PI3KInhibitorpi3kinhibitor

Dabrafenib

By

Dabrafenib

Product: 1-Naphthyl PP1 (hydrochloride)

Identifier : DBSNPE001062
Drug : DB08912 (Dabrafenib)
Interacting Gene/Enzyme : Glucose-6-phosphate 1-dehydrogenase
Gene Name : G6PD
UniProt ID : P11413
Defining Change(s) :

  • 1000_1002delACC

Allele Name : Villeurbanne
Genotype(s) : Not Available
Type(s) : ADR Inferred
Groups : G6PD deficiency
Description : Increased risk of hemolytic anemia.
References :

  1. Welsh SJ, Corrie PG: Management of BRAF and MEK inhibitor toxicities in patients with metastatic melanoma. Ther Adv Med Oncol. 2015 Mar;7(2):122-36. doi: 10.1177/1758834014566428. [PubMed:25755684 ]
  2. Tafinlar® (dabrafenib) capsules[package insert]. East Hanover, New Jersey: Novartis Pharmaceuticals Corporation; 2016. [Link]

PMID: 6325345

Dabrafenib

By

Dabrafenib

Product: Nastorazepide

Identifier : DBSNPE001063
Drug : DB08912 (Dabrafenib)
Interacting Gene/Enzyme : Glucose-6-phosphate 1-dehydrogenase
Gene Name : G6PD
UniProt ID : P11413
Defining Change(s) :

  • 1006A->G

Allele Name : Torun
Genotype(s) : Not Available
Type(s) : ADR Inferred
Groups : G6PD deficiency
Description : Increased risk of hemolytic anemia.
References :

  1. Welsh SJ, Corrie PG: Management of BRAF and MEK inhibitor toxicities in patients with metastatic melanoma. Ther Adv Med Oncol. 2015 Mar;7(2):122-36. doi: 10.1177/1758834014566428. [PubMed:25755684 ]
  2. Tafinlar® (dabrafenib) capsules[package insert]. East Hanover, New Jersey: Novartis Pharmaceuticals Corporation; 2016. [Link]

PMID: 45788

Dabrafenib

By

Dabrafenib

Product: NSC59984

Identifier : DBSNPE001064
Drug : DB08912 (Dabrafenib)
Interacting Gene/Enzyme : Glucose-6-phosphate 1-dehydrogenase
Gene Name : G6PD
UniProt ID : P11413
Defining Change(s) :

  • 105_107delCAT

Allele Name : Sunderland
Genotype(s) : Not Available
Type(s) : ADR Inferred
Groups : G6PD deficiency
Description : Increased risk of hemolytic anemia.
References :

  1. Welsh SJ, Corrie PG: Management of BRAF and MEK inhibitor toxicities in patients with metastatic melanoma. Ther Adv Med Oncol. 2015 Mar;7(2):122-36. doi: 10.1177/1758834014566428. [PubMed:25755684 ]
  2. Tafinlar® (dabrafenib) capsules[package insert]. East Hanover, New Jersey: Novartis Pharmaceuticals Corporation; 2016. [Link]

PMID: 19892704

Dabrafenib

By

Dabrafenib

Product: VU0361737

Identifier : DBSNPE001065
Drug : DB08912 (Dabrafenib)
Interacting Gene/Enzyme : Glucose-6-phosphate 1-dehydrogenase
Gene Name : G6PD
UniProt ID : P11413
Defining Change(s) :

  • 1081G->A

Allele Name : Iwatsuki
Genotype(s) : Not Available
Type(s) : ADR Inferred
Groups : G6PD deficiency
Description : Increased risk of hemolytic anemia.
References :

  1. Welsh SJ, Corrie PG: Management of BRAF and MEK inhibitor toxicities in patients with metastatic melanoma. Ther Adv Med Oncol. 2015 Mar;7(2):122-36. doi: 10.1177/1758834014566428. [PubMed:25755684 ]
  2. Tafinlar® (dabrafenib) capsules[package insert]. East Hanover, New Jersey: Novartis Pharmaceuticals Corporation; 2016. [Link]

PMID: 17229869

Dabrafenib

By

Dabrafenib

Product: LJI308

Identifier : DBSNPE001066
Drug : DB08912 (Dabrafenib)
Interacting Gene/Enzyme : Glucose-6-phosphate 1-dehydrogenase
Gene Name : G6PD
UniProt ID : P11413
Defining Change(s) :

  • 1082C->T

Allele Name : Serres
Genotype(s) : Not Available
Type(s) : ADR Inferred
Groups : G6PD deficiency
Description : Increased risk of hemolytic anemia.
References :

  1. Welsh SJ, Corrie PG: Management of BRAF and MEK inhibitor toxicities in patients with metastatic melanoma. Ther Adv Med Oncol. 2015 Mar;7(2):122-36. doi: 10.1177/1758834014566428. [PubMed:25755684 ]
  2. Tafinlar® (dabrafenib) capsules[package insert]. East Hanover, New Jersey: Novartis Pharmaceuticals Corporation; 2016. [Link]

PMID: 19282028

Dabrafenib

By

Dabrafenib

Product: CC-115 (hydrochloride)

Identifier : DBSNPE001067
Drug : DB08912 (Dabrafenib)
Interacting Gene/Enzyme : Glucose-6-phosphate 1-dehydrogenase
Gene Name : G6PD
UniProt ID : P11413
Defining Change(s) :

  • 1084_1101delCTGAACGAGCGCAAGGCC

Allele Name : Tondela
Genotype(s) : Not Available
Type(s) : ADR Inferred
Groups : G6PD deficiency
Description : Increased risk of hemolytic anemia.
References :

  1. Welsh SJ, Corrie PG: Management of BRAF and MEK inhibitor toxicities in patients with metastatic melanoma. Ther Adv Med Oncol. 2015 Mar;7(2):122-36. doi: 10.1177/1758834014566428. [PubMed:25755684 ]
  2. Tafinlar® (dabrafenib) capsules[package insert]. East Hanover, New Jersey: Novartis Pharmaceuticals Corporation; 2016. [Link]

PMID: 11435499

Dabrafenib

By

Dabrafenib

Product: DCVC

Identifier : DBSNPE001068
Drug : DB08912 (Dabrafenib)
Interacting Gene/Enzyme : Glucose-6-phosphate 1-dehydrogenase
Gene Name : G6PD
UniProt ID : P11413
Defining Change(s) :

  • 1089C->A

Allele Name : Loma Linda
Genotype(s) : Not Available
Type(s) : ADR Inferred
Groups : G6PD deficiency
Description : Increased risk of hemolytic anemia.
References :

  1. Welsh SJ, Corrie PG: Management of BRAF and MEK inhibitor toxicities in patients with metastatic melanoma. Ther Adv Med Oncol. 2015 Mar;7(2):122-36. doi: 10.1177/1758834014566428. [PubMed:25755684 ]
  2. Tafinlar® (dabrafenib) capsules[package insert]. East Hanover, New Jersey: Novartis Pharmaceuticals Corporation; 2016. [Link]

PMID: 23241962

Dabrafenib

By

Dabrafenib

Product: ATP-polyamine-biotin

Identifier : DBSNPE001069
Drug : DB08912 (Dabrafenib)
Interacting Gene/Enzyme : Glucose-6-phosphate 1-dehydrogenase
Gene Name : G6PD
UniProt ID : P11413
Defining Change(s) :

  • 1089C->G

Allele Name : Aachen
Genotype(s) : Not Available
Type(s) : ADR Inferred
Groups : G6PD deficiency
Description : Increased risk of hemolytic anemia.
References :

  1. Welsh SJ, Corrie PG: Management of BRAF and MEK inhibitor toxicities in patients with metastatic melanoma. Ther Adv Med Oncol. 2015 Mar;7(2):122-36. doi: 10.1177/1758834014566428. [PubMed:25755684 ]
  2. Tafinlar® (dabrafenib) capsules[package insert]. East Hanover, New Jersey: Novartis Pharmaceuticals Corporation; 2016. [Link]

PMID: 25365541

Dabrafenib

By

Dabrafenib

Product: Brilliant Blue FCF

Identifier : DBSNPE001070
Drug : DB08912 (Dabrafenib)
Interacting Gene/Enzyme : Glucose-6-phosphate 1-dehydrogenase
Gene Name : G6PD
UniProt ID : P11413
Defining Change(s) :

  • 1096A->G

Allele Name : Tenri
Genotype(s) : Not Available
Type(s) : ADR Inferred
Groups : G6PD deficiency
Description : Increased risk of hemolytic anemia.
References :

  1. Welsh SJ, Corrie PG: Management of BRAF and MEK inhibitor toxicities in patients with metastatic melanoma. Ther Adv Med Oncol. 2015 Mar;7(2):122-36. doi: 10.1177/1758834014566428. [PubMed:25755684 ]
  2. Tafinlar® (dabrafenib) capsules[package insert]. East Hanover, New Jersey: Novartis Pharmaceuticals Corporation; 2016. [Link]

PMID: 17652444

Dabrafenib

By

Dabrafenib

Product: Fast Green FCF

Identifier : DBSNPE001071
Drug : DB08912 (Dabrafenib)
Interacting Gene/Enzyme : Glucose-6-phosphate 1-dehydrogenase
Gene Name : G6PD
UniProt ID : P11413
Defining Change(s) :

  • 1132G>A

Allele Name : Montpellier
Genotype(s) : Not Available
Type(s) : ADR Inferred
Groups : G6PD deficiency
Description : Increased risk of hemolytic anemia.
References :

  1. Welsh SJ, Corrie PG: Management of BRAF and MEK inhibitor toxicities in patients with metastatic melanoma. Ther Adv Med Oncol. 2015 Mar;7(2):122-36. doi: 10.1177/1758834014566428. [PubMed:25755684 ]
  2. Tafinlar® (dabrafenib) capsules[package insert]. East Hanover, New Jersey: Novartis Pharmaceuticals Corporation; 2016. [Link]

PMID: 21095183

Dabrafenib

By

Dabrafenib

Product: Tartrazine

Identifier : DBSNPE001072
Drug : DB08912 (Dabrafenib)
Interacting Gene/Enzyme : Glucose-6-phosphate 1-dehydrogenase
Gene Name : G6PD
UniProt ID : P11413
Defining Change(s) :

  • 1138A->G

Allele Name : Calvo Mackenna
Genotype(s) : Not Available
Type(s) : ADR Inferred
Groups : G6PD deficiency
Description : Increased risk of hemolytic anemia.
References :

  1. Welsh SJ, Corrie PG: Management of BRAF and MEK inhibitor toxicities in patients with metastatic melanoma. Ther Adv Med Oncol. 2015 Mar;7(2):122-36. doi: 10.1177/1758834014566428. [PubMed:25755684 ]
  2. Tafinlar® (dabrafenib) capsules[package insert]. East Hanover, New Jersey: Novartis Pharmaceuticals Corporation; 2016. [Link]

PMID: 20107188

Dabrafenib

By

Dabrafenib

Product: Sunset Yellow FCF

Identifier : DBSNPE001073
Drug : DB08912 (Dabrafenib)
Interacting Gene/Enzyme : Glucose-6-phosphate 1-dehydrogenase
Gene Name : G6PD
UniProt ID : P11413
Defining Change(s) :

  • 1139T->C

Allele Name : Riley
Genotype(s) : Not Available
Type(s) : ADR Inferred
Groups : G6PD deficiency
Description : Increased risk of hemolytic anemia.
References :

  1. Welsh SJ, Corrie PG: Management of BRAF and MEK inhibitor toxicities in patients with metastatic melanoma. Ther Adv Med Oncol. 2015 Mar;7(2):122-36. doi: 10.1177/1758834014566428. [PubMed:25755684 ]
  2. Tafinlar® (dabrafenib) capsules[package insert]. East Hanover, New Jersey: Novartis Pharmaceuticals Corporation; 2016. [Link]

PMID: 16697190

Dabrafenib

By

Dabrafenib

Product: E-982

Identifier : DBSNPE001074
Drug : DB08912 (Dabrafenib)
Interacting Gene/Enzyme : Glucose-6-phosphate 1-dehydrogenase
Gene Name : G6PD
UniProt ID : P11413
Defining Change(s) :

  • 1141T->C

Allele Name : Olomouc
Genotype(s) : Not Available
Type(s) : ADR Inferred
Groups : G6PD deficiency
Description : Increased risk of hemolytic anemia.
References :

  1. Welsh SJ, Corrie PG: Management of BRAF and MEK inhibitor toxicities in patients with metastatic melanoma. Ther Adv Med Oncol. 2015 Mar;7(2):122-36. doi: 10.1177/1758834014566428. [PubMed:25755684 ]
  2. Tafinlar® (dabrafenib) capsules[package insert]. East Hanover, New Jersey: Novartis Pharmaceuticals Corporation; 2016. [Link]

PMID: 12410796

Dabrafenib

By

Dabrafenib

Product: D-JNKI-1

Identifier : DBSNPE001075
Drug : DB08912 (Dabrafenib)
Interacting Gene/Enzyme : Glucose-6-phosphate 1-dehydrogenase
Gene Name : G6PD
UniProt ID : P11413
Defining Change(s) :

  • 1153T->C

Allele Name : Tomah
Genotype(s) : Not Available
Type(s) : ADR Inferred
Groups : G6PD deficiency
Description : Increased risk of hemolytic anemia.
References :

  1. Welsh SJ, Corrie PG: Management of BRAF and MEK inhibitor toxicities in patients with metastatic melanoma. Ther Adv Med Oncol. 2015 Mar;7(2):122-36. doi: 10.1177/1758834014566428. [PubMed:25755684 ]
  2. Tafinlar® (dabrafenib) capsules[package insert]. East Hanover, New Jersey: Novartis Pharmaceuticals Corporation; 2016. [Link]

PMID: 11285256

Dabrafenib

By

Dabrafenib

Product: Tubastatin-A

Identifier : DBSNPE001076
Drug : DB08912 (Dabrafenib)
Interacting Gene/Enzyme : Glucose-6-phosphate 1-dehydrogenase
Gene Name : G6PD
UniProt ID : P11413
Defining Change(s) :

