapsone

Product: Loganin

Identifier : DBSNPE001354
Drug : DB00250 (Dapsone)
Interacting Gene/Enzyme : Glucose-6-phosphate 1-dehydrogenase
Gene Name : G6PD
UniProt ID : P11413
Defining Change(s) :

  • 519C->G

Allele Name : Miaoli
Genotype(s) : Not Available
Type(s) : ADR Inferred
Groups : G6PD deficiency
Description : Increased risk of hemolysis and hemolytic anemia.
References :

  1. Luzzatto L, Seneca E: G6PD deficiency: a classic example of pharmacogenetics with on-going clinical implications. Br J Haematol. 2014 Feb;164(4):469-80. doi: 10.1111/bjh.12665. Epub 2013 Dec 28. [PubMed:24372186 ]
  2. Aczone® (dapsone) Gel[package insert]. Irvine, California: Allergan, Inc.; 2016. [Link]

PMID: 2567153

Dapsone

By

Dapsone

Product: Magnolol

Identifier : DBSNPE001355
Drug : DB00250 (Dapsone)
Interacting Gene/Enzyme : Glucose-6-phosphate 1-dehydrogenase
Gene Name : G6PD
UniProt ID : P11413
Defining Change(s) :

  • 563C->T

Allele Name : Mediterranean, Dallas, Panama‚ Sassari, Cagliari, Birmingham
Genotype(s) : Not Available
Type(s) : ADR Inferred
Groups : G6PD deficiency
Description : Increased risk of hemolysis and hemolytic anemia.
References :

  1. Luzzatto L, Seneca E: G6PD deficiency: a classic example of pharmacogenetics with on-going clinical implications. Br J Haematol. 2014 Feb;164(4):469-80. doi: 10.1111/bjh.12665. Epub 2013 Dec 28. [PubMed:24372186 ]
  2. Aczone® (dapsone) Gel[package insert]. Irvine, California: Allergan, Inc.; 2016. [Link]

PMID: 2896235

Dapsone

By

Dapsone

Product: AMI-1

Identifier : DBSNPE001356
Drug : DB00250 (Dapsone)
Interacting Gene/Enzyme : Glucose-6-phosphate 1-dehydrogenase
Gene Name : G6PD
UniProt ID : P11413
Defining Change(s) :

  • 592C->T

Allele Name : Coimbra Shunde
Genotype(s) : Not Available
Type(s) : ADR Inferred
Groups : G6PD deficiency
Description : Increased risk of hemolysis and hemolytic anemia.
References :

  1. Luzzatto L, Seneca E: G6PD deficiency: a classic example of pharmacogenetics with on-going clinical implications. Br J Haematol. 2014 Feb;164(4):469-80. doi: 10.1111/bjh.12665. Epub 2013 Dec 28. [PubMed:24372186 ]
  2. Aczone® (dapsone) Gel[package insert]. Irvine, California: Allergan, Inc.; 2016. [Link]

PMID: 7568326

Dapsone

By

Dapsone

Product: TAS-301

Identifier : DBSNPE001357
Drug : DB00250 (Dapsone)
Interacting Gene/Enzyme : Glucose-6-phosphate 1-dehydrogenase
Gene Name : G6PD
UniProt ID : P11413
Defining Change(s) :

  • 593G>A

Allele Name : Nilgiri
Genotype(s) : Not Available
Type(s) : ADR Inferred
Groups : G6PD deficiency
Description : Increased risk of hemolysis and hemolytic anemia.
References :

  1. Luzzatto L, Seneca E: G6PD deficiency: a classic example of pharmacogenetics with on-going clinical implications. Br J Haematol. 2014 Feb;164(4):469-80. doi: 10.1111/bjh.12665. Epub 2013 Dec 28. [PubMed:24372186 ]
  2. Aczone® (dapsone) Gel[package insert]. Irvine, California: Allergan, Inc.; 2016. [Link]

PMID: 40258

Dapsone

By

Dapsone

Product: Imidapril (hydrochloride)

Identifier : DBSNPE001358
Drug : DB00250 (Dapsone)
Interacting Gene/Enzyme : Glucose-6-phosphate 1-dehydrogenase
Gene Name : G6PD
UniProt ID : P11413
Defining Change(s) :

  • 679C->T

Allele Name : Radlowo
Genotype(s) : Not Available
Type(s) : ADR Inferred
Groups : G6PD deficiency
Description : Increased risk of hemolysis and hemolytic anemia.
References :

  1. Luzzatto L, Seneca E: G6PD deficiency: a classic example of pharmacogenetics with on-going clinical implications. Br J Haematol. 2014 Feb;164(4):469-80. doi: 10.1111/bjh.12665. Epub 2013 Dec 28. [PubMed:24372186 ]
  2. Aczone® (dapsone) Gel[package insert]. Irvine, California: Allergan, Inc.; 2016. [Link]

PMID: 40257

Dapsone

By

Dapsone

Product: Nampt-IN-1

Identifier : DBSNPE001359
Drug : DB00250 (Dapsone)
Interacting Gene/Enzyme : Glucose-6-phosphate 1-dehydrogenase
Gene Name : G6PD
UniProt ID : P11413
Defining Change(s) :

  • 811G>C

Allele Name : Roubaix
Genotype(s) : Not Available
Type(s) : ADR Inferred
Groups : G6PD deficiency
Description : Increased risk of hemolysis and hemolytic anemia.
References :

  1. Luzzatto L, Seneca E: G6PD deficiency: a classic example of pharmacogenetics with on-going clinical implications. Br J Haematol. 2014 Feb;164(4):469-80. doi: 10.1111/bjh.12665. Epub 2013 Dec 28. [PubMed:24372186 ]
  2. Aczone® (dapsone) Gel[package insert]. Irvine, California: Allergan, Inc.; 2016. [Link]

PMID: 26224396

Dapsone

By

Dapsone

Product: CHF5074

Identifier : DBSNPE001360
Drug : DB00250 (Dapsone)
Interacting Gene/Enzyme : Glucose-6-phosphate 1-dehydrogenase
Gene Name : G6PD
UniProt ID : P11413
Defining Change(s) :