  • 1154G->T

Allele Name : Lynwood
Genotype(s) : Not Available
Type(s) : ADR Inferred
Groups : G6PD deficiency
Description : Increased risk of hemolytic anemia.
References :

  1. Welsh SJ, Corrie PG: Management of BRAF and MEK inhibitor toxicities in patients with metastatic melanoma. Ther Adv Med Oncol. 2015 Mar;7(2):122-36. doi: 10.1177/1758834014566428. [PubMed:25755684 ]
  2. Tafinlar® (dabrafenib) capsules[package insert]. East Hanover, New Jersey: Novartis Pharmaceuticals Corporation; 2016. [Link]

PMID: 8626507

Dabrafenib

By

Dabrafenib

Product: XY1

Identifier : DBSNPE001077
Drug : DB08912 (Dabrafenib)
Interacting Gene/Enzyme : Glucose-6-phosphate 1-dehydrogenase
Gene Name : G6PD
UniProt ID : P11413
Defining Change(s) :

  • 1155C->G

Allele Name : Madrid
Genotype(s) : Not Available
Type(s) : ADR Inferred
Groups : G6PD deficiency
Description : Increased risk of hemolytic anemia.
References :

  1. Welsh SJ, Corrie PG: Management of BRAF and MEK inhibitor toxicities in patients with metastatic melanoma. Ther Adv Med Oncol. 2015 Mar;7(2):122-36. doi: 10.1177/1758834014566428. [PubMed:25755684 ]
  2. Tafinlar® (dabrafenib) capsules[package insert]. East Hanover, New Jersey: Novartis Pharmaceuticals Corporation; 2016. [Link]

PMID: 25450672

Dabrafenib

By

Dabrafenib

Product: SGC707

Identifier : DBSNPE001078
Drug : DB08912 (Dabrafenib)
Interacting Gene/Enzyme : Glucose-6-phosphate 1-dehydrogenase
Gene Name : G6PD
UniProt ID : P11413
Defining Change(s) :

  • 1156A->G

Allele Name : Iowa, Walter Reed, Springfield
Genotype(s) : Not Available
Type(s) : ADR Inferred
Groups : G6PD deficiency
Description : Increased risk of hemolytic anemia.
References :

  1. Welsh SJ, Corrie PG: Management of BRAF and MEK inhibitor toxicities in patients with metastatic melanoma. Ther Adv Med Oncol. 2015 Mar;7(2):122-36. doi: 10.1177/1758834014566428. [PubMed:25755684 ]
  2. Tafinlar® (dabrafenib) capsules[package insert]. East Hanover, New Jersey: Novartis Pharmaceuticals Corporation; 2016. [Link]

PMID: 23219934

Dabrafenib

By

Dabrafenib

Product: Sudan I

Identifier : DBSNPE001079
Drug : DB08912 (Dabrafenib)
Interacting Gene/Enzyme : Glucose-6-phosphate 1-dehydrogenase
Gene Name : G6PD
UniProt ID : P11413
Defining Change(s) :

  • 1160G->A

Allele Name : Beverly Hills, Genova, Iwate, Niigata, Yamaguchi
Genotype(s) : Not Available
Type(s) : ADR Inferred
Groups : G6PD deficiency
Description : Increased risk of hemolytic anemia.
References :

  1. Welsh SJ, Corrie PG: Management of BRAF and MEK inhibitor toxicities in patients with metastatic melanoma. Ther Adv Med Oncol. 2015 Mar;7(2):122-36. doi: 10.1177/1758834014566428. [PubMed:25755684 ]
  2. Tafinlar® (dabrafenib) capsules[package insert]. East Hanover, New Jersey: Novartis Pharmaceuticals Corporation; 2016. [Link]

PMID: 20943772

Dabrafenib

By

Dabrafenib

Product: PF-2771

Identifier : DBSNPE001080
Drug : DB08912 (Dabrafenib)
Interacting Gene/Enzyme : Glucose-6-phosphate 1-dehydrogenase
Gene Name : G6PD
UniProt ID : P11413
Defining Change(s) :

  • 1162A->G

Allele Name : Hartford
Genotype(s) : Not Available
Type(s) : ADR Inferred
Groups : G6PD deficiency
Description : Increased risk of hemolytic anemia.
References :

  1. Welsh SJ, Corrie PG: Management of BRAF and MEK inhibitor toxicities in patients with metastatic melanoma. Ther Adv Med Oncol. 2015 Mar;7(2):122-36. doi: 10.1177/1758834014566428. [PubMed:25755684 ]
  2. Tafinlar® (dabrafenib) capsules[package insert]. East Hanover, New Jersey: Novartis Pharmaceuticals Corporation; 2016. [Link]

PMID: 11818455

Dabrafenib

By

Dabrafenib

Product: Centrinone-B

Identifier : DBSNPE001081
Drug : DB08912 (Dabrafenib)
Interacting Gene/Enzyme : Glucose-6-phosphate 1-dehydrogenase
Gene Name : G6PD
UniProt ID : P11413
Defining Change(s) :

  • 1166A->G

Allele Name : Praha
Genotype(s) : Not Available
Type(s) : ADR Inferred
Groups : G6PD deficiency
Description : Increased risk of hemolytic anemia.
References :

  1. Welsh SJ, Corrie PG: Management of BRAF and MEK inhibitor toxicities in patients with metastatic melanoma. Ther Adv Med Oncol. 2015 Mar;7(2):122-36. doi: 10.1177/1758834014566428. [PubMed:25755684 ]
  2. Tafinlar® (dabrafenib) capsules[package insert]. East Hanover, New Jersey: Novartis Pharmaceuticals Corporation; 2016. [Link]

PMID: 10586077

Dabrafenib

By

Dabrafenib

Product: Pachymic acid

Identifier : DBSNPE001082
Drug : DB08912 (Dabrafenib)
Interacting Gene/Enzyme : Glucose-6-phosphate 1-dehydrogenase
Gene Name : G6PD
UniProt ID : P11413
Defining Change(s) :

  • 1175T>C

Allele Name : Krakow
Genotype(s) : Not Available
Type(s) : ADR Inferred
Groups : G6PD deficiency
Description : Increased risk of hemolytic anemia.
References :

  1. Welsh SJ, Corrie PG: Management of BRAF and MEK inhibitor toxicities in patients with metastatic melanoma. Ther Adv Med Oncol. 2015 Mar;7(2):122-36. doi: 10.1177/1758834014566428. [PubMed:25755684 ]
  2. Tafinlar® (dabrafenib) capsules[package insert]. East Hanover, New Jersey: Novartis Pharmaceuticals Corporation; 2016. [Link]

PMID: 25326384

Dabrafenib

By

Dabrafenib

Product: Aucubin

Identifier : DBSNPE001083
Drug : DB08912 (Dabrafenib)
Interacting Gene/Enzyme : Glucose-6-phosphate 1-dehydrogenase
Gene Name : G6PD
UniProt ID : P11413
Defining Change(s) :

  • 1177C->G

Allele Name : Wisconsin
Genotype(s) : Not Available
Type(s) : ADR Inferred
Groups : G6PD deficiency
Description : Increased risk of hemolytic anemia.
References :

  1. Welsh SJ, Corrie PG: Management of BRAF and MEK inhibitor toxicities in patients with metastatic melanoma. Ther Adv Med Oncol. 2015 Mar;7(2):122-36. doi: 10.1177/1758834014566428. [PubMed:25755684 ]
  2. Tafinlar® (dabrafenib) capsules[package insert]. East Hanover, New Jersey: Novartis Pharmaceuticals Corporation; 2016. [Link]

PMID: 20930115

Dabrafenib

By

Dabrafenib

Product: STING agonist-1

Identifier : DBSNPE001084
Drug : DB08912 (Dabrafenib)
Interacting Gene/Enzyme : Glucose-6-phosphate 1-dehydrogenase
Gene Name : G6PD
UniProt ID : P11413
Defining Change(s) :

  • 1178G->A

Allele Name : Nashville, Anaheim, Portici
Genotype(s) : Not Available
Type(s) : ADR Inferred
Groups : G6PD deficiency
Description : Increased risk of hemolytic anemia.
References :

  1. Welsh SJ, Corrie PG: Management of BRAF and MEK inhibitor toxicities in patients with metastatic melanoma. Ther Adv Med Oncol. 2015 Mar;7(2):122-36. doi: 10.1177/1758834014566428. [PubMed:25755684 ]
  2. Tafinlar® (dabrafenib) capsules[package insert]. East Hanover, New Jersey: Novartis Pharmaceuticals Corporation; 2016. [Link]

PMID: 17687636

Dabrafenib

By

Dabrafenib

Product: NS-018 (hydrochloride)

Identifier : DBSNPE001085
Drug : DB08912 (Dabrafenib)
Interacting Gene/Enzyme : Glucose-6-phosphate 1-dehydrogenase
Gene Name : G6PD
UniProt ID : P11413
Defining Change(s) :

  • 1180G->C

Allele Name : Alhambra
Genotype(s) : Not Available
Type(s) : ADR Inferred
Groups : G6PD deficiency
Description : Increased risk of hemolytic anemia.
References :

  1. Welsh SJ, Corrie PG: Management of BRAF and MEK inhibitor toxicities in patients with metastatic melanoma. Ther Adv Med Oncol. 2015 Mar;7(2):122-36. doi: 10.1177/1758834014566428. [PubMed:25755684 ]
  2. Tafinlar® (dabrafenib) capsules[package insert]. East Hanover, New Jersey: Novartis Pharmaceuticals Corporation; 2016. [Link]

PMID: 16101820

Dabrafenib

By

Dabrafenib

Product: NS-018

Identifier : DBSNPE001086
Drug : DB08912 (Dabrafenib)
Interacting Gene/Enzyme : Glucose-6-phosphate 1-dehydrogenase
Gene Name : G6PD
UniProt ID : P11413
Defining Change(s) :

  • 1187C->T

Allele Name : Bari
Genotype(s) : Not Available
Type(s) : ADR Inferred
Groups : G6PD deficiency
Description : Increased risk of hemolytic anemia.
References :

  1. Welsh SJ, Corrie PG: Management of BRAF and MEK inhibitor toxicities in patients with metastatic melanoma. Ther Adv Med Oncol. 2015 Mar;7(2):122-36. doi: 10.1177/1758834014566428. [PubMed:25755684 ]
  2. Tafinlar® (dabrafenib) capsules[package insert]. East Hanover, New Jersey: Novartis Pharmaceuticals Corporation; 2016. [Link]

PMID: 28483551

Dabrafenib

By

Dabrafenib

Product: MUT056399

Identifier : DBSNPE001087
Drug : DB08912 (Dabrafenib)
Interacting Gene/Enzyme : Glucose-6-phosphate 1-dehydrogenase
Gene Name : G6PD
UniProt ID : P11413
Defining Change(s) :

  • 1192G->A

Allele Name : Puerto Limon
Genotype(s) : Not Available
Type(s) : ADR Inferred
Groups : G6PD deficiency
Description : Increased risk of hemolytic anemia.
References :

  1. Welsh SJ, Corrie PG: Management of BRAF and MEK inhibitor toxicities in patients with metastatic melanoma. Ther Adv Med Oncol. 2015 Mar;7(2):122-36. doi: 10.1177/1758834014566428. [PubMed:25755684 ]
  2. Tafinlar® (dabrafenib) capsules[package insert]. East Hanover, New Jersey: Novartis Pharmaceuticals Corporation; 2016. [Link]

PMID: 22706076

Dabrafenib

By

Dabrafenib

Product: CCT251545

Identifier : DBSNPE001088
Drug : DB08912 (Dabrafenib)
Interacting Gene/Enzyme : Glucose-6-phosphate 1-dehydrogenase
Gene Name : G6PD
UniProt ID : P11413
Defining Change(s) :

  • 1205C>A

Allele Name : Covao do Lobo
Genotype(s) : Not Available
Type(s) : ADR Inferred
Groups : G6PD deficiency
Description : Increased risk of hemolytic anemia.
References :

  1. Welsh SJ, Corrie PG: Management of BRAF and MEK inhibitor toxicities in patients with metastatic melanoma. Ther Adv Med Oncol. 2015 Mar;7(2):122-36. doi: 10.1177/1758834014566428. [PubMed:25755684 ]
  2. Tafinlar® (dabrafenib) capsules[package insert]. East Hanover, New Jersey: Novartis Pharmaceuticals Corporation; 2016. [Link]

PMID: 11533030

Dabrafenib

By

Dabrafenib

Product: JQ-1 (carboxylic acid)

Identifier : DBSNPE001089
Drug : DB08912 (Dabrafenib)
Interacting Gene/Enzyme : Glucose-6-phosphate 1-dehydrogenase
Gene Name : G6PD
UniProt ID : P11413
Defining Change(s) :

  • 1215G->A

Allele Name : Clinic
Genotype(s) : Not Available
Type(s) : ADR Inferred
Groups : G6PD deficiency
Description : Increased risk of hemolytic anemia.
References :

  1. Welsh SJ, Corrie PG: Management of BRAF and MEK inhibitor toxicities in patients with metastatic melanoma. Ther Adv Med Oncol. 2015 Mar;7(2):122-36. doi: 10.1177/1758834014566428. [PubMed:25755684 ]
  2. Tafinlar® (dabrafenib) capsules[package insert]. East Hanover, New Jersey: Novartis Pharmaceuticals Corporation; 2016. [Link]

PMID: 15210823

Dabrafenib

By

Dabrafenib

Product: LY3023414

Identifier : DBSNPE001090
Drug : DB08912 (Dabrafenib)
Interacting Gene/Enzyme : Glucose-6-phosphate 1-dehydrogenase
Gene Name : G6PD
UniProt ID : P11413
Defining Change(s) :

  • 1225C->T

Allele Name : Udivecht
Genotype(s) : Not Available
Type(s) : ADR Inferred
Groups : G6PD deficiency
Description : Increased risk of hemolytic anemia.
References :

  1. Welsh SJ, Corrie PG: Management of BRAF and MEK inhibitor toxicities in patients with metastatic melanoma. Ther Adv Med Oncol. 2015 Mar;7(2):122-36. doi: 10.1177/1758834014566428. [PubMed:25755684 ]
  2. Tafinlar® (dabrafenib) capsules[package insert]. East Hanover, New Jersey: Novartis Pharmaceuticals Corporation; 2016. [Link]

PMID: 25598664

Dabrafenib

By

Dabrafenib

Product: DEL-22379

Identifier : DBSNPE001091
Drug : DB08912 (Dabrafenib)
Interacting Gene/Enzyme : Glucose-6-phosphate 1-dehydrogenase
Gene Name : G6PD
UniProt ID : P11413
Defining Change(s) :

  • 1226C->G

Allele Name : Suwalki
Genotype(s) : Not Available
Type(s) : ADR Inferred
Groups : G6PD deficiency
Description : Increased risk of hemolytic anemia.
References :

  1. Welsh SJ, Corrie PG: Management of BRAF and MEK inhibitor toxicities in patients with metastatic melanoma. Ther Adv Med Oncol. 2015 Mar;7(2):122-36. doi: 10.1177/1758834014566428. [PubMed:25755684 ]
  2. Tafinlar® (dabrafenib) capsules[package insert]. East Hanover, New Jersey: Novartis Pharmaceuticals Corporation; 2016. [Link]

PMID: 23447017

Dabrafenib

By

Dabrafenib

Product: Aglafoline

Identifier : DBSNPE001092
Drug : DB08912 (Dabrafenib)
Interacting Gene/Enzyme : Glucose-6-phosphate 1-dehydrogenase
Gene Name : G6PD
UniProt ID : P11413
Defining Change(s) :

  • 1228G->T

Allele Name : Riverside
Genotype(s) : Not Available
Type(s) : ADR Inferred
Groups : G6PD deficiency
Description : Increased risk of hemolytic anemia.
References :

  1. Welsh SJ, Corrie PG: Management of BRAF and MEK inhibitor toxicities in patients with metastatic melanoma. Ther Adv Med Oncol. 2015 Mar;7(2):122-36. doi: 10.1177/1758834014566428. [PubMed:25755684 ]
  2. Tafinlar® (dabrafenib) capsules[package insert]. East Hanover, New Jersey: Novartis Pharmaceuticals Corporation; 2016. [Link]

PMID: 23381993

Dabrafenib

By

Dabrafenib

Product: LOXO-101 (sulfate)

Identifier : DBSNPE001093
Drug : DB08912 (Dabrafenib)
Interacting Gene/Enzyme : Glucose-6-phosphate 1-dehydrogenase
Gene Name : G6PD
UniProt ID : P11413
Defining Change(s) :

  • 1229G->A

Allele Name : Japan, Shinagawa
Genotype(s) : Not Available
Type(s) : ADR Inferred
Groups : G6PD deficiency
Description : Increased risk of hemolytic anemia.
References :

  1. Welsh SJ, Corrie PG: Management of BRAF and MEK inhibitor toxicities in patients with metastatic melanoma. Ther Adv Med Oncol. 2015 Mar;7(2):122-36. doi: 10.1177/1758834014566428. [PubMed:25755684 ]
  2. Tafinlar® (dabrafenib) capsules[package insert]. East Hanover, New Jersey: Novartis Pharmaceuticals Corporation; 2016. [Link]

PMID: 17428601

Dabrafenib

By

Dabrafenib

Product: Ribocil-C

Identifier : DBSNPE001094
Drug : DB08912 (Dabrafenib)
Interacting Gene/Enzyme : Glucose-6-phosphate 1-dehydrogenase
Gene Name : G6PD
UniProt ID : P11413
Defining Change(s) :

  • 1229G->C

Allele Name : Kawasaki
Genotype(s) : Not Available
Type(s) : ADR Inferred
Groups : G6PD deficiency
Description : Increased risk of hemolytic anemia.
References :

  1. Welsh SJ, Corrie PG: Management of BRAF and MEK inhibitor toxicities in patients with metastatic melanoma. Ther Adv Med Oncol. 2015 Mar;7(2):122-36. doi: 10.1177/1758834014566428. [PubMed:25755684 ]
  2. Tafinlar® (dabrafenib) capsules[package insert]. East Hanover, New Jersey: Novartis Pharmaceuticals Corporation; 2016. [Link]

PMID: 10882119

Dabrafenib

By

Dabrafenib

Product: Ribocil

Identifier : DBSNPE001095
Drug : DB08912 (Dabrafenib)
Interacting Gene/Enzyme : Glucose-6-phosphate 1-dehydrogenase
Gene Name : G6PD
UniProt ID : P11413
Defining Change(s) :

  • 1231A->G

Allele Name : Munich
Genotype(s) : Not Available
Type(s) : ADR Inferred
Groups : G6PD deficiency
Description : Increased risk of hemolytic anemia.
References :

  1. Welsh SJ, Corrie PG: Management of BRAF and MEK inhibitor toxicities in patients with metastatic melanoma. Ther Adv Med Oncol. 2015 Mar;7(2):122-36. doi: 10.1177/1758834014566428. [PubMed:25755684 ]
  2. Tafinlar® (dabrafenib) capsules[package insert]. East Hanover, New Jersey: Novartis Pharmaceuticals Corporation; 2016. [Link]

PMID: 27694829

Dabrafenib

By

Dabrafenib

Product: Acalabrutinib

Identifier : DBSNPE001096
Drug : DB08912 (Dabrafenib)
Interacting Gene/Enzyme : Glucose-6-phosphate 1-dehydrogenase
Gene Name : G6PD
UniProt ID : P11413
Defining Change(s) :

  • 1284C->A

Allele Name : Georgia
Genotype(s) : Not Available
Type(s) : ADR Inferred
Groups : G6PD deficiency
Description : Increased risk of hemolytic anemia.
References :

  1. Welsh SJ, Corrie PG: Management of BRAF and MEK inhibitor toxicities in patients with metastatic melanoma. Ther Adv Med Oncol. 2015 Mar;7(2):122-36. doi: 10.1177/1758834014566428. [PubMed:25755684 ]
  2. Tafinlar® (dabrafenib) capsules[package insert]. East Hanover, New Jersey: Novartis Pharmaceuticals Corporation; 2016. [Link]

PMID: 26023867

Dabrafenib

By

Dabrafenib

Product: SKF 38393 (hydrochloride)

Identifier : DBSNPE001097
Drug : DB08912 (Dabrafenib)
Interacting Gene/Enzyme : Glucose-6-phosphate 1-dehydrogenase
Gene Name : G6PD
UniProt ID : P11413
Defining Change(s) :

  • 1292T->G

Allele Name : Sumare
Genotype(s) : Not Available
Type(s) : ADR Inferred
Groups : G6PD deficiency
Description : Increased risk of hemolytic anemia.
References :

  1. Welsh SJ, Corrie PG: Management of BRAF and MEK inhibitor toxicities in patients with metastatic melanoma. Ther Adv Med Oncol. 2015 Mar;7(2):122-36. doi: 10.1177/1758834014566428. [PubMed:25755684 ]
  2. Tafinlar® (dabrafenib) capsules[package insert]. East Hanover, New Jersey: Novartis Pharmaceuticals Corporation; 2016. [Link]

PMID: 28287161

Dabrafenib

By

Dabrafenib

Product: PKR-IN-2

Identifier : DBSNPE001098
Drug : DB08912 (Dabrafenib)
Interacting Gene/Enzyme : Glucose-6-phosphate 1-dehydrogenase
Gene Name : G6PD
UniProt ID : P11413
Defining Change(s) :

  • 1318C->T

Allele Name : Telti/Kobe
Genotype(s) : Not Available
Type(s) : ADR Inferred
Groups : G6PD deficiency
Description : Increased risk of hemolytic anemia.
References :

  1. Welsh SJ, Corrie PG: Management of BRAF and MEK inhibitor toxicities in patients with metastatic melanoma. Ther Adv Med Oncol. 2015 Mar;7(2):122-36. doi: 10.1177/1758834014566428. [PubMed:25755684 ]
  2. Tafinlar® (dabrafenib) capsules[package insert]. East Hanover, New Jersey: Novartis Pharmaceuticals Corporation; 2016. [Link]

PMID: 22840769

Dabrafenib

By

Dabrafenib

Product: Tauroursodeoxycholate (Sodium)

Identifier : DBSNPE001099
Drug : DB08912 (Dabrafenib)
Interacting Gene/Enzyme : Glucose-6-phosphate 1-dehydrogenase
Gene Name : G6PD
UniProt ID : P11413
Defining Change(s) :

  • 1339G->A

Allele Name : Santiago de Cuba, Morioka
Genotype(s) : Not Available
Type(s) : ADR Inferred
Groups : G6PD deficiency
Description : Increased risk of hemolytic anemia.
References :

  1. Welsh SJ, Corrie PG: Management of BRAF and MEK inhibitor toxicities in patients with metastatic melanoma. Ther Adv Med Oncol. 2015 Mar;7(2):122-36. doi: 10.1177/1758834014566428. [PubMed:25755684 ]
  2. Tafinlar® (dabrafenib) capsules[package insert]. East Hanover, New Jersey: Novartis Pharmaceuticals Corporation; 2016. [Link]

PMID: 27723751

Dabrafenib

By

Dabrafenib

Product: Degarelix

Identifier : DBSNPE001100
Drug : DB08912 (Dabrafenib)
Interacting Gene/Enzyme : Glucose-6-phosphate 1-dehydrogenase
Gene Name : G6PD
UniProt ID : P11413
Defining Change(s) :

  • 1358T->A

Allele Name : Harima
Genotype(s) : Not Available
Type(s) : ADR Inferred
Groups : G6PD deficiency
Description : Increased risk of hemolytic anemia.
References :

  1. Welsh SJ, Corrie PG: Management of BRAF and MEK inhibitor toxicities in patients with metastatic melanoma. Ther Adv Med Oncol. 2015 Mar;7(2):122-36. doi: 10.1177/1758834014566428. [PubMed:25755684 ]
  2. Tafinlar® (dabrafenib) capsules[package insert]. East Hanover, New Jersey: Novartis Pharmaceuticals Corporation; 2016. [Link]

PMID: 24290880

Dabrafenib

By

Dabrafenib

Product: Naloxegol (oxalate)

Identifier : DBSNPE001101
Drug : DB08912 (Dabrafenib)
Interacting Gene/Enzyme : Glucose-6-phosphate 1-dehydrogenase
Gene Name : G6PD
UniProt ID : P11413
Defining Change(s) :

  • 1366G->C

Allele Name : Figuera da Foz
Genotype(s) : Not Available
Type(s) : ADR Inferred
Groups : G6PD deficiency
Description : Increased risk of hemolytic anemia.
References :

  1. Welsh SJ, Corrie PG: Management of BRAF and MEK inhibitor toxicities in patients with metastatic melanoma. Ther Adv Med Oncol. 2015 Mar;7(2):122-36. doi: 10.1177/1758834014566428. [PubMed:25755684 ]
  2. Tafinlar® (dabrafenib) capsules[package insert]. East Hanover, New Jersey: Novartis Pharmaceuticals Corporation; 2016. [Link]

PMID: 24706986

Dabrafenib

By

Dabrafenib

Product: 6-Quinoxalinecarboxylic acid, 2,3-bis(bromomethyl)-

Identifier : DBSNPE001102
Drug : DB08912 (Dabrafenib)
Interacting Gene/Enzyme : Glucose-6-phosphate 1-dehydrogenase
Gene Name : G6PD
UniProt ID : P11413
Defining Change(s) :

  • 1367A>T

Allele Name : Amiens
Genotype(s) : Not Available
Type(s) : ADR Inferred
Groups : G6PD deficiency
Description : Increased risk of hemolytic anemia.
References :

  1. Welsh SJ, Corrie PG: Management of BRAF and MEK inhibitor toxicities in patients with metastatic melanoma. Ther Adv Med Oncol. 2015 Mar;7(2):122-36. doi: 10.1177/1758834014566428. [PubMed:25755684 ]
  2. Tafinlar® (dabrafenib) capsules[package insert]. East Hanover, New Jersey: Novartis Pharmaceuticals Corporation; 2016. [Link]

PMID: 25053235

Dabrafenib

By

Dabrafenib

Product: McMMAF

Identifier : DBSNPE001103
Drug : DB08912 (Dabrafenib)
Interacting Gene/Enzyme : Glucose-6-phosphate 1-dehydrogenase
Gene Name : G6PD
UniProt ID : P11413
Defining Change(s) :

  • 1376G->T, 1502T->G

Allele Name : Bangkok Noi
Genotype(s) : Not Available
Type(s) : ADR Inferred
Groups : G6PD deficiency
Description : Increased risk of hemolytic anemia.
References :

  1. Welsh SJ, Corrie PG: Management of BRAF and MEK inhibitor toxicities in patients with metastatic melanoma. Ther Adv Med Oncol. 2015 Mar;7(2):122-36. doi: 10.1177/1758834014566428. [PubMed:25755684 ]
  2. Tafinlar® (dabrafenib) capsules[package insert]. East Hanover, New Jersey: Novartis Pharmaceuticals Corporation; 2016. [Link]

PMID: 23707258

Dabrafenib

By

Dabrafenib

Product: Gynostemma Extract

Identifier : DBSNPE001104
Drug : DB08912 (Dabrafenib)
Interacting Gene/Enzyme : Glucose-6-phosphate 1-dehydrogenase
Gene Name : G6PD
UniProt ID : P11413
Defining Change(s) :

  • 1462G->A

Allele Name : Fukaya
Genotype(s) : Not Available
Type(s) : ADR Inferred
Groups : G6PD deficiency
Description : Increased risk of hemolytic anemia.
References :

  1. Welsh SJ, Corrie PG: Management of BRAF and MEK inhibitor toxicities in patients with metastatic melanoma. Ther Adv Med Oncol. 2015 Mar;7(2):122-36. doi: 10.1177/1758834014566428. [PubMed:25755684 ]
  2. Tafinlar® (dabrafenib) capsules[package insert]. East Hanover, New Jersey: Novartis Pharmaceuticals Corporation; 2016. [Link]