  • 835A->G

Allele Name : Haikou
Genotype(s) : Not Available
Type(s) : ADR Inferred
Groups : G6PD deficiency
Description : Increased risk of hemolysis and hemolytic anemia.
References :

  1. Luzzatto L, Seneca E: G6PD deficiency: a classic example of pharmacogenetics with on-going clinical implications. Br J Haematol. 2014 Feb;164(4):469-80. doi: 10.1111/bjh.12665. Epub 2013 Dec 28. [PubMed:24372186 ]
  2. Aczone® (dapsone) Gel[package insert]. Irvine, California: Allergan, Inc.; 2016. [Link]

PMID: 18607852

Dapsone

By

Dapsone

Product: Norvancomycin (hydrochloride)

Identifier : DBSNPE001361
Drug : DB00250 (Dapsone)
Interacting Gene/Enzyme : Glucose-6-phosphate 1-dehydrogenase
Gene Name : G6PD
UniProt ID : P11413
Defining Change(s) :

  • 835A->T

Allele Name : Chinese-1
Genotype(s) : Not Available
Type(s) : ADR Inferred
Groups : G6PD deficiency
Description : Increased risk of hemolysis and hemolytic anemia.
References :

  1. Luzzatto L, Seneca E: G6PD deficiency: a classic example of pharmacogenetics with on-going clinical implications. Br J Haematol. 2014 Feb;164(4):469-80. doi: 10.1111/bjh.12665. Epub 2013 Dec 28. [PubMed:24372186 ]
  2. Aczone® (dapsone) Gel[package insert]. Irvine, California: Allergan, Inc.; 2016. [Link]

PMID: 12955907

Dapsone

By

Dapsone

Product: Enasidenib

Identifier : DBSNPE001362
Drug : DB00250 (Dapsone)
Interacting Gene/Enzyme : Glucose-6-phosphate 1-dehydrogenase
Gene Name : G6PD
UniProt ID : P11413
Defining Change(s) :

  • 848A>G

Allele Name : Mizushima
Genotype(s) : Not Available
Type(s) : ADR Inferred
Groups : G6PD deficiency
Description : Increased risk of hemolysis and hemolytic anemia.
References :

  1. Luzzatto L, Seneca E: G6PD deficiency: a classic example of pharmacogenetics with on-going clinical implications. Br J Haematol. 2014 Feb;164(4):469-80. doi: 10.1111/bjh.12665. Epub 2013 Dec 28. [PubMed:24372186 ]
  2. Aczone® (dapsone) Gel[package insert]. Irvine, California: Allergan, Inc.; 2016. [Link]

PMID: 1333969

Dapsone

By

Dapsone

Product: AZD3759

Identifier : DBSNPE001363
Drug : DB00250 (Dapsone)
Interacting Gene/Enzyme : Glucose-6-phosphate 1-dehydrogenase
Gene Name : G6PD
UniProt ID : P11413
Defining Change(s) :

  • 853C->T

Allele Name : Osaka
Genotype(s) : Not Available
Type(s) : ADR Inferred
Groups : G6PD deficiency
Description : Increased risk of hemolysis and hemolytic anemia.
References :

  1. Luzzatto L, Seneca E: G6PD deficiency: a classic example of pharmacogenetics with on-going clinical implications. Br J Haematol. 2014 Feb;164(4):469-80. doi: 10.1111/bjh.12665. Epub 2013 Dec 28. [PubMed:24372186 ]
  2. Aczone® (dapsone) Gel[package insert]. Irvine, California: Allergan, Inc.; 2016. [Link]

PMID: 1664802

Dapsone

By

Dapsone

Product: CY2-SE

Identifier : DBSNPE001364
Drug : DB00250 (Dapsone)
Interacting Gene/Enzyme : Glucose-6-phosphate 1-dehydrogenase
Gene Name : G6PD
UniProt ID : P11413
Defining Change(s) :

  • 871G->A

Allele Name : Viangchan, Jammu
Genotype(s) : Not Available
Type(s) : ADR Inferred
Groups : G6PD deficiency
Description : Increased risk of hemolysis and hemolytic anemia.
References :

  1. Luzzatto L, Seneca E: G6PD deficiency: a classic example of pharmacogenetics with on-going clinical implications. Br J Haematol. 2014 Feb;164(4):469-80. doi: 10.1111/bjh.12665. Epub 2013 Dec 28. [PubMed:24372186 ]
  2. Aczone® (dapsone) Gel[package insert]. Irvine, California: Allergan, Inc.; 2016. [Link]

PMID: 16297441

Dapsone

By

Dapsone

Product: CY2

Identifier : DBSNPE001365
Drug : DB00250 (Dapsone)
Interacting Gene/Enzyme : Glucose-6-phosphate 1-dehydrogenase
Gene Name : G6PD
UniProt ID : P11413
Defining Change(s) :

  • 916G->A

Allele Name : Seoul
Genotype(s) : Not Available
Type(s) : ADR Inferred
Groups : G6PD deficiency
Description : Increased risk of hemolysis and hemolytic anemia.
References :

  1. Luzzatto L, Seneca E: G6PD deficiency: a classic example of pharmacogenetics with on-going clinical implications. Br J Haematol. 2014 Feb;164(4):469-80. doi: 10.1111/bjh.12665. Epub 2013 Dec 28. [PubMed:24372186 ]
  2. Aczone® (dapsone) Gel[package insert]. Irvine, California: Allergan, Inc.; 2016. [Link]

PMID: 6317396

Dapsone

By

Dapsone

Product: Dansyl chloride

Identifier : DBSNPE001366
Drug : DB00250 (Dapsone)
Interacting Gene/Enzyme : Glucose-6-phosphate 1-dehydrogenase
Gene Name : G6PD
UniProt ID : P11413
Defining Change(s) :

  • 929G->A

Allele Name : Ludhiana
Genotype(s) : Not Available
Type(s) : ADR Inferred
Groups : G6PD deficiency
Description : Increased risk of hemolysis and hemolytic anemia.
References :