PMID: 21885866

Dabrafenib

By

Dabrafenib

Product: Hematoxylin

Identifier : DBSNPE001105
Drug : DB08912 (Dabrafenib)
Interacting Gene/Enzyme : Glucose-6-phosphate 1-dehydrogenase
Gene Name : G6PD
UniProt ID : P11413
Defining Change(s) :

  • 1463G->T

Allele Name : Campinas
Genotype(s) : Not Available
Type(s) : ADR Inferred
Groups : G6PD deficiency
Description : Increased risk of hemolytic anemia.
References :

  1. Welsh SJ, Corrie PG: Management of BRAF and MEK inhibitor toxicities in patients with metastatic melanoma. Ther Adv Med Oncol. 2015 Mar;7(2):122-36. doi: 10.1177/1758834014566428. [PubMed:25755684 ]
  2. Tafinlar® (dabrafenib) capsules[package insert]. East Hanover, New Jersey: Novartis Pharmaceuticals Corporation; 2016. [Link]

PMID: 25581517

Dabrafenib

By

Dabrafenib

Product: Amaranth

Identifier : DBSNPE001106
Drug : DB08912 (Dabrafenib)
Interacting Gene/Enzyme : Glucose-6-phosphate 1-dehydrogenase
Gene Name : G6PD
UniProt ID : P11413
Defining Change(s) :

  • 1465C>T

Allele Name : Buenos Aires
Genotype(s) : Not Available
Type(s) : ADR Inferred
Groups : G6PD deficiency
Description : Increased risk of hemolytic anemia.
References :

  1. Welsh SJ, Corrie PG: Management of BRAF and MEK inhibitor toxicities in patients with metastatic melanoma. Ther Adv Med Oncol. 2015 Mar;7(2):122-36. doi: 10.1177/1758834014566428. [PubMed:25755684 ]
  2. Tafinlar® (dabrafenib) capsules[package insert]. East Hanover, New Jersey: Novartis Pharmaceuticals Corporation; 2016. [Link]

PMID: 18690216

Dabrafenib

By

Dabrafenib

Product: Ponceau 4R

Identifier : DBSNPE001107
Drug : DB08912 (Dabrafenib)
Interacting Gene/Enzyme : Glucose-6-phosphate 1-dehydrogenase
Gene Name : G6PD
UniProt ID : P11413
Defining Change(s) :

  • 1466C->T

Allele Name : Arakawa
Genotype(s) : Not Available
Type(s) : ADR Inferred
Groups : G6PD deficiency
Description : Increased risk of hemolytic anemia.
References :

  1. Welsh SJ, Corrie PG: Management of BRAF and MEK inhibitor toxicities in patients with metastatic melanoma. Ther Adv Med Oncol. 2015 Mar;7(2):122-36. doi: 10.1177/1758834014566428. [PubMed:25755684 ]
  2. Tafinlar® (dabrafenib) capsules[package insert]. East Hanover, New Jersey: Novartis Pharmaceuticals Corporation; 2016. [Link]

PMID: 23200667

Dabrafenib

By

Dabrafenib

Product: BRD7552

Identifier : DBSNPE001108
Drug : DB08912 (Dabrafenib)
Interacting Gene/Enzyme : Glucose-6-phosphate 1-dehydrogenase
Gene Name : G6PD
UniProt ID : P11413
Defining Change(s) :

  • 1488_1490delGAA

Allele Name : Brighton
Genotype(s) : Not Available
Type(s) : ADR Inferred
Groups : G6PD deficiency
Description : Increased risk of hemolytic anemia.
References :

  1. Welsh SJ, Corrie PG: Management of BRAF and MEK inhibitor toxicities in patients with metastatic melanoma. Ther Adv Med Oncol. 2015 Mar;7(2):122-36. doi: 10.1177/1758834014566428. [PubMed:25755684 ]
  2. Tafinlar® (dabrafenib) capsules[package insert]. East Hanover, New Jersey: Novartis Pharmaceuticals Corporation; 2016. [Link]

PMID: 21747117

Dabrafenib

By

Dabrafenib

Product: FIIN-2

Identifier : DBSNPE001109
Drug : DB08912 (Dabrafenib)
Interacting Gene/Enzyme : Glucose-6-phosphate 1-dehydrogenase
Gene Name : G6PD
UniProt ID : P11413
Defining Change(s) :

  • 159G->C

Allele Name : Kozukata
Genotype(s) : Not Available
Type(s) : ADR Inferred
Groups : G6PD deficiency
Description : Increased risk of hemolytic anemia.
References :

  1. Welsh SJ, Corrie PG: Management of BRAF and MEK inhibitor toxicities in patients with metastatic melanoma. Ther Adv Med Oncol. 2015 Mar;7(2):122-36. doi: 10.1177/1758834014566428. [PubMed:25755684 ]
  2. Tafinlar® (dabrafenib) capsules[package insert]. East Hanover, New Jersey: Novartis Pharmaceuticals Corporation; 2016. [Link]

PMID: 17494766

Dabrafenib

By

Dabrafenib

Product: Mephenesin

Identifier : DBSNPE001110
Drug : DB08912 (Dabrafenib)
Interacting Gene/Enzyme : Glucose-6-phosphate 1-dehydrogenase
Gene Name : G6PD
UniProt ID : P11413
Defining Change(s) :

  • 180_182delTCT

Allele Name : Amsterdam
Genotype(s) : Not Available
Type(s) : ADR Inferred
Groups : G6PD deficiency
Description : Increased risk of hemolytic anemia.
References :

  1. Welsh SJ, Corrie PG: Management of BRAF and MEK inhibitor toxicities in patients with metastatic melanoma. Ther Adv Med Oncol. 2015 Mar;7(2):122-36. doi: 10.1177/1758834014566428. [PubMed:25755684 ]
  2. Tafinlar® (dabrafenib) capsules[package insert]. East Hanover, New Jersey: Novartis Pharmaceuticals Corporation; 2016. [Link]

PMID: 25544756

Dabrafenib

By

Dabrafenib

Product: TMC647055 (Choline salt)

Identifier : DBSNPE001111
Drug : DB08912 (Dabrafenib)
Interacting Gene/Enzyme : Glucose-6-phosphate 1-dehydrogenase
Gene Name : G6PD
UniProt ID : P11413
Defining Change(s) :

  • 202G->A, 376A->G, 1264C>G

Allele Name : No name
Genotype(s) : Not Available
Type(s) : ADR Inferred
Groups : G6PD deficiency
Description : Increased risk of hemolytic anemia.
References :

  1. Welsh SJ, Corrie PG: Management of BRAF and MEK inhibitor toxicities in patients with metastatic melanoma. Ther Adv Med Oncol. 2015 Mar;7(2):122-36. doi: 10.1177/1758834014566428. [PubMed:25755684 ]
  2. Tafinlar® (dabrafenib) capsules[package insert]. East Hanover, New Jersey: Novartis Pharmaceuticals Corporation; 2016. [Link]

PMID: 23212373

Dabrafenib

By

Dabrafenib

Product: PF-3274167

Identifier : DBSNPE001112
Drug : DB08912 (Dabrafenib)
Interacting Gene/Enzyme : Glucose-6-phosphate 1-dehydrogenase
Gene Name : G6PD
UniProt ID : P11413
Defining Change(s) :

  • 224T->C

Allele Name : Swansea
Genotype(s) : Not Available
Type(s) : ADR Inferred
Groups : G6PD deficiency
Description : Increased risk of hemolytic anemia.
References :

  1. Welsh SJ, Corrie PG: Management of BRAF and MEK inhibitor toxicities in patients with metastatic melanoma. Ther Adv Med Oncol. 2015 Mar;7(2):122-36. doi: 10.1177/1758834014566428. [PubMed:25755684 ]
  2. Tafinlar® (dabrafenib) capsules[package insert]. East Hanover, New Jersey: Novartis Pharmaceuticals Corporation; 2016. [Link]

PMID: 18676853

Dabrafenib

By

Dabrafenib

Product: NS-398

Identifier : DBSNPE001113
Drug : DB08912 (Dabrafenib)
Interacting Gene/Enzyme : Glucose-6-phosphate 1-dehydrogenase
Gene Name : G6PD
UniProt ID : P11413
Defining Change(s) :

  • 281_283delAGA

Allele Name : Urayasu
Genotype(s) : Not Available
Type(s) : ADR Inferred
Groups : G6PD deficiency
Description : Increased risk of hemolytic anemia.
References :

  1. Welsh SJ, Corrie PG: Management of BRAF and MEK inhibitor toxicities in patients with metastatic melanoma. Ther Adv Med Oncol. 2015 Mar;7(2):122-36. doi: 10.1177/1758834014566428. [PubMed:25755684 ]
  2. Tafinlar® (dabrafenib) capsules[package insert]. East Hanover, New Jersey: Novartis Pharmaceuticals Corporation; 2016. [Link]

PMID: 22798407

Dabrafenib

By

Dabrafenib

Product: Ombitasvir

Identifier : DBSNPE001114
Drug : DB08912 (Dabrafenib)
Interacting Gene/Enzyme : Glucose-6-phosphate 1-dehydrogenase
Gene Name : G6PD
UniProt ID : P11413
Defining Change(s) :

  • 317C->G544C->T592C->T

Allele Name : Vancouver
Genotype(s) : Not Available
Type(s) : ADR Inferred
Groups : G6PD deficiency
Description : Increased risk of hemolytic anemia.
References :

  1. Welsh SJ, Corrie PG: Management of BRAF and MEK inhibitor toxicities in patients with metastatic melanoma. Ther Adv Med Oncol. 2015 Mar;7(2):122-36. doi: 10.1177/1758834014566428. [PubMed:25755684 ]
  2. Tafinlar® (dabrafenib) capsules[package insert]. East Hanover, New Jersey: Novartis Pharmaceuticals Corporation; 2016. [Link]

PMID: 24291777

Dabrafenib

By

Dabrafenib

Product: MSX-122

Identifier : DBSNPE001115
Drug : DB08912 (Dabrafenib)
Interacting Gene/Enzyme : Glucose-6-phosphate 1-dehydrogenase
Gene Name : G6PD
UniProt ID : P11413
Defining Change(s) :

  • 376A->G, 1159C->T

Allele Name : Mt Sinai
Genotype(s) : Not Available
Type(s) : ADR Inferred
Groups : G6PD deficiency
Description : Increased risk of hemolytic anemia.
References :

  1. Welsh SJ, Corrie PG: Management of BRAF and MEK inhibitor toxicities in patients with metastatic melanoma. Ther Adv Med Oncol. 2015 Mar;7(2):122-36. doi: 10.1177/1758834014566428. [PubMed:25755684 ]
  2. Tafinlar® (dabrafenib) capsules[package insert]. East Hanover, New Jersey: Novartis Pharmaceuticals Corporation; 2016. [Link]

PMID: 21078672

Dabrafenib

By

Dabrafenib

Product: Elbasvir

Identifier : DBSNPE001116
Drug : DB08912 (Dabrafenib)
Interacting Gene/Enzyme : Glucose-6-phosphate 1-dehydrogenase
Gene Name : G6PD
UniProt ID : P11413
Defining Change(s) :

  • 488G->A

Allele Name : Plymouth
Genotype(s) : Not Available
Type(s) : ADR Inferred
Groups : G6PD deficiency
Description : Increased risk of hemolytic anemia.
References :

  1. Welsh SJ, Corrie PG: Management of BRAF and MEK inhibitor toxicities in patients with metastatic melanoma. Ther Adv Med Oncol. 2015 Mar;7(2):122-36. doi: 10.1177/1758834014566428. [PubMed:25755684 ]
  2. Tafinlar® (dabrafenib) capsules[package insert]. East Hanover, New Jersey: Novartis Pharmaceuticals Corporation; 2016. [Link]

PMID: 23213213

Dabrafenib

By

Dabrafenib

Product: thymus peptide C

Identifier : DBSNPE001117
Drug : DB08912 (Dabrafenib)
Interacting Gene/Enzyme : Glucose-6-phosphate 1-dehydrogenase
Gene Name : G6PD
UniProt ID : P11413
Defining Change(s) :

  • 514C->T

Allele Name : Volendam
Genotype(s) : Not Available
Type(s) : ADR Inferred
Groups : G6PD deficiency
Description : Increased risk of hemolytic anemia.
References :

  1. Welsh SJ, Corrie PG: Management of BRAF and MEK inhibitor toxicities in patients with metastatic melanoma. Ther Adv Med Oncol. 2015 Mar;7(2):122-36. doi: 10.1177/1758834014566428. [PubMed:25755684 ]
  2. Tafinlar® (dabrafenib) capsules[package insert]. East Hanover, New Jersey: Novartis Pharmaceuticals Corporation; 2016. [Link]

PMID: 27127239

Dabrafenib

By

Dabrafenib

Product: Elagolix

Identifier : DBSNPE001118
Drug : DB08912 (Dabrafenib)
Interacting Gene/Enzyme : Glucose-6-phosphate 1-dehydrogenase
Gene Name : G6PD
UniProt ID : P11413
Defining Change(s) :

  • 527A->G

Allele Name : Shinshu
Genotype(s) : Not Available
Type(s) : ADR Inferred
Groups : G6PD deficiency
Description : Increased risk of hemolytic anemia.
References :

  1. Welsh SJ, Corrie PG: Management of BRAF and MEK inhibitor toxicities in patients with metastatic melanoma. Ther Adv Med Oncol. 2015 Mar;7(2):122-36. doi: 10.1177/1758834014566428. [PubMed:25755684 ]
  2. Tafinlar® (dabrafenib) capsules[package insert]. East Hanover, New Jersey: Novartis Pharmaceuticals Corporation; 2016. [Link]

PMID: 27084884

Dabrafenib

By

Dabrafenib

Product: Metamizole (sodium hydrate)

Identifier : DBSNPE001119
Drug : DB08912 (Dabrafenib)
Interacting Gene/Enzyme : Glucose-6-phosphate 1-dehydrogenase
Gene Name : G6PD
UniProt ID : P11413
Defining Change(s) :

  • 535A->T

Allele Name : Chikugo
Genotype(s) : Not Available
Type(s) : ADR Inferred
Groups : G6PD deficiency
Description : Increased risk of hemolytic anemia.
References :

  1. Welsh SJ, Corrie PG: Management of BRAF and MEK inhibitor toxicities in patients with metastatic melanoma. Ther Adv Med Oncol. 2015 Mar;7(2):122-36. doi: 10.1177/1758834014566428. [PubMed:25755684 ]
  2. Tafinlar® (dabrafenib) capsules[package insert]. East Hanover, New Jersey: Novartis Pharmaceuticals Corporation; 2016. [Link]

PMID: 24714748

Dabrafenib

By

Dabrafenib

Product: Methoxyphenamine (Hydrochloride)

Identifier : DBSNPE001120
Drug : DB08912 (Dabrafenib)
Interacting Gene/Enzyme : Glucose-6-phosphate 1-dehydrogenase
Gene Name : G6PD
UniProt ID : P11413
Defining Change(s) :

  • 561_563delCTC

Allele Name : Tsukui
Genotype(s) : Not Available
Type(s) : ADR Inferred
Groups : G6PD deficiency
Description : Increased risk of hemolytic anemia.
References :

  1. Welsh SJ, Corrie PG: Management of BRAF and MEK inhibitor toxicities in patients with metastatic melanoma. Ther Adv Med Oncol. 2015 Mar;7(2):122-36. doi: 10.1177/1758834014566428. [PubMed:25755684 ]
  2. Tafinlar® (dabrafenib) capsules[package insert]. East Hanover, New Jersey: Novartis Pharmaceuticals Corporation; 2016. [Link]

PMID: 24356956

Dabrafenib

By

Dabrafenib

Product: Harmine

Identifier : DBSNPE001121
Drug : DB08912 (Dabrafenib)
Interacting Gene/Enzyme : Glucose-6-phosphate 1-dehydrogenase
Gene Name : G6PD
UniProt ID : P11413
Defining Change(s) :

  • 573C>G

Allele Name : Pedoplis-Ckaro
Genotype(s) : Not Available
Type(s) : ADR Inferred
Groups : G6PD deficiency
Description : Increased risk of hemolytic anemia.
References :

  1. Welsh SJ, Corrie PG: Management of BRAF and MEK inhibitor toxicities in patients with metastatic melanoma. Ther Adv Med Oncol. 2015 Mar;7(2):122-36. doi: 10.1177/1758834014566428. [PubMed:25755684 ]
  2. Tafinlar® (dabrafenib) capsules[package insert]. East Hanover, New Jersey: Novartis Pharmaceuticals Corporation; 2016. [Link]

PMID: 16288083

Dabrafenib

By

Dabrafenib

Product: THS-044

Identifier : DBSNPE001122
Drug : DB08912 (Dabrafenib)
Interacting Gene/Enzyme : Glucose-6-phosphate 1-dehydrogenase
Gene Name : G6PD
UniProt ID : P11413
Defining Change(s) :

  • 593G->C

Allele Name : Santiago
Genotype(s) : Not Available
Type(s) : ADR Inferred
Groups : G6PD deficiency
Description : Increased risk of hemolytic anemia.
References :

  1. Welsh SJ, Corrie PG: Management of BRAF and MEK inhibitor toxicities in patients with metastatic melanoma. Ther Adv Med Oncol. 2015 Mar;7(2):122-36. doi: 10.1177/1758834014566428. [PubMed:25755684 ]
  2. Tafinlar® (dabrafenib) capsules[package insert]. East Hanover, New Jersey: Novartis Pharmaceuticals Corporation; 2016. [Link]

PMID: 25643210

Dabrafenib

By

Dabrafenib

Product: LMI070

Identifier : DBSNPE001123
Drug : DB08912 (Dabrafenib)
Interacting Gene/Enzyme : Glucose-6-phosphate 1-dehydrogenase
Gene Name : G6PD
UniProt ID : P11413
Defining Change(s) :

  • 637G->T

Allele Name : Minnesota, Marion, Gastonia, LeJeune
Genotype(s) : Not Available
Type(s) : ADR Inferred
Groups : G6PD deficiency
Description : Increased risk of hemolytic anemia.
References :

  1. Welsh SJ, Corrie PG: Management of BRAF and MEK inhibitor toxicities in patients with metastatic melanoma. Ther Adv Med Oncol. 2015 Mar;7(2):122-36. doi: 10.1177/1758834014566428. [PubMed:25755684 ]
  2. Tafinlar® (dabrafenib) capsules[package insert]. East Hanover, New Jersey: Novartis Pharmaceuticals Corporation; 2016. [Link]

PMID: 19402821

Dabrafenib

By

Dabrafenib

Product: alpha-Amanitin

Identifier : DBSNPE001124
Drug : DB08912 (Dabrafenib)
Interacting Gene/Enzyme : Glucose-6-phosphate 1-dehydrogenase
Gene Name : G6PD
UniProt ID : P11413
Defining Change(s) :

  • 637G->T, 1037A->T

Allele Name : Cincinnati
Genotype(s) : Not Available
Type(s) : ADR Inferred
Groups : G6PD deficiency
Description : Increased risk of hemolytic anemia.
References :

  1. Welsh SJ, Corrie PG: Management of BRAF and MEK inhibitor toxicities in patients with metastatic melanoma. Ther Adv Med Oncol. 2015 Mar;7(2):122-36. doi: 10.1177/1758834014566428. [PubMed:25755684 ]
  2. Tafinlar® (dabrafenib) capsules[package insert]. East Hanover, New Jersey: Novartis Pharmaceuticals Corporation; 2016. [Link]

PMID: 26551880

Dabrafenib

By

Dabrafenib

Product: Calicheamicin

Identifier : DBSNPE001125
Drug : DB08912 (Dabrafenib)
Interacting Gene/Enzyme : Glucose-6-phosphate 1-dehydrogenase
Gene Name : G6PD
UniProt ID : P11413
Defining Change(s) :

  • 648T->G

Allele Name : Harilaou
Genotype(s) : Not Available
Type(s) : ADR Inferred
Groups : G6PD deficiency
Description : Increased risk of hemolytic anemia.
References :

  1. Welsh SJ, Corrie PG: Management of BRAF and MEK inhibitor toxicities in patients with metastatic melanoma. Ther Adv Med Oncol. 2015 Mar;7(2):122-36. doi: 10.1177/1758834014566428. [PubMed:25755684 ]
  2. Tafinlar® (dabrafenib) capsules[package insert]. East Hanover, New Jersey: Novartis Pharmaceuticals Corporation; 2016. [Link]

PMID: 26139536

Dabrafenib

By

Dabrafenib

Product: Maytansinol

Identifier : DBSNPE001126
Drug : DB08912 (Dabrafenib)
Interacting Gene/Enzyme : Glucose-6-phosphate 1-dehydrogenase
Gene Name : G6PD
UniProt ID : P11413
Defining Change(s) :

  • 683_685delACA

Allele Name : North Dallas
Genotype(s) : Not Available
Type(s) : ADR Inferred
Groups : G6PD deficiency
Description : Increased risk of hemolytic anemia.
References :

  1. Welsh SJ, Corrie PG: Management of BRAF and MEK inhibitor toxicities in patients with metastatic melanoma. Ther Adv Med Oncol. 2015 Mar;7(2):122-36. doi: 10.1177/1758834014566428. [PubMed:25755684 ]
  2. Tafinlar® (dabrafenib) capsules[package insert]. East Hanover, New Jersey: Novartis Pharmaceuticals Corporation; 2016. [Link]

PMID: 23874880

Dabrafenib

By

Dabrafenib

Product: GBT 440

Identifier : DBSNPE001127
Drug : DB08912 (Dabrafenib)
Interacting Gene/Enzyme : Glucose-6-phosphate 1-dehydrogenase
Gene Name : G6PD
UniProt ID : P11413
Defining Change(s) :

  • 695G->A

Allele Name : Asahikawa
Genotype(s) : Not Available
Type(s) : ADR Inferred
Groups : G6PD deficiency
Description : Increased risk of hemolytic anemia.
References :

  1. Welsh SJ, Corrie PG: Management of BRAF and MEK inhibitor toxicities in patients with metastatic melanoma. Ther Adv Med Oncol. 2015 Mar;7(2):122-36. doi: 10.1177/1758834014566428. [PubMed:25755684 ]
  2. Tafinlar® (dabrafenib) capsules[package insert]. East Hanover, New Jersey: Novartis Pharmaceuticals Corporation; 2016. [Link]

PMID: 24191005

Dabrafenib

By

Dabrafenib

Product: Remimazolam (benzenesulfonate)

Identifier : DBSNPE001128
Drug : DB08912 (Dabrafenib)
Interacting Gene/Enzyme : Glucose-6-phosphate 1-dehydrogenase
Gene Name : G6PD
UniProt ID : P11413
Defining Change(s) :

  • 713A->G

Allele Name : Durham
Genotype(s) : Not Available
Type(s) : ADR Inferred
Groups : G6PD deficiency
Description : Increased risk of hemolytic anemia.
References :

  1. Welsh SJ, Corrie PG: Management of BRAF and MEK inhibitor toxicities in patients with metastatic melanoma. Ther Adv Med Oncol. 2015 Mar;7(2):122-36. doi: 10.1177/1758834014566428. [PubMed:25755684 ]
  2. Tafinlar® (dabrafenib) capsules[package insert]. East Hanover, New Jersey: Novartis Pharmaceuticals Corporation; 2016. [Link]

PMID: 21750219

Dabrafenib

By

Dabrafenib

Product: GSK163090

Identifier : DBSNPE001129
Drug : DB08912 (Dabrafenib)
Interacting Gene/Enzyme : Glucose-6-phosphate 1-dehydrogenase
Gene Name : G6PD
UniProt ID : P11413
Defining Change(s) :

  • 724_729delGGCACT

Allele Name : Stonybrook
Genotype(s) : Not Available
Type(s) : ADR Inferred
Groups : G6PD deficiency
Description : Increased risk of hemolytic anemia.
References :

  1. Welsh SJ, Corrie PG: Management of BRAF and MEK inhibitor toxicities in patients with metastatic melanoma. Ther Adv Med Oncol. 2015 Mar;7(2):122-36. doi: 10.1177/1758834014566428. [PubMed:25755684 ]
  2. Tafinlar® (dabrafenib) capsules[package insert]. East Hanover, New Jersey: Novartis Pharmaceuticals Corporation; 2016. [Link]

PMID: 21325073

Dabrafenib

By

Dabrafenib

Product: Ancitabine (hydrochloride)

Identifier : DBSNPE001130
Drug : DB08912 (Dabrafenib)
Interacting Gene/Enzyme : Glucose-6-phosphate 1-dehydrogenase
Gene Name : G6PD
UniProt ID : P11413
Defining Change(s) :

  • 769C->G

Allele Name : Wayne
Genotype(s) : Not Available
Type(s) : ADR Inferred
Groups : G6PD deficiency
Description : Increased risk of hemolytic anemia.
References :

  1. Welsh SJ, Corrie PG: Management of BRAF and MEK inhibitor toxicities in patients with metastatic melanoma. Ther Adv Med Oncol. 2015 Mar;7(2):122-36. doi: 10.1177/1758834014566428. [PubMed:25755684 ]
  2. Tafinlar® (dabrafenib) capsules[package insert]. East Hanover, New Jersey: Novartis Pharmaceuticals Corporation; 2016. [Link]

PMID: 20166697

Dabrafenib

By

Dabrafenib

Product: Nifursol

Identifier : DBSNPE001131
Drug : DB08912 (Dabrafenib)
Interacting Gene/Enzyme : Glucose-6-phosphate 1-dehydrogenase
Gene Name : G6PD
UniProt ID : P11413
Defining Change(s) :

  • 806G->A

Allele Name : Aveiro
Genotype(s) : Not Available
Type(s) : ADR Inferred
Groups : G6PD deficiency
Description : Increased risk of hemolytic anemia.
References :

  1. Welsh SJ, Corrie PG: Management of BRAF and MEK inhibitor toxicities in patients with metastatic melanoma. Ther Adv Med Oncol. 2015 Mar;7(2):122-36. doi: 10.1177/1758834014566428. [PubMed:25755684 ]
  2. Tafinlar® (dabrafenib) capsules[package insert]. East Hanover, New Jersey: Novartis Pharmaceuticals Corporation; 2016. [Link]

PMID: 23319802

Dabrafenib

By

Dabrafenib

Product: Clebopride (malate)

Identifier : DBSNPE001132
Drug : DB08912 (Dabrafenib)
Interacting Gene/Enzyme : Glucose-6-phosphate 1-dehydrogenase
Gene Name : G6PD
UniProt ID : P11413
Defining Change(s) :

  • 820G->A

Allele Name : Cleveland Corum
Genotype(s) : Not Available
Type(s) : ADR Inferred
Groups : G6PD deficiency
Description : Increased risk of hemolytic anemia.
References :

  1. Welsh SJ, Corrie PG: Management of BRAF and MEK inhibitor toxicities in patients with metastatic melanoma. Ther Adv Med Oncol. 2015 Mar;7(2):122-36. doi: 10.1177/1758834014566428. [PubMed:25755684 ]
  2. Tafinlar® (dabrafenib) capsules[package insert]. East Hanover, New Jersey: Novartis Pharmaceuticals Corporation; 2016. [Link]

PMID: 20072130

Dabrafenib

By

Dabrafenib

Product: Chlorphenoxamine

Identifier : DBSNPE001133
Drug : DB08912 (Dabrafenib)
Interacting Gene/Enzyme : Glucose-6-phosphate 1-dehydrogenase
Gene Name : G6PD
UniProt ID : P11413
Defining Change(s) :

  • 821A>T

Allele Name : Lille
Genotype(s) : Not Available
Type(s) : ADR Inferred
Groups : G6PD deficiency
Description : Increased risk of hemolytic anemia.
References :

  1. Welsh SJ, Corrie PG: Management of BRAF and MEK inhibitor toxicities in patients with metastatic melanoma. Ther Adv Med Oncol. 2015 Mar;7(2):122-36. doi: 10.1177/1758834014566428. [PubMed:25755684 ]
  2. Tafinlar® (dabrafenib) capsules[package insert]. East Hanover, New Jersey: Novartis Pharmaceuticals Corporation; 2016. [Link]