  1. Luzzatto L, Seneca E: G6PD deficiency: a classic example of pharmacogenetics with on-going clinical implications. Br J Haematol. 2014 Feb;164(4):469-80. doi: 10.1111/bjh.12665. Epub 2013 Dec 28. [PubMed:24372186 ]
  2. Aczone® (dapsone) Gel[package insert]. Irvine, California: Allergan, Inc.; 2016. [Link]

PMID: 27897203

Dapsone

By

Dapsone

Product: 3,6-Dichlorotrimellitic acid

Identifier : DBSNPE001367
Drug : DB00250 (Dapsone)
Interacting Gene/Enzyme : Glucose-6-phosphate 1-dehydrogenase
Gene Name : G6PD
UniProt ID : P11413
Defining Change(s) :

  • 977C->A

Allele Name : Farroupilha
Genotype(s) : Not Available
Type(s) : ADR Inferred
Groups : G6PD deficiency
Description : Increased risk of hemolysis and hemolytic anemia.
References :

  1. Luzzatto L, Seneca E: G6PD deficiency: a classic example of pharmacogenetics with on-going clinical implications. Br J Haematol. 2014 Feb;164(4):469-80. doi: 10.1111/bjh.12665. Epub 2013 Dec 28. [PubMed:24372186 ]
  2. Aczone® (dapsone) Gel[package insert]. Irvine, California: Allergan, Inc.; 2016. [Link]

PMID: 25080584

Dapsone

By

Dapsone

Product: 3,6-Dichlorotrimellitic anhydride

Identifier : DBSNPE001368
Drug : DB00250 (Dapsone)
Interacting Gene/Enzyme : Glucose-6-phosphate 1-dehydrogenase
Gene Name : G6PD
UniProt ID : P11413
Defining Change(s) :

  • 1024C->T

Allele Name : Chinese-5
Genotype(s) : Not Available
Type(s) : ADR Inferred
Groups : G6PD deficiency
Description : Increased risk of hemolysis and hemolytic anemia.
References :

  1. Luzzatto L, Seneca E: G6PD deficiency: a classic example of pharmacogenetics with on-going clinical implications. Br J Haematol. 2014 Feb;164(4):469-80. doi: 10.1111/bjh.12665. Epub 2013 Dec 28. [PubMed:24372186 ]
  2. Aczone® (dapsone) Gel[package insert]. Irvine, California: Allergan, Inc.; 2016. [Link]

PMID: 2478895

Dapsone

By

Dapsone

Product: CY3-N3

Identifier : DBSNPE001369
Drug : DB00250 (Dapsone)
Interacting Gene/Enzyme : Glucose-6-phosphate 1-dehydrogenase
Gene Name : G6PD
UniProt ID : P11413
Defining Change(s) :

  • 130G>A

Allele Name : Rignano
Genotype(s) : Not Available
Type(s) : ADR Inferred
Groups : G6PD deficiency
Description : Increased risk of hemolysis and hemolytic anemia.
References :

  1. Luzzatto L, Seneca E: G6PD deficiency: a classic example of pharmacogenetics with on-going clinical implications. Br J Haematol. 2014 Feb;164(4):469-80. doi: 10.1111/bjh.12665. Epub 2013 Dec 28. [PubMed:24372186 ]
  2. Aczone® (dapsone) Gel[package insert]. Irvine, California: Allergan, Inc.; 2016. [Link]

PMID: 2765936

Dapsone

By

Dapsone

Product: Calcein (tetraethyl ester)

Identifier : DBSNPE001370
Drug : DB00250 (Dapsone)
Interacting Gene/Enzyme : Glucose-6-phosphate 1-dehydrogenase
Gene Name : G6PD
UniProt ID : P11413
Defining Change(s) :

  • 131C->G

Allele Name : Orissa
Genotype(s) : Not Available
Type(s) : ADR Inferred
Groups : G6PD deficiency
Description : Increased risk of hemolysis and hemolytic anemia.
References :

  1. Luzzatto L, Seneca E: G6PD deficiency: a classic example of pharmacogenetics with on-going clinical implications. Br J Haematol. 2014 Feb;164(4):469-80. doi: 10.1111/bjh.12665. Epub 2013 Dec 28. [PubMed:24372186 ]
  2. Aczone® (dapsone) Gel[package insert]. Irvine, California: Allergan, Inc.; 2016. [Link]

PMID: 2498110

Dapsone

By

Dapsone

Product: CY7

Identifier : DBSNPE001371
Drug : DB00250 (Dapsone)
Interacting Gene/Enzyme : Glucose-6-phosphate 1-dehydrogenase
Gene Name : G6PD
UniProt ID : P11413
Defining Change(s) :

  • 1380G>C

Allele Name : G6PDNice
Genotype(s) : Not Available
Type(s) : ADR Inferred
Groups : G6PD deficiency
Description : Increased risk of hemolysis and hemolytic anemia.
References :

  1. Luzzatto L, Seneca E: G6PD deficiency: a classic example of pharmacogenetics with on-going clinical implications. Br J Haematol. 2014 Feb;164(4):469-80. doi: 10.1111/bjh.12665. Epub 2013 Dec 28. [PubMed:24372186 ]
  2. Aczone® (dapsone) Gel[package insert]. Irvine, California: Allergan, Inc.; 2016. [Link]

PMID: 3032657

Dapsone

By

Dapsone

Product: CY7-SE

Identifier : DBSNPE001372
Drug : DB00250 (Dapsone)
Interacting Gene/Enzyme : Glucose-6-phosphate 1-dehydrogenase
Gene Name : G6PD
UniProt ID : P11413
Defining Change(s) :

  • 1387C->T

Allele Name : Kamiube, Keelung
Genotype(s) : Not Available
Type(s) : ADR Inferred
Groups : G6PD deficiency
Description : Increased risk of hemolysis and hemolytic anemia.
References :

  1. Luzzatto L, Seneca E: G6PD deficiency: a classic example of pharmacogenetics with on-going clinical implications. Br J Haematol. 2014 Feb;164(4):469-80. doi: 10.1111/bjh.12665. Epub 2013 Dec 28. [PubMed:24372186 ]
  2. Aczone® (dapsone) Gel[package insert]. Irvine, California: Allergan, Inc.; 2016. [Link]