PMID: 26012633

Dabrafenib

By

Dabrafenib

Product: Ceftizoxime (sodium)

Identifier : DBSNPE001134
Drug : DB08912 (Dabrafenib)
Interacting Gene/Enzyme : Glucose-6-phosphate 1-dehydrogenase
Gene Name : G6PD
UniProt ID : P11413
Defining Change(s) :

  • 825G>C

Allele Name : Bangkok
Genotype(s) : Not Available
Type(s) : ADR Inferred
Groups : G6PD deficiency
Description : Increased risk of hemolytic anemia.
References :

  1. Welsh SJ, Corrie PG: Management of BRAF and MEK inhibitor toxicities in patients with metastatic melanoma. Ther Adv Med Oncol. 2015 Mar;7(2):122-36. doi: 10.1177/1758834014566428. [PubMed:25755684 ]
  2. Tafinlar® (dabrafenib) capsules[package insert]. East Hanover, New Jersey: Novartis Pharmaceuticals Corporation; 2016. [Link]

PMID: 22157018

Dabrafenib

By

Dabrafenib

Product: Benzetimide (hydrochloride)

Identifier : DBSNPE001135
Drug : DB08912 (Dabrafenib)
Interacting Gene/Enzyme : Glucose-6-phosphate 1-dehydrogenase
Gene Name : G6PD
UniProt ID : P11413
Defining Change(s) :

  • 826C->T

Allele Name : Sugao
Genotype(s) : Not Available
Type(s) : ADR Inferred
Groups : G6PD deficiency
Description : Increased risk of hemolytic anemia.
References :

  1. Welsh SJ, Corrie PG: Management of BRAF and MEK inhibitor toxicities in patients with metastatic melanoma. Ther Adv Med Oncol. 2015 Mar;7(2):122-36. doi: 10.1177/1758834014566428. [PubMed:25755684 ]
  2. Tafinlar® (dabrafenib) capsules[package insert]. East Hanover, New Jersey: Novartis Pharmaceuticals Corporation; 2016. [Link]

PMID: 23394126

Dabrafenib

By

Dabrafenib

Product: Mezlocillin (sodium)

Identifier : DBSNPE001136
Drug : DB08912 (Dabrafenib)
Interacting Gene/Enzyme : Glucose-6-phosphate 1-dehydrogenase
Gene Name : G6PD
UniProt ID : P11413
Defining Change(s) :

  • 832T->C

Allele Name : La Jolla
Genotype(s) : Not Available
Type(s) : ADR Inferred
Groups : G6PD deficiency
Description : Increased risk of hemolytic anemia.
References :

  1. Welsh SJ, Corrie PG: Management of BRAF and MEK inhibitor toxicities in patients with metastatic melanoma. Ther Adv Med Oncol. 2015 Mar;7(2):122-36. doi: 10.1177/1758834014566428. [PubMed:25755684 ]
  2. Tafinlar® (dabrafenib) capsules[package insert]. East Hanover, New Jersey: Novartis Pharmaceuticals Corporation; 2016. [Link]

PMID: 10519405

Dabrafenib

By

Dabrafenib

Product: Cefonicid (sodium)

Identifier : DBSNPE001137
Drug : DB08912 (Dabrafenib)
Interacting Gene/Enzyme : Glucose-6-phosphate 1-dehydrogenase
Gene Name : G6PD
UniProt ID : P11413
Defining Change(s) :

  • 833C->T

Allele Name : Wexham
Genotype(s) : Not Available
Type(s) : ADR Inferred
Groups : G6PD deficiency
Description : Increased risk of hemolytic anemia.
References :

  1. Welsh SJ, Corrie PG: Management of BRAF and MEK inhibitor toxicities in patients with metastatic melanoma. Ther Adv Med Oncol. 2015 Mar;7(2):122-36. doi: 10.1177/1758834014566428. [PubMed:25755684 ]
  2. Tafinlar® (dabrafenib) capsules[package insert]. East Hanover, New Jersey: Novartis Pharmaceuticals Corporation; 2016. [Link]

PMID: 7592920

Dabrafenib

By

Dabrafenib

Product: Cefsulodin (sodium)

Identifier : DBSNPE001138
Drug : DB08912 (Dabrafenib)
Interacting Gene/Enzyme : Glucose-6-phosphate 1-dehydrogenase
Gene Name : G6PD
UniProt ID : P11413
Defining Change(s) :

  • 851T>C

Allele Name : Piodivkow
Genotype(s) : Not Available
Type(s) : ADR Inferred
Groups : G6PD deficiency
Description : Increased risk of hemolytic anemia.
References :

  1. Welsh SJ, Corrie PG: Management of BRAF and MEK inhibitor toxicities in patients with metastatic melanoma. Ther Adv Med Oncol. 2015 Mar;7(2):122-36. doi: 10.1177/1758834014566428. [PubMed:25755684 ]
  2. Tafinlar® (dabrafenib) capsules[package insert]. East Hanover, New Jersey: Novartis Pharmaceuticals Corporation; 2016. [Link]

PMID: 20653956

Dabrafenib

By

Dabrafenib

Product: Baicalin

Identifier : DBSNPE001139
Drug : DB08912 (Dabrafenib)
Interacting Gene/Enzyme : Glucose-6-phosphate 1-dehydrogenase
Gene Name : G6PD
UniProt ID : P11413
Defining Change(s) :

  • 910G->T

Allele Name : West Virginia
Genotype(s) : Not Available
Type(s) : ADR Inferred
Groups : G6PD deficiency
Description : Increased risk of hemolytic anemia.
References :

  1. Welsh SJ, Corrie PG: Management of BRAF and MEK inhibitor toxicities in patients with metastatic melanoma. Ther Adv Med Oncol. 2015 Mar;7(2):122-36. doi: 10.1177/1758834014566428. [PubMed:25755684 ]
  2. Tafinlar® (dabrafenib) capsules[package insert]. East Hanover, New Jersey: Novartis Pharmaceuticals Corporation; 2016. [Link]

PMID: 9157972

Dabrafenib

By

Dabrafenib

Product: Safflower Yellow

Identifier : DBSNPE001140
Drug : DB08912 (Dabrafenib)
Interacting Gene/Enzyme : Glucose-6-phosphate 1-dehydrogenase
Gene Name : G6PD
UniProt ID : P11413
Defining Change(s) :

  • 921G->C

Allele Name : Omiya
Genotype(s) : Not Available
Type(s) : ADR Inferred
Groups : G6PD deficiency
Description : Increased risk of hemolytic anemia.
References :

  1. Welsh SJ, Corrie PG: Management of BRAF and MEK inhibitor toxicities in patients with metastatic melanoma. Ther Adv Med Oncol. 2015 Mar;7(2):122-36. doi: 10.1177/1758834014566428. [PubMed:25755684 ]
  2. Tafinlar® (dabrafenib) capsules[package insert]. East Hanover, New Jersey: Novartis Pharmaceuticals Corporation; 2016. [Link]

PMID: 8910319

Dabrafenib

By

Dabrafenib

Product: Ligustilide

Identifier : DBSNPE001141
Drug : DB08912 (Dabrafenib)
Interacting Gene/Enzyme : Glucose-6-phosphate 1-dehydrogenase
Gene Name : G6PD
UniProt ID : P11413
Defining Change(s) :

  • 953_976delCCACCAAAGGGTACCTGGAC GACC

Allele Name : Nara
Genotype(s) : Not Available
Type(s) : ADR Inferred
Groups : G6PD deficiency
Description : Increased risk of hemolytic anemia.
References :

  1. Welsh SJ, Corrie PG: Management of BRAF and MEK inhibitor toxicities in patients with metastatic melanoma. Ther Adv Med Oncol. 2015 Mar;7(2):122-36. doi: 10.1177/1758834014566428. [PubMed:25755684 ]
  2. Tafinlar® (dabrafenib) capsules[package insert]. East Hanover, New Jersey: Novartis Pharmaceuticals Corporation; 2016. [Link]

PMID: 27558159

Dabrafenib

By

Dabrafenib

Product: Ligustrazine (hydrochloride)

Identifier : DBSNPE001142
Drug : DB08912 (Dabrafenib)
Interacting Gene/Enzyme : Glucose-6-phosphate 1-dehydrogenase
Gene Name : G6PD
UniProt ID : P11413
Defining Change(s) :

  • 962G->A

Allele Name : Manhattan
Genotype(s) : Not Available
Type(s) : ADR Inferred
Groups : G6PD deficiency
Description : Increased risk of hemolytic anemia.
References :

  1. Welsh SJ, Corrie PG: Management of BRAF and MEK inhibitor toxicities in patients with metastatic melanoma. Ther Adv Med Oncol. 2015 Mar;7(2):122-36. doi: 10.1177/1758834014566428. [PubMed:25755684 ]
  2. Tafinlar® (dabrafenib) capsules[package insert]. East Hanover, New Jersey: Novartis Pharmaceuticals Corporation; 2016. [Link]

PMID: 15034210

Dabrafenib

By

Dabrafenib

Product: Astragalus polysaccharide

Identifier : DBSNPE001143
Drug : DB08912 (Dabrafenib)
Interacting Gene/Enzyme : Glucose-6-phosphate 1-dehydrogenase
Gene Name : G6PD
UniProt ID : P11413
Defining Change(s) :

  • 964T->C

Allele Name : Rehevot
Genotype(s) : Not Available
Type(s) : ADR Inferred
Groups : G6PD deficiency
Description : Increased risk of hemolytic anemia.
References :

  1. Welsh SJ, Corrie PG: Management of BRAF and MEK inhibitor toxicities in patients with metastatic melanoma. Ther Adv Med Oncol. 2015 Mar;7(2):122-36. doi: 10.1177/1758834014566428. [PubMed:25755684 ]
  2. Tafinlar® (dabrafenib) capsules[package insert]. East Hanover, New Jersey: Novartis Pharmaceuticals Corporation; 2016. [Link]

PMID: 11258552

Dabrafenib

By

Dabrafenib

Product: Coixol

Identifier : DBSNPE001144
Drug : DB08912 (Dabrafenib)
Interacting Gene/Enzyme : Glucose-6-phosphate 1-dehydrogenase
Gene Name : G6PD
UniProt ID : P11413
Defining Change(s) :

  • 99A->G
  • 1360C->T

Allele Name : Honiara
Genotype(s) : Not Available
Type(s) : ADR Inferred
Groups : G6PD deficiency
Description : Increased risk of hemolytic anemia.
References :

  1. Welsh SJ, Corrie PG: Management of BRAF and MEK inhibitor toxicities in patients with metastatic melanoma. Ther Adv Med Oncol. 2015 Mar;7(2):122-36. doi: 10.1177/1758834014566428. [PubMed:25755684 ]
  2. Tafinlar® (dabrafenib) capsules[package insert]. East Hanover, New Jersey: Novartis Pharmaceuticals Corporation; 2016. [Link]

PMID: 9304400

Dabrafenib

By

Dabrafenib

Product: beta-Mangostin

Identifier : DBSNPE001145
Drug : DB08912 (Dabrafenib)
Interacting Gene/Enzyme : Glucose-6-phosphate 1-dehydrogenase
Gene Name : G6PD
UniProt ID : P11413
Defining Change(s) :

  • 1246G->A

Allele Name : Tokyo, Fukushima
Genotype(s) : Not Available
Type(s) : ADR Inferred
Groups : G6PD deficiency
Description : Increased risk of hemolytic anemia.
References :

  1. Welsh SJ, Corrie PG: Management of BRAF and MEK inhibitor toxicities in patients with metastatic melanoma. Ther Adv Med Oncol. 2015 Mar;7(2):122-36. doi: 10.1177/1758834014566428. [PubMed:25755684 ]
  2. Tafinlar® (dabrafenib) capsules[package insert]. East Hanover, New Jersey: Novartis Pharmaceuticals Corporation; 2016. [Link]

PMID: 20406854

Dabrafenib

By

Dabrafenib

Product: Diosgenin

Identifier : DBSNPE001146
Drug : DB08912 (Dabrafenib)
Interacting Gene/Enzyme : Glucose-6-phosphate 1-dehydrogenase
Gene Name : G6PD
UniProt ID : P11413
Defining Change(s) :

  • 1003G->A

Allele Name : Chatham
Genotype(s) : Not Available
Type(s) : ADR Inferred
Groups : G6PD deficiency
Description : Increased risk of hemolytic anemia.
References :

  1. Welsh SJ, Corrie PG: Management of BRAF and MEK inhibitor toxicities in patients with metastatic melanoma. Ther Adv Med Oncol. 2015 Mar;7(2):122-36. doi: 10.1177/1758834014566428. [PubMed:25755684 ]
  2. Tafinlar® (dabrafenib) capsules[package insert]. East Hanover, New Jersey: Novartis Pharmaceuticals Corporation; 2016. [Link]

PMID: 15240720

Dabrafenib

By

Dabrafenib

Product: Salidroside

Identifier : DBSNPE001147
Drug : DB08912 (Dabrafenib)
Interacting Gene/Enzyme : Glucose-6-phosphate 1-dehydrogenase
Gene Name : G6PD
UniProt ID : P11413
Defining Change(s) :

  • 1004C->A

Allele Name : Fushan
Genotype(s) : Not Available
Type(s) : ADR Inferred
Groups : G6PD deficiency
Description : Increased risk of hemolytic anemia.
References :

  1. Welsh SJ, Corrie PG: Management of BRAF and MEK inhibitor toxicities in patients with metastatic melanoma. Ther Adv Med Oncol. 2015 Mar;7(2):122-36. doi: 10.1177/1758834014566428. [PubMed:25755684 ]
  2. Tafinlar® (dabrafenib) capsules[package insert]. East Hanover, New Jersey: Novartis Pharmaceuticals Corporation; 2016. [Link]

PMID: 8095552

Dabrafenib

By

Dabrafenib

Product: Eicosapentaenoic acid (ethyl ester)