PMID: 22583860

Dapsone

By

Dapsone

Product: CY3-SE

Identifier : DBSNPE001373
Drug : DB00250 (Dapsone)
Interacting Gene/Enzyme : Glucose-6-phosphate 1-dehydrogenase
Gene Name : G6PD
UniProt ID : P11413
Defining Change(s) :

  • 1400C->G

Allele Name : Neapolis
Genotype(s) : Not Available
Type(s) : ADR Inferred
Groups : G6PD deficiency
Description : Increased risk of hemolysis and hemolytic anemia.
References :

  1. Luzzatto L, Seneca E: G6PD deficiency: a classic example of pharmacogenetics with on-going clinical implications. Br J Haematol. 2014 Feb;164(4):469-80. doi: 10.1111/bjh.12665. Epub 2013 Dec 28. [PubMed:24372186 ]
  2. Aczone® (dapsone) Gel[package insert]. Irvine, California: Allergan, Inc.; 2016. [Link]

PMID: 22297173

Dapsone

By

Dapsone

Product: CY3

Identifier : DBSNPE001374
Drug : DB00250 (Dapsone)
Interacting Gene/Enzyme : Glucose-6-phosphate 1-dehydrogenase
Gene Name : G6PD
UniProt ID : P11413
Defining Change(s) :

  • 143T->C

Allele Name : Aures
Genotype(s) : Not Available
Type(s) : ADR Inferred
Groups : G6PD deficiency
Description : Increased risk of hemolysis and hemolytic anemia.
References :

  1. Luzzatto L, Seneca E: G6PD deficiency: a classic example of pharmacogenetics with on-going clinical implications. Br J Haematol. 2014 Feb;164(4):469-80. doi: 10.1111/bjh.12665. Epub 2013 Dec 28. [PubMed:24372186 ]
  2. Aczone® (dapsone) Gel[package insert]. Irvine, California: Allergan, Inc.; 2016. [Link]

PMID: 19837095

Dapsone

By

Dapsone

Product: CY5

Identifier : DBSNPE001375
Drug : DB00250 (Dapsone)
Interacting Gene/Enzyme : Glucose-6-phosphate 1-dehydrogenase
Gene Name : G6PD
UniProt ID : P11413
Defining Change(s) :

  • 1442C->G

Allele Name : Split
Genotype(s) : Not Available
Type(s) : ADR Inferred
Groups : G6PD deficiency
Description : Increased risk of hemolysis and hemolytic anemia.
References :

  1. Luzzatto L, Seneca E: G6PD deficiency: a classic example of pharmacogenetics with on-going clinical implications. Br J Haematol. 2014 Feb;164(4):469-80. doi: 10.1111/bjh.12665. Epub 2013 Dec 28. [PubMed:24372186 ]
  2. Aczone® (dapsone) Gel[package insert]. Irvine, California: Allergan, Inc.; 2016. [Link]

PMID: 1326631

Dapsone

By

Dapsone

Product: CY5-YNE

Identifier : DBSNPE001376
Drug : DB00250 (Dapsone)
Interacting Gene/Enzyme : Glucose-6-phosphate 1-dehydrogenase
Gene Name : G6PD
UniProt ID : P11413
Defining Change(s) :

  • 148C->T

Allele Name : Kambos
Genotype(s) : Not Available
Type(s) : ADR Inferred
Groups : G6PD deficiency
Description : Increased risk of hemolysis and hemolytic anemia.
References :

  1. Luzzatto L, Seneca E: G6PD deficiency: a classic example of pharmacogenetics with on-going clinical implications. Br J Haematol. 2014 Feb;164(4):469-80. doi: 10.1111/bjh.12665. Epub 2013 Dec 28. [PubMed:24372186 ]
  2. Aczone® (dapsone) Gel[package insert]. Irvine, California: Allergan, Inc.; 2016. [Link]

PMID: 8411007

Dapsone

By

Dapsone

Product: CY5-SE

Identifier : DBSNPE001377
Drug : DB00250 (Dapsone)
Interacting Gene/Enzyme : Glucose-6-phosphate 1-dehydrogenase
Gene Name : G6PD
UniProt ID : P11413
Defining Change(s) :

  • 170G>A

Allele Name : Palesdivina
Genotype(s) : Not Available
Type(s) : ADR Inferred
Groups : G6PD deficiency
Description : Increased risk of hemolysis and hemolytic anemia.
References :

  1. Luzzatto L, Seneca E: G6PD deficiency: a classic example of pharmacogenetics with on-going clinical implications. Br J Haematol. 2014 Feb;164(4):469-80. doi: 10.1111/bjh.12665. Epub 2013 Dec 28. [PubMed:24372186 ]
  2. Aczone® (dapsone) Gel[package insert]. Irvine, California: Allergan, Inc.; 2016. [Link]

PMID: 10063485

Dapsone

By

Dapsone

Product: CY3-YNE

Identifier : DBSNPE001378
Drug : DB00250 (Dapsone)
Interacting Gene/Enzyme : Glucose-6-phosphate 1-dehydrogenase
Gene Name : G6PD
UniProt ID : P11413
Defining Change(s) :

  • 172G->A

Allele Name : Metaponto
Genotype(s) : Not Available
Type(s) : ADR Inferred
Groups : G6PD deficiency
Description : Increased risk of hemolysis and hemolytic anemia.
References :

  1. Luzzatto L, Seneca E: G6PD deficiency: a classic example of pharmacogenetics with on-going clinical implications. Br J Haematol. 2014 Feb;164(4):469-80. doi: 10.1111/bjh.12665. Epub 2013 Dec 28. [PubMed:24372186 ]
  2. Aczone® (dapsone) Gel[package insert]. Irvine, California: Allergan, Inc.; 2016. [Link]

PMID: 10667451

Dapsone

By

Dapsone

Product: 5-ROX

Identifier : DBSNPE001379
Drug : DB00250 (Dapsone)
Interacting Gene/Enzyme : Glucose-6-phosphate 1-dehydrogenase
Gene Name : G6PD
UniProt ID : P11413
Defining Change(s) :