Identifier : DBSNPE001148
Drug : DB08912 (Dabrafenib)
Interacting Gene/Enzyme : Glucose-6-phosphate 1-dehydrogenase
Gene Name : G6PD
UniProt ID : P11413
Defining Change(s) :

  • 1052G->T

Allele Name : Partenope
Genotype(s) : Not Available
Type(s) : ADR Inferred
Groups : G6PD deficiency
Description : Increased risk of hemolytic anemia.
References :

  1. Welsh SJ, Corrie PG: Management of BRAF and MEK inhibitor toxicities in patients with metastatic melanoma. Ther Adv Med Oncol. 2015 Mar;7(2):122-36. doi: 10.1177/1758834014566428. [PubMed:25755684 ]
  2. Tafinlar® (dabrafenib) capsules[package insert]. East Hanover, New Jersey: Novartis Pharmaceuticals Corporation; 2016. [Link]

PMID: 3361576

Dabrafenib

By

Dabrafenib

Product: Ellipticine

Identifier : DBSNPE001149
Drug : DB08912 (Dabrafenib)
Interacting Gene/Enzyme : Glucose-6-phosphate 1-dehydrogenase
Gene Name : G6PD
UniProt ID : P11413
Defining Change(s) :

  • 1057C->T

Allele Name : Ierapediva
Genotype(s) : Not Available
Type(s) : ADR Inferred
Groups : G6PD deficiency
Description : Increased risk of hemolytic anemia.
References :

  1. Welsh SJ, Corrie PG: Management of BRAF and MEK inhibitor toxicities in patients with metastatic melanoma. Ther Adv Med Oncol. 2015 Mar;7(2):122-36. doi: 10.1177/1758834014566428. [PubMed:25755684 ]
  2. Tafinlar® (dabrafenib) capsules[package insert]. East Hanover, New Jersey: Novartis Pharmaceuticals Corporation; 2016. [Link]

PMID: 4015683

Dabrafenib

By

Dabrafenib

Product: Sirtinol

Identifier : DBSNPE001150
Drug : DB08912 (Dabrafenib)
Interacting Gene/Enzyme : Glucose-6-phosphate 1-dehydrogenase
Gene Name : G6PD
UniProt ID : P11413
Defining Change(s) :

  • 1193A->G

Allele Name : Anadia
Genotype(s) : Not Available
Type(s) : ADR Inferred
Groups : G6PD deficiency
Description : Increased risk of hemolytic anemia.
References :

  1. Welsh SJ, Corrie PG: Management of BRAF and MEK inhibitor toxicities in patients with metastatic melanoma. Ther Adv Med Oncol. 2015 Mar;7(2):122-36. doi: 10.1177/1758834014566428. [PubMed:25755684 ]
  2. Tafinlar® (dabrafenib) capsules[package insert]. East Hanover, New Jersey: Novartis Pharmaceuticals Corporation; 2016. [Link]

PMID: 9503264

Dabrafenib

By

Dabrafenib

Product: Amprolium (hydrochloride)

Identifier : DBSNPE001151
Drug : DB08912 (Dabrafenib)
Interacting Gene/Enzyme : Glucose-6-phosphate 1-dehydrogenase
Gene Name : G6PD
UniProt ID : P11413
Defining Change(s) :

  • 1220A->C

Allele Name : Abeno
Genotype(s) : Not Available
Type(s) : ADR Inferred
Groups : G6PD deficiency
Description : Increased risk of hemolytic anemia.
References :

  1. Welsh SJ, Corrie PG: Management of BRAF and MEK inhibitor toxicities in patients with metastatic melanoma. Ther Adv Med Oncol. 2015 Mar;7(2):122-36. doi: 10.1177/1758834014566428. [PubMed:25755684 ]
  2. Tafinlar® (dabrafenib) capsules[package insert]. East Hanover, New Jersey: Novartis Pharmaceuticals Corporation; 2016. [Link]

PMID: 1773824

Dabrafenib

By

Dabrafenib

Product: Didox

Identifier : DBSNPE001152
Drug : DB08912 (Dabrafenib)
Interacting Gene/Enzyme : Glucose-6-phosphate 1-dehydrogenase
Gene Name : G6PD
UniProt ID : P11413
Defining Change(s) :

  • 1291G->A

Allele Name : Surabaya
Genotype(s) : Not Available
Type(s) : ADR Inferred
Groups : G6PD deficiency
Description : Increased risk of hemolytic anemia.
References :

  1. Welsh SJ, Corrie PG: Management of BRAF and MEK inhibitor toxicities in patients with metastatic melanoma. Ther Adv Med Oncol. 2015 Mar;7(2):122-36. doi: 10.1177/1758834014566428. [PubMed:25755684 ]
  2. Tafinlar® (dabrafenib) capsules[package insert]. East Hanover, New Jersey: Novartis Pharmaceuticals Corporation; 2016. [Link]

PMID: 2173754

Dabrafenib

By

Dabrafenib

Product: NQDI-1

Identifier : DBSNPE001153
Drug : DB08912 (Dabrafenib)
Interacting Gene/Enzyme : Glucose-6-phosphate 1-dehydrogenase
Gene Name : G6PD
UniProt ID : P11413
Defining Change(s) :

  • 1316G->C

Allele Name : Pawnee
Genotype(s) : Not Available
Type(s) : ADR Inferred
Groups : G6PD deficiency
Description : Increased risk of hemolytic anemia.
References :

  1. Welsh SJ, Corrie PG: Management of BRAF and MEK inhibitor toxicities in patients with metastatic melanoma. Ther Adv Med Oncol. 2015 Mar;7(2):122-36. doi: 10.1177/1758834014566428. [PubMed:25755684 ]
  2. Tafinlar® (dabrafenib) capsules[package insert]. East Hanover, New Jersey: Novartis Pharmaceuticals Corporation; 2016. [Link]

PMID: 11744750

Dabrafenib

By

Dabrafenib

Product: Gonadorelin (acetate)

Identifier : DBSNPE001154
Drug : DB08912 (Dabrafenib)
Interacting Gene/Enzyme : Glucose-6-phosphate 1-dehydrogenase
Gene Name : G6PD
UniProt ID : P11413
Defining Change(s) :

  • 1342A->G

Allele Name : S. Antioco
Genotype(s) : Not Available
Type(s) : ADR Inferred
Groups : G6PD deficiency
Description : Increased risk of hemolytic anemia.
References :

  1. Welsh SJ, Corrie PG: Management of BRAF and MEK inhibitor toxicities in patients with metastatic melanoma. Ther Adv Med Oncol. 2015 Mar;7(2):122-36. doi: 10.1177/1758834014566428. [PubMed:25755684 ]
  2. Tafinlar® (dabrafenib) capsules[package insert]. East Hanover, New Jersey: Novartis Pharmaceuticals Corporation; 2016. [Link]

PMID: 27247228

Dabrafenib

By

Dabrafenib

Product: Eleutheroside E

Identifier : DBSNPE001155
Drug : DB08912 (Dabrafenib)
Interacting Gene/Enzyme : Glucose-6-phosphate 1-dehydrogenase
Gene Name : G6PD
UniProt ID : P11413
Defining Change(s) :

  • 1347G->C

Allele Name : Cassano
Genotype(s) : Not Available
Type(s) : ADR Inferred
Groups : G6PD deficiency
Description : Increased risk of hemolytic anemia.
References :

  1. Welsh SJ, Corrie PG: Management of BRAF and MEK inhibitor toxicities in patients with metastatic melanoma. Ther Adv Med Oncol. 2015 Mar;7(2):122-36. doi: 10.1177/1758834014566428. [PubMed:25755684 ]
  2. Tafinlar® (dabrafenib) capsules[package insert]. East Hanover, New Jersey: Novartis Pharmaceuticals Corporation; 2016. [Link]

PMID: 10336561

Dabrafenib

By

Dabrafenib

Product: CJ-42794

Identifier : DBSNPE001156
Drug : DB08912 (Dabrafenib)
Interacting Gene/Enzyme : Glucose-6-phosphate 1-dehydrogenase
Gene Name : G6PD
UniProt ID : P11413
Defining Change(s) :

  • 1347G->C
  • 1360C->T

Allele Name : Hermoupolis
Genotype(s) : Not Available
Type(s) : ADR Inferred
Groups : G6PD deficiency
Description : Increased risk of hemolytic anemia.
References :

  1. Welsh SJ, Corrie PG: Management of BRAF and MEK inhibitor toxicities in patients with metastatic melanoma. Ther Adv Med Oncol. 2015 Mar;7(2):122-36. doi: 10.1177/1758834014566428. [PubMed:25755684 ]
  2. Tafinlar® (dabrafenib) capsules[package insert]. East Hanover, New Jersey: Novartis Pharmaceuticals Corporation; 2016. [Link]

PMID: 8985692

Dabrafenib

By

Dabrafenib

Product: APD597

Identifier : DBSNPE001157
Drug : DB08912 (Dabrafenib)
Interacting Gene/Enzyme : Glucose-6-phosphate 1-dehydrogenase
Gene Name : G6PD
UniProt ID : P11413
Defining Change(s) :

  • 1360C->T

Allele Name : Union,Maewo, Chinese-2, Kalo
Genotype(s) : Not Available
Type(s) : ADR Inferred
Groups : G6PD deficiency
Description : Increased risk of hemolytic anemia.
References :

  1. Welsh SJ, Corrie PG: Management of BRAF and MEK inhibitor toxicities in patients with metastatic melanoma. Ther Adv Med Oncol. 2015 Mar;7(2):122-36. doi: 10.1177/1758834014566428. [PubMed:25755684 ]
  2. Tafinlar® (dabrafenib) capsules[package insert]. East Hanover, New Jersey: Novartis Pharmaceuticals Corporation; 2016. [Link]

PMID: 21847371

Dabrafenib

By

Dabrafenib

Product: RRx-001

Identifier : DBSNPE001158
Drug : DB08912 (Dabrafenib)
Interacting Gene/Enzyme : Glucose-6-phosphate 1-dehydrogenase
Gene Name : G6PD
UniProt ID : P11413
Defining Change(s) :

  • 1361G->A

Allele Name : Andalus
Genotype(s) : Not Available
Type(s) : ADR Inferred
Groups : G6PD deficiency
Description : Increased risk of hemolytic anemia.
References :

  1. Welsh SJ, Corrie PG: Management of BRAF and MEK inhibitor toxicities in patients with metastatic melanoma. Ther Adv Med Oncol. 2015 Mar;7(2):122-36. doi: 10.1177/1758834014566428. [PubMed:25755684 ]
  2. Tafinlar® (dabrafenib) capsules[package insert]. East Hanover, New Jersey: Novartis Pharmaceuticals Corporation; 2016. [Link]

PMID: 8101867

Dabrafenib

By

Dabrafenib

Product: Fenoterol (hydrobromide)

Identifier : DBSNPE001159
Drug : DB08912 (Dabrafenib)
Interacting Gene/Enzyme : Glucose-6-phosphate 1-dehydrogenase
Gene Name : G6PD
UniProt ID : P11413
Defining Change(s) :

  • 1376G->C

Allele Name : Cosenza
Genotype(s) : Not Available
Type(s) : ADR Inferred
Groups : G6PD deficiency
Description : Increased risk of hemolytic anemia.
References :

  1. Welsh SJ, Corrie PG: Management of BRAF and MEK inhibitor toxicities in patients with metastatic melanoma. Ther Adv Med Oncol. 2015 Mar;7(2):122-36. doi: 10.1177/1758834014566428. [PubMed:25755684 ]
  2. Tafinlar® (dabrafenib) capsules[package insert]. East Hanover, New Jersey: Novartis Pharmaceuticals Corporation; 2016. [Link]

PMID: 10771287

Dabrafenib

By

Dabrafenib

Product: 9-Azido-Neu5DAz

Identifier : DBSNPE001160
Drug : DB08912 (Dabrafenib)
Interacting Gene/Enzyme : Glucose-6-phosphate 1-dehydrogenase
Gene Name : G6PD
UniProt ID : P11413
Defining Change(s) :

  • 1376G->T

Allele Name : Canton, Taiwan- Hakka, Gifu-like, Agrigento-like
Genotype(s) : Not Available
Type(s) : ADR Inferred
Groups : G6PD deficiency
Description : Increased risk of hemolytic anemia.
References :

  1. Welsh SJ, Corrie PG: Management of BRAF and MEK inhibitor toxicities in patients with metastatic melanoma. Ther Adv Med Oncol. 2015 Mar;7(2):122-36. doi: 10.1177/1758834014566428. [PubMed:25755684 ]
  2. Tafinlar® (dabrafenib) capsules[package insert]. East Hanover, New Jersey: Novartis Pharmaceuticals Corporation; 2016. [Link]

PMID: 9514305

Dabrafenib

By

Dabrafenib

Product: JAK3-IN-1

Identifier : DBSNPE001161
Drug : DB08912 (Dabrafenib)
Interacting Gene/Enzyme : Glucose-6-phosphate 1-dehydrogenase
Gene Name : G6PD
UniProt ID : P11413
Defining Change(s) :

  • 1387C->A

Allele Name : Flores
Genotype(s) : Not Available
Type(s) : ADR Inferred
Groups : G6PD deficiency
Description : Increased risk of hemolytic anemia.
References :

  1. Welsh SJ, Corrie PG: Management of BRAF and MEK inhibitor toxicities in patients with metastatic melanoma. Ther Adv Med Oncol. 2015 Mar;7(2):122-36. doi: 10.1177/1758834014566428. [PubMed:25755684 ]
  2. Tafinlar® (dabrafenib) capsules[package insert]. East Hanover, New Jersey: Novartis Pharmaceuticals Corporation; 2016. [Link]

PMID: 8813529

Dabrafenib

By

Dabrafenib

Product: Pimelic Diphenylamide 106 (analog)

Identifier : DBSNPE001162
Drug : DB08912 (Dabrafenib)
Interacting Gene/Enzyme : Glucose-6-phosphate 1-dehydrogenase
Gene Name : G6PD
UniProt ID : P11413
Defining Change(s) :