  • 185C->T

Allele Name : Musashino
Genotype(s) : Not Available
Type(s) : ADR Inferred
Groups : G6PD deficiency
Description : Increased risk of hemolysis and hemolytic anemia.
References :

  1. Luzzatto L, Seneca E: G6PD deficiency: a classic example of pharmacogenetics with on-going clinical implications. Br J Haematol. 2014 Feb;164(4):469-80. doi: 10.1111/bjh.12665. Epub 2013 Dec 28. [PubMed:24372186 ]
  2. Aczone® (dapsone) Gel[package insert]. Irvine, California: Allergan, Inc.; 2016. [Link]

PMID: 7196507

Dapsone

By

Dapsone

Product: 6-ROX

Identifier : DBSNPE001380
Drug : DB00250 (Dapsone)
Interacting Gene/Enzyme : Glucose-6-phosphate 1-dehydrogenase
Gene Name : G6PD
UniProt ID : P11413
Defining Change(s) :

  • 202G->A

Allele Name : Asahi
Genotype(s) : Not Available
Type(s) : ADR Inferred
Groups : G6PD deficiency
Description : Increased risk of hemolysis and hemolytic anemia.
References :

  1. Luzzatto L, Seneca E: G6PD deficiency: a classic example of pharmacogenetics with on-going clinical implications. Br J Haematol. 2014 Feb;164(4):469-80. doi: 10.1111/bjh.12665. Epub 2013 Dec 28. [PubMed:24372186 ]
  2. Aczone® (dapsone) Gel[package insert]. Irvine, California: Allergan, Inc.; 2016. [Link]

PMID: 24586687

Dapsone

By

Dapsone

Product: 5(6)-ROX

Identifier : DBSNPE001381
Drug : DB00250 (Dapsone)
Interacting Gene/Enzyme : Glucose-6-phosphate 1-dehydrogenase
Gene Name : G6PD
UniProt ID : P11413
Defining Change(s) :

  • 202G->A
  • 376A->G

Allele Name : A- (202), Ferrara I
Genotype(s) : Not Available
Type(s) : ADR Inferred
Groups : G6PD deficiency
Description : Increased risk of hemolysis and hemolytic anemia.
References :

  1. Luzzatto L, Seneca E: G6PD deficiency: a classic example of pharmacogenetics with on-going clinical implications. Br J Haematol. 2014 Feb;164(4):469-80. doi: 10.1111/bjh.12665. Epub 2013 Dec 28. [PubMed:24372186 ]
  2. Aczone® (dapsone) Gel[package insert]. Irvine, California: Allergan, Inc.; 2016. [Link]

PMID: 23902941

Dapsone

By

Dapsone

Product: ONO-4059 (analog)

Identifier : DBSNPE001382
Drug : DB00250 (Dapsone)
Interacting Gene/Enzyme : Glucose-6-phosphate 1-dehydrogenase
Gene Name : G6PD
UniProt ID : P11413
Defining Change(s) :

  • 209A->G

Allele Name : Murcia Oristano
Genotype(s) : Not Available
Type(s) : ADR Inferred
Groups : G6PD deficiency
Description : Increased risk of hemolysis and hemolytic anemia.
References :

  1. Luzzatto L, Seneca E: G6PD deficiency: a classic example of pharmacogenetics with on-going clinical implications. Br J Haematol. 2014 Feb;164(4):469-80. doi: 10.1111/bjh.12665. Epub 2013 Dec 28. [PubMed:24372186 ]
  2. Aczone® (dapsone) Gel[package insert]. Irvine, California: Allergan, Inc.; 2016. [Link]

PMID: 21912668

Dapsone

By

Dapsone

Product: LY354740

Identifier : DBSNPE001383
Drug : DB00250 (Dapsone)
Interacting Gene/Enzyme : Glucose-6-phosphate 1-dehydrogenase
Gene Name : G6PD
UniProt ID : P11413
Defining Change(s) :

  • 241C->T

Allele Name : Ube Konan
Genotype(s) : Not Available
Type(s) : ADR Inferred
Groups : G6PD deficiency
Description : Increased risk of hemolysis and hemolytic anemia.
References :

  1. Luzzatto L, Seneca E: G6PD deficiency: a classic example of pharmacogenetics with on-going clinical implications. Br J Haematol. 2014 Feb;164(4):469-80. doi: 10.1111/bjh.12665. Epub 2013 Dec 28. [PubMed:24372186 ]
  2. Aczone® (dapsone) Gel[package insert]. Irvine, California: Allergan, Inc.; 2016. [Link]

PMID: 21270945

Dapsone

By

Dapsone

Product: Cilobradine (hydrochloride)

Identifier : DBSNPE001384
Drug : DB00250 (Dapsone)
Interacting Gene/Enzyme : Glucose-6-phosphate 1-dehydrogenase
Gene Name : G6PD
UniProt ID : P11413
Defining Change(s) :

  • 242G->A

Allele Name : Lagosanto
Genotype(s) : Not Available
Type(s) : ADR Inferred
Groups : G6PD deficiency
Description : Increased risk of hemolysis and hemolytic anemia.
References :

  1. Luzzatto L, Seneca E: G6PD deficiency: a classic example of pharmacogenetics with on-going clinical implications. Br J Haematol. 2014 Feb;164(4):469-80. doi: 10.1111/bjh.12665. Epub 2013 Dec 28. [PubMed:24372186 ]
  2. Aczone® (dapsone) Gel[package insert]. Irvine, California: Allergan, Inc.; 2016. [Link]

PMID: 9723942

Dapsone

By

Dapsone

Product: N6-Cyclohexyladenosine

Identifier : DBSNPE001385
Drug : DB00250 (Dapsone)
Interacting Gene/Enzyme : Glucose-6-phosphate 1-dehydrogenase
Gene Name : G6PD
UniProt ID : P11413
Defining Change(s) :

  • 274C->T

Allele Name : Guangzhou
Genotype(s) : Not Available
Type(s) : ADR Inferred
Groups : G6PD deficiency
Description : Increased risk of hemolysis and hemolytic anemia.
References :

  1. Luzzatto L, Seneca E: G6PD deficiency: a classic example of pharmacogenetics with on-going clinical implications. Br J Haematol. 2014 Feb;164(4):469-80. doi: 10.1111/bjh.12665. Epub 2013 Dec 28. [PubMed:24372186 ]
  2. Aczone® (dapsone) Gel[package insert]. Irvine, California: Allergan, Inc.; 2016. [Link]

PMID: 15231642

Dapsone

By

Dapsone

Product: WEHI-345

Identifier : DBSNPE001386
Drug : DB00250 (Dapsone)
Interacting Gene/Enzyme : Glucose-6-phosphate 1-dehydrogenase
Gene Name : G6PD
UniProt ID : P11413
Defining Change(s) :

  • 323T->A

Allele Name : Hammersmith
Genotype(s) : Not Available
Type(s) : ADR Inferred
Groups : G6PD deficiency
Description : Increased risk of hemolysis and hemolytic anemia.
References :

  1. Luzzatto L, Seneca E: G6PD deficiency: a classic example of pharmacogenetics with on-going clinical implications. Br J Haematol. 2014 Feb;164(4):469-80. doi: 10.1111/bjh.12665. Epub 2013 Dec 28. [PubMed:24372186 ]
  2. Aczone® (dapsone) Gel[package insert]. Irvine, California: Allergan, Inc.; 2016. [Link]

PMID: 12624814

Dapsone

By

Dapsone

Product: UMI-77

Identifier : DBSNPE001387
Drug : DB00250 (Dapsone)
Interacting Gene/Enzyme : Glucose-6-phosphate 1-dehydrogenase
Gene Name : G6PD
UniProt ID : P11413
Defining Change(s) :

  • 34G->T

Allele Name : Sinnai
Genotype(s) : Not Available
Type(s) : ADR Inferred
Groups : G6PD deficiency
Description : Increased risk of hemolysis and hemolytic anemia.
References :

  1. Luzzatto L, Seneca E: G6PD deficiency: a classic example of pharmacogenetics with on-going clinical implications. Br J Haematol. 2014 Feb;164(4):469-80. doi: 10.1111/bjh.12665. Epub 2013 Dec 28. [PubMed:24372186 ]
  2. Aczone® (dapsone) Gel[package insert]. Irvine, California: Allergan, Inc.; 2016. [Link]

PMID: 2836213

Dapsone

By

Dapsone

Product: OTS514

Identifier : DBSNPE001388
Drug : DB00250 (Dapsone)
Interacting Gene/Enzyme : Glucose-6-phosphate 1-dehydrogenase
Gene Name : G6PD
UniProt ID : P11413
Defining Change(s) :

  • 376A->G
  • 680G->T

Allele Name : A- (680)
Genotype(s) : Not Available
Type(s) : ADR Inferred
Groups : G6PD deficiency
Description : Increased risk of hemolysis and hemolytic anemia.
References :

  1. Luzzatto L, Seneca E: G6PD deficiency: a classic example of pharmacogenetics with on-going clinical implications. Br J Haematol. 2014 Feb;164(4):469-80. doi: 10.1111/bjh.12665. Epub 2013 Dec 28. [PubMed:24372186 ]
  2. Aczone® (dapsone) Gel[package insert]. Irvine, California: Allergan, Inc.; 2016. [Link]

PMID: 17046030

Dapsone

By

Dapsone

Product: IB-MECA

Identifier : DBSNPE001389
Drug : DB00250 (Dapsone)
Interacting Gene/Enzyme : Glucose-6-phosphate 1-dehydrogenase
Gene Name : G6PD
UniProt ID : P11413
Defining Change(s) :

  • 376A->G
  • 968T->C

Allele Name : A- (968), Betica,Selma, Guantanamo
Genotype(s) : Not Available
Type(s) : ADR Inferred
Groups : G6PD deficiency
Description : Increased risk of hemolysis and hemolytic anemia.
References :

  1. Luzzatto L, Seneca E: G6PD deficiency: a classic example of pharmacogenetics with on-going clinical implications. Br J Haematol. 2014 Feb;164(4):469-80. doi: 10.1111/bjh.12665. Epub 2013 Dec 28. [PubMed:24372186 ]
  2. Aczone® (dapsone) Gel[package insert]. Irvine, California: Allergan, Inc.; 2016. [Link]

PMID: 9804628

Dapsone

By

Dapsone

Product: Paritaprevir

Identifier : DBSNPE001390
Drug : DB00250 (Dapsone)
Interacting Gene/Enzyme : Glucose-6-phosphate 1-dehydrogenase
Gene Name : G6PD
UniProt ID : P11413
Defining Change(s) :

  • 383T>G

Allele Name : Salerno Pyrgos
Genotype(s) : Not Available
Type(s) : ADR Inferred
Groups : G6PD deficiency
Description : Increased risk of hemolysis and hemolytic anemia.
References :

  1. Luzzatto L, Seneca E: G6PD deficiency: a classic example of pharmacogenetics with on-going clinical implications. Br J Haematol. 2014 Feb;164(4):469-80. doi: 10.1111/bjh.12665. Epub 2013 Dec 28. [PubMed:24372186 ]
  2. Aczone® (dapsone) Gel[package insert]. Irvine, California: Allergan, Inc.; 2016. [Link]

PMID: 9014149

Dapsone

By

Dapsone

Product: OTS-964

Identifier : DBSNPE001391
Drug : DB00250 (Dapsone)
Interacting Gene/Enzyme : Glucose-6-phosphate 1-dehydrogenase
Gene Name : G6PD
UniProt ID : P11413
Defining Change(s) :

  • 392G->T

Allele Name : Quing Yan
Genotype(s) : Not Available
Type(s) : ADR Inferred
Groups : G6PD deficiency
Description : Increased risk of hemolysis and hemolytic anemia.
References :

  1. Luzzatto L, Seneca E: G6PD deficiency: a classic example of pharmacogenetics with on-going clinical implications. Br J Haematol. 2014 Feb;164(4):469-80. doi: 10.1111/bjh.12665. Epub 2013 Dec 28. [PubMed:24372186 ]
  2. Aczone® (dapsone) Gel[package insert]. Irvine, California: Allergan, Inc.; 2016. [Link]

PMID: 23380687

Dapsone

By

Dapsone

Product: Kenpaullone

Identifier : DBSNPE001392
Drug : DB00250 (Dapsone)
Interacting Gene/Enzyme : Glucose-6-phosphate 1-dehydrogenase
Gene Name : G6PD
UniProt ID : P11413
Defining Change(s) :

  • 40G->A

Allele Name : Lages
Genotype(s) : Not Available
Type(s) : ADR Inferred
Groups : G6PD deficiency
Description : Increased risk of hemolysis and hemolytic anemia.
References :

  1. Luzzatto L, Seneca E: G6PD deficiency: a classic example of pharmacogenetics with on-going clinical implications. Br J Haematol. 2014 Feb;164(4):469-80. doi: 10.1111/bjh.12665. Epub 2013 Dec 28. [PubMed:24372186 ]
  2. Aczone® (dapsone) Gel[package insert]. Irvine, California: Allergan, Inc.; 2016. [Link]

PMID: 23126673

Dapsone

By

Dapsone

Product: Oritavancin (diphosphate)

Identifier : DBSNPE001393
Drug : DB00250 (Dapsone)
Interacting Gene/Enzyme : Glucose-6-phosphate 1-dehydrogenase
Gene Name : G6PD
UniProt ID : P11413
Defining Change(s) :

  • 466G->A

Allele Name : Ilesha
Genotype(s) : Not Available
Type(s) : ADR Inferred
Groups : G6PD deficiency
Description : Increased risk of hemolysis and hemolytic anemia.
References :

  1. Luzzatto L, Seneca E: G6PD deficiency: a classic example of pharmacogenetics with on-going clinical implications. Br J Haematol. 2014 Feb;164(4):469-80. doi: 10.1111/bjh.12665. Epub 2013 Dec 28. [PubMed:24372186 ]
  2. Aczone® (dapsone) Gel[package insert]. Irvine, California: Allergan, Inc.; 2016. [Link]

PMID: 18175099

Dapsone

By

Dapsone

Product: PF-4840154

Identifier : DBSNPE001394
Drug : DB00250 (Dapsone)
Interacting Gene/Enzyme : Glucose-6-phosphate 1-dehydrogenase
Gene Name : G6PD
UniProt ID : P11413
Defining Change(s) :

  • 487G->A

Allele Name : Mahidol
Genotype(s) : Not Available
Type(s) : ADR Inferred
Groups : G6PD deficiency
Description : Increased risk of hemolysis and hemolytic anemia.
References :

  1. Luzzatto L, Seneca E: G6PD deficiency: a classic example of pharmacogenetics with on-going clinical implications. Br J Haematol. 2014 Feb;164(4):469-80. doi: 10.1111/bjh.12665. Epub 2013 Dec 28. [PubMed:24372186 ]
  2. Aczone® (dapsone) Gel[package insert]. Irvine, California: Allergan, Inc.; 2016. [Link]

PMID: 3161005

Dapsone

By

Dapsone

Product: A2AR-agonist-1

Identifier : DBSNPE001395
Drug : DB00250 (Dapsone)
Interacting Gene/Enzyme : Glucose-6-phosphate 1-dehydrogenase
Gene Name : G6PD
UniProt ID : P11413
Defining Change(s) :

  • 542A->T

Allele Name : Malaga
Genotype(s) : Not Available
Type(s) : ADR Inferred
Groups : G6PD deficiency
Description : Increased risk of hemolysis and hemolytic anemia.
References :

  1. Luzzatto L, Seneca E: G6PD deficiency: a classic example of pharmacogenetics with on-going clinical implications. Br J Haematol. 2014 Feb;164(4):469-80. doi: 10.1111/bjh.12665. Epub 2013 Dec 28. [PubMed:24372186 ]
  2. Aczone® (dapsone) Gel[package insert]. Irvine, California: Allergan, Inc.; 2016. [Link]

PMID: 8913357

Dapsone

By

Dapsone

Product: N6-(4-Hydroxybenzyl)adenosine

Identifier : DBSNPE001396
Drug : DB00250 (Dapsone)
Interacting Gene/Enzyme : Glucose-6-phosphate 1-dehydrogenase
Gene Name : G6PD
UniProt ID : P11413
Defining Change(s) :

  • 634A->G

Allele Name : Sibari
Genotype(s) : Not Available
Type(s) : ADR Inferred
Groups : G6PD deficiency
Description : Increased risk of hemolysis and hemolytic anemia.
References :

  1. Luzzatto L, Seneca E: G6PD deficiency: a classic example of pharmacogenetics with on-going clinical implications. Br J Haematol. 2014 Feb;164(4):469-80. doi: 10.1111/bjh.12665. Epub 2013 Dec 28. [PubMed:24372186 ]
  2. Aczone® (dapsone) Gel[package insert]. Irvine, California: Allergan, Inc.; 2016. [Link]

PMID: 1311690

Dapsone

By

Dapsone

Product: O4I2

Identifier : DBSNPE001397
Drug : DB00250 (Dapsone)
Interacting Gene/Enzyme : Glucose-6-phosphate 1-dehydrogenase
Gene Name : G6PD
UniProt ID : P11413
Defining Change(s) :

  • 680G->A

Allele Name : Mexico City
Genotype(s) : Not Available
Type(s) : ADR Inferred
Groups : G6PD deficiency
Description : Increased risk of hemolysis and hemolytic anemia.
References :

  1. Luzzatto L, Seneca E: G6PD deficiency: a classic example of pharmacogenetics with on-going clinical implications. Br J Haematol. 2014 Feb;164(4):469-80. doi: 10.1111/bjh.12665. Epub 2013 Dec 28. [PubMed:24372186 ]
  2. Aczone® (dapsone) Gel[package insert]. Irvine, California: Allergan, Inc.; 2016. [Link]

PMID: 3022383

Dapsone

By

Dapsone

Product: Quisinostat

Identifier : DBSNPE001398
Drug : DB00250 (Dapsone)
Interacting Gene/Enzyme : Glucose-6-phosphate 1-dehydrogenase
Gene Name : G6PD
UniProt ID : P11413
Defining Change(s) :

  • 703C->T

Allele Name : Nanning
Genotype(s) : Not Available
Type(s) : ADR Inferred
Groups : G6PD deficiency
Description : Increased risk of hemolysis and hemolytic anemia.
References :

  1. Luzzatto L, Seneca E: G6PD deficiency: a classic example of pharmacogenetics with on-going clinical implications. Br J Haematol. 2014 Feb;164(4):469-80. doi: 10.1111/bjh.12665. Epub 2013 Dec 28. [PubMed:24372186 ]
  2. Aczone® (dapsone) Gel[package insert]. Irvine, California: Allergan, Inc.; 2016. [Link]

PMID: 26612620

Dapsone

By

Dapsone

Product: O4I1

Identifier : DBSNPE001399
Drug : DB00250 (Dapsone)
Interacting Gene/Enzyme : Glucose-6-phosphate 1-dehydrogenase
Gene Name : G6PD
UniProt ID : P11413
Defining Change(s) :

  • 844G->C

Allele Name : Seattle, Lodi, Modena, Ferrara II, Athens-like
Genotype(s) : Not Available
Type(s) : ADR Inferred
Groups : G6PD deficiency
Description : Increased risk of hemolysis and hemolytic anemia.
References :

  1. Luzzatto L, Seneca E: G6PD deficiency: a classic example of pharmacogenetics with on-going clinical implications. Br J Haematol. 2014 Feb;164(4):469-80. doi: 10.1111/bjh.12665. Epub 2013 Dec 28. [PubMed:24372186 ]
  2. Aczone® (dapsone) Gel[package insert]. Irvine, California: Allergan, Inc.; 2016. [Link]

PMID: 9518641

Dapsone

By

Dapsone

Product: Solithromycin

Identifier : DBSNPE001400
Drug : DB00250 (Dapsone)
Interacting Gene/Enzyme : Glucose-6-phosphate 1-dehydrogenase
Gene Name : G6PD
UniProt ID : P11413
Defining Change(s) :

  • 844G->T

Allele Name : Bajo Maumere
Genotype(s) : Not Available
Type(s) : ADR Inferred
Groups : G6PD deficiency
Description : Increased risk of hemolysis and hemolytic anemia.
References :

  1. Luzzatto L, Seneca E: G6PD deficiency: a classic example of pharmacogenetics with on-going clinical implications. Br J Haematol. 2014 Feb;164(4):469-80. doi: 10.1111/bjh.12665. Epub 2013 Dec 28. [PubMed:24372186 ]
  2. Aczone® (dapsone) Gel[package insert]. Irvine, California: Allergan, Inc.; 2016. [Link]

PMID: 7562476

Dapsone

By

Dapsone

Product: ROR gamma-t-IN-1

Identifier : DBSNPE001401
Drug : DB00250 (Dapsone)
Interacting Gene/Enzyme : Glucose-6-phosphate 1-dehydrogenase
Gene Name : G6PD
UniProt ID : P11413
Defining Change(s) :

  • 854G->A

Allele Name : Montalbano
Genotype(s) : Not Available
Type(s) : ADR Inferred
Groups : G6PD deficiency
Description : Increased risk of hemolysis and hemolytic anemia.
References :

  1. Luzzatto L, Seneca E: G6PD deficiency: a classic example of pharmacogenetics with on-going clinical implications. Br J Haematol. 2014 Feb;164(4):469-80. doi: 10.1111/bjh.12665. Epub 2013 Dec 28. [PubMed:24372186 ]
  2. Aczone® (dapsone) Gel[package insert]. Irvine, California: Allergan, Inc.; 2016. [Link]

PMID: 8905326

Dapsone

By

Dapsone

Product: ISX-9

Identifier : DBSNPE001402
Drug : DB00250 (Dapsone)
Interacting Gene/Enzyme : Glucose-6-phosphate 1-dehydrogenase
Gene Name : G6PD
UniProt ID : P11413
Defining Change(s) :

  • 949G->A

Allele Name : Kalyan-Kerala, Jamnaga, Rohini
Genotype(s) : Not Available
Type(s) : ADR Inferred
Groups : G6PD deficiency
Description : Increased risk of hemolysis and hemolytic anemia.
References :

  1. Luzzatto L, Seneca E: G6PD deficiency: a classic example of pharmacogenetics with on-going clinical implications. Br J Haematol. 2014 Feb;164(4):469-80. doi: 10.1111/bjh.12665. Epub 2013 Dec 28. [PubMed:24372186 ]
  2. Aczone® (dapsone) Gel[package insert]. Irvine, California: Allergan, Inc.; 2016. [Link]

PMID: 8592655

Dapsone

By

Dapsone

Product: Cabotegravir

Identifier : DBSNPE001403
Drug : DB00250 (Dapsone)
Interacting Gene/Enzyme : Glucose-6-phosphate 1-dehydrogenase
Gene Name : G6PD
UniProt ID : P11413
Defining Change(s) :

  • 95A->G

Allele Name : Gaohe
Genotype(s) : Not Available
Type(s) : ADR Inferred
Groups : G6PD deficiency
Description : Increased risk of hemolysis and hemolytic anemia.
References :

  1. Luzzatto L, Seneca E: G6PD deficiency: a classic example of pharmacogenetics with on-going clinical implications. Br J Haematol. 2014 Feb;164(4):469-80. doi: 10.1111/bjh.12665. Epub 2013 Dec 28. [PubMed:24372186 ]
  2. Aczone® (dapsone) Gel[package insert]. Irvine, California: Allergan, Inc.; 2016. [Link]

PMID: 9651158

By

Related Post

You Missed

Uncategorized

Scgb1a1 (Rat) Recombinant Protein

Uncategorized

MSTN (Human) Recombinant Protein

Uncategorized

FLT3LG (Human) Recombinant Protein (P01)

Uncategorized

Fgf9 (Rat) Recombinant Protein