  • 1388G->A

Allele Name : Kaiping, Anant, Dhon, Sapporo-like, Wosera
Genotype(s) : Not Available
Type(s) : ADR Inferred
Groups : G6PD deficiency
Description : Increased risk of hemolytic anemia.
References :

  1. Welsh SJ, Corrie PG: Management of BRAF and MEK inhibitor toxicities in patients with metastatic melanoma. Ther Adv Med Oncol. 2015 Mar;7(2):122-36. doi: 10.1177/1758834014566428. [PubMed:25755684 ]
  2. Tafinlar® (dabrafenib) capsules[package insert]. East Hanover, New Jersey: Novartis Pharmaceuticals Corporation; 2016. [Link]

PMID: 9014500

Dabrafenib

By

Dabrafenib

Product: Ro 46-2005

Identifier : DBSNPE001164
Drug : DB08912 (Dabrafenib)
Interacting Gene/Enzyme : Glucose-6-phosphate 1-dehydrogenase
Gene Name : G6PD
UniProt ID : P11413
Defining Change(s) :

  • 179T>C

Allele Name : Costanzo
Genotype(s) : Not Available
Type(s) : ADR Inferred
Groups : G6PD deficiency
Description : Increased risk of hemolytic anemia.
References :

  1. Welsh SJ, Corrie PG: Management of BRAF and MEK inhibitor toxicities in patients with metastatic melanoma. Ther Adv Med Oncol. 2015 Mar;7(2):122-36. doi: 10.1177/1758834014566428. [PubMed:25755684 ]
  2. Tafinlar® (dabrafenib) capsules[package insert]. East Hanover, New Jersey: Novartis Pharmaceuticals Corporation; 2016. [Link]

PMID: 2081813

Dabrafenib

By

Dabrafenib

Product: Kasugamycin (hydrochloride hydrate)

Identifier : DBSNPE001165
Drug : DB08912 (Dabrafenib)
Interacting Gene/Enzyme : Glucose-6-phosphate 1-dehydrogenase
Gene Name : G6PD
UniProt ID : P11413
Defining Change(s) :

  • 185C->A

Allele Name : Amazonia
Genotype(s) : Not Available
Type(s) : ADR Inferred
Groups : G6PD deficiency
Description : Increased risk of hemolytic anemia.
References :

  1. Welsh SJ, Corrie PG: Management of BRAF and MEK inhibitor toxicities in patients with metastatic melanoma. Ther Adv Med Oncol. 2015 Mar;7(2):122-36. doi: 10.1177/1758834014566428. [PubMed:25755684 ]
  2. Tafinlar® (dabrafenib) capsules[package insert]. East Hanover, New Jersey: Novartis Pharmaceuticals Corporation; 2016. [Link]

PMID: 4393081

Dabrafenib

By

Dabrafenib

Product: AMG-337

Identifier : DBSNPE001166
Drug : DB08912 (Dabrafenib)
Interacting Gene/Enzyme : Glucose-6-phosphate 1-dehydrogenase
Gene Name : G6PD
UniProt ID : P11413
Defining Change(s) :

  • 196T->A

Allele Name : Songklanagarind
Genotype(s) : Not Available
Type(s) : ADR Inferred
Groups : G6PD deficiency
Description : Increased risk of hemolytic anemia.
References :

  1. Welsh SJ, Corrie PG: Management of BRAF and MEK inhibitor toxicities in patients with metastatic melanoma. Ther Adv Med Oncol. 2015 Mar;7(2):122-36. doi: 10.1177/1758834014566428. [PubMed:25755684 ]
  2. Tafinlar® (dabrafenib) capsules[package insert]. East Hanover, New Jersey: Novartis Pharmaceuticals Corporation; 2016. [Link]

PMID: 28300633

Dabrafenib

By

Dabrafenib

Product: L-778123 (hydrochloride)

Identifier : DBSNPE001167
Drug : DB08912 (Dabrafenib)
Interacting Gene/Enzyme : Glucose-6-phosphate 1-dehydrogenase
Gene Name : G6PD
UniProt ID : P11413
Defining Change(s) :

  • 202G->A
  • 871G->A

Allele Name : Hechi
Genotype(s) : Not Available
Type(s) : ADR Inferred
Groups : G6PD deficiency
Description : Increased risk of hemolytic anemia.
References :

  1. Welsh SJ, Corrie PG: Management of BRAF and MEK inhibitor toxicities in patients with metastatic melanoma. Ther Adv Med Oncol. 2015 Mar;7(2):122-36. doi: 10.1177/1758834014566428. [PubMed:25755684 ]
  2. Tafinlar® (dabrafenib) capsules[package insert]. East Hanover, New Jersey: Novartis Pharmaceuticals Corporation; 2016. [Link]

PMID: 28286129

Dabrafenib

By

Dabrafenib

Product: L67

Identifier : DBSNPE001168
Drug : DB08912 (Dabrafenib)
Interacting Gene/Enzyme : Glucose-6-phosphate 1-dehydrogenase
Gene Name : G6PD
UniProt ID : P11413
Defining Change(s) :

  • 208T->C

Allele Name : Namouru
Genotype(s) : Not Available
Type(s) : ADR Inferred
Groups : G6PD deficiency
Description : Increased risk of hemolytic anemia.
References :

  1. Welsh SJ, Corrie PG: Management of BRAF and MEK inhibitor toxicities in patients with metastatic melanoma. Ther Adv Med Oncol. 2015 Mar;7(2):122-36. doi: 10.1177/1758834014566428. [PubMed:25755684 ]
  2. Tafinlar® (dabrafenib) capsules[package insert]. East Hanover, New Jersey: Novartis Pharmaceuticals Corporation; 2016. [Link]

PMID: 22580167

Dabrafenib

By

Dabrafenib

Product: DMXAA

Identifier : DBSNPE001169
Drug : DB08912 (Dabrafenib)
Interacting Gene/Enzyme : Glucose-6-phosphate 1-dehydrogenase
Gene Name : G6PD
UniProt ID : P11413
Defining Change(s) :

  • 352T>C

Allele Name : Bao Loc
Genotype(s) : Not Available
Type(s) : ADR Inferred
Groups : G6PD deficiency
Description : Increased risk of hemolytic anemia.
References :

  1. Welsh SJ, Corrie PG: Management of BRAF and MEK inhibitor toxicities in patients with metastatic melanoma. Ther Adv Med Oncol. 2015 Mar;7(2):122-36. doi: 10.1177/1758834014566428. [PubMed:25755684 ]
  2. Tafinlar® (dabrafenib) capsules[package insert]. East Hanover, New Jersey: Novartis Pharmaceuticals Corporation; 2016. [Link]

PMID: 18832425

Dabrafenib

By

Dabrafenib

Product: Pyr10

Identifier : DBSNPE001170
Drug : DB08912 (Dabrafenib)
Interacting Gene/Enzyme : Glucose-6-phosphate 1-dehydrogenase
Gene Name : G6PD
UniProt ID : P11413
Defining Change(s) :

  • 375G->T, 379G->T383T->C384C>T

Allele Name : Crispim
Genotype(s) : Not Available
Type(s) : ADR Inferred
Groups : G6PD deficiency
Description : Increased risk of hemolytic anemia.
References :

  1. Welsh SJ, Corrie PG: Management of BRAF and MEK inhibitor toxicities in patients with metastatic melanoma. Ther Adv Med Oncol. 2015 Mar;7(2):122-36. doi: 10.1177/1758834014566428. [PubMed:25755684 ]
  2. Tafinlar® (dabrafenib) capsules[package insert]. East Hanover, New Jersey: Novartis Pharmaceuticals Corporation; 2016. [Link]

PMID: 19213928

Dabrafenib

By

Dabrafenib

Product: Ferulic acid (sodium)

Identifier : DBSNPE001171
Drug : DB08912 (Dabrafenib)
Interacting Gene/Enzyme : Glucose-6-phosphate 1-dehydrogenase
Gene Name : G6PD
UniProt ID : P11413
Defining Change(s) :

  • 376A->G
  • 463C->G

Allele Name : Acrokorinthos
Genotype(s) : Not Available
Type(s) : ADR Inferred
Groups : G6PD deficiency
Description : Increased risk of hemolytic anemia.
References :

  1. Welsh SJ, Corrie PG: Management of BRAF and MEK inhibitor toxicities in patients with metastatic melanoma. Ther Adv Med Oncol. 2015 Mar;7(2):122-36. doi: 10.1177/1758834014566428. [PubMed:25755684 ]
  2. Tafinlar® (dabrafenib) capsules[package insert]. East Hanover, New Jersey: Novartis Pharmaceuticals Corporation; 2016. [Link]

PMID: 19447274

Dabrafenib

By

Dabrafenib

Product: Lasofoxifene (Tartrate)

Identifier : DBSNPE001173
Drug : DB08912 (Dabrafenib)
Interacting Gene/Enzyme : Glucose-6-phosphate 1-dehydrogenase
Gene Name : G6PD
UniProt ID : P11413
Defining Change(s) :

  • 376A->G
  • 871G->A

Allele Name : Ananindeua
Genotype(s) : Not Available
Type(s) : ADR Inferred
Groups : G6PD deficiency
Description : Increased risk of hemolytic anemia.
References :

  1. Welsh SJ, Corrie PG: Management of BRAF and MEK inhibitor toxicities in patients with metastatic melanoma. Ther Adv Med Oncol. 2015 Mar;7(2):122-36. doi: 10.1177/1758834014566428. [PubMed:25755684 ]
  2. Tafinlar® (dabrafenib) capsules[package insert]. East Hanover, New Jersey: Novartis Pharmaceuticals Corporation; 2016. [Link]

PMID: 7582468

Dabrafenib

By

Dabrafenib

Product: Lorediplon

Identifier : DBSNPE001174
Drug : DB08912 (Dabrafenib)
Interacting Gene/Enzyme : Glucose-6-phosphate 1-dehydrogenase
Gene Name : G6PD
UniProt ID : P11413
Defining Change(s) :

  • 383T->C

Allele Name : Vanua Lava
Genotype(s) : Not Available
Type(s) : ADR Inferred
Groups : G6PD deficiency
Description : Increased risk of hemolytic anemia.
References :

  1. Welsh SJ, Corrie PG: Management of BRAF and MEK inhibitor toxicities in patients with metastatic melanoma. Ther Adv Med Oncol. 2015 Mar;7(2):122-36. doi: 10.1177/1758834014566428. [PubMed:25755684 ]
  2. Tafinlar® (dabrafenib) capsules[package insert]. East Hanover, New Jersey: Novartis Pharmaceuticals Corporation; 2016. [Link]

PMID: 5752907

Dabrafenib

By

Dabrafenib

Product: FPS-ZM1

Identifier : DBSNPE001175
Drug : DB08912 (Dabrafenib)
Interacting Gene/Enzyme : Glucose-6-phosphate 1-dehydrogenase
Gene Name : G6PD
UniProt ID : P11413
Defining Change(s) :

  • 406C->T

Allele Name : Valladolid
Genotype(s) : Not Available
Type(s) : ADR Inferred
Groups : G6PD deficiency
Description : Increased risk of hemolytic anemia.
References :

  1. Welsh SJ, Corrie PG: Management of BRAF and MEK inhibitor toxicities in patients with metastatic melanoma. Ther Adv Med Oncol. 2015 Mar;7(2):122-36. doi: 10.1177/1758834014566428. [PubMed:25755684 ]
  2. Tafinlar® (dabrafenib) capsules[package insert]. East Hanover, New Jersey: Novartis Pharmaceuticals Corporation; 2016. [Link]

PMID: 27212040

Dabrafenib

By

Dabrafenib

Product: UNC0642

Identifier : DBSNPE001176
Drug : DB08912 (Dabrafenib)
Interacting Gene/Enzyme : Glucose-6-phosphate 1-dehydrogenase
Gene Name : G6PD
UniProt ID : P11413
Defining Change(s) :

  • 409C->T

Allele Name : Belem
Genotype(s) : Not Available
Type(s) : ADR Inferred
Groups : G6PD deficiency
Description : Increased risk of hemolytic anemia.
References :

  1. Welsh SJ, Corrie PG: Management of BRAF and MEK inhibitor toxicities in patients with metastatic melanoma. Ther Adv Med Oncol. 2015 Mar;7(2):122-36. doi: 10.1177/1758834014566428. [PubMed:25755684 ]
  2. Tafinlar® (dabrafenib) capsules[package insert]. East Hanover, New Jersey: Novartis Pharmaceuticals Corporation; 2016. [Link]

PMID: 27725215

Dabrafenib

By

Dabrafenib

Product: A-674563 (hydrochloride)

Identifier : DBSNPE001177
Drug : DB08912 (Dabrafenib)
Interacting Gene/Enzyme : Glucose-6-phosphate 1-dehydrogenase
Gene Name : G6PD
UniProt ID : P11413
Defining Change(s) :

  • 442G->A

Allele Name : Liuzhou
Genotype(s) : Not Available
Type(s) : ADR Inferred
Groups : G6PD deficiency
Description : Increased risk of hemolytic anemia.
References :

  1. Welsh SJ, Corrie PG: Management of BRAF and MEK inhibitor toxicities in patients with metastatic melanoma. Ther Adv Med Oncol. 2015 Mar;7(2):122-36. doi: 10.1177/1758834014566428. [PubMed:25755684 ]
  2. Tafinlar® (dabrafenib) capsules[package insert]. East Hanover, New Jersey: Novartis Pharmaceuticals Corporation; 2016. [Link]

PMID: 25748028

Dabrafenib

By

Dabrafenib

Product: AMG319

Identifier : DBSNPE001178
Drug : DB08912 (Dabrafenib)
Interacting Gene/Enzyme : Glucose-6-phosphate 1-dehydrogenase
Gene Name : G6PD
UniProt ID : P11413
Defining Change(s) :

  • 473G>A

Allele Name : Shenzen
Genotype(s) : Not Available
Type(s) : ADR Inferred
Groups : G6PD deficiency
Description : Increased risk of hemolytic anemia.
References :

  1. Welsh SJ, Corrie PG: Management of BRAF and MEK inhibitor toxicities in patients with metastatic melanoma. Ther Adv Med Oncol. 2015 Mar;7(2):122-36. doi: 10.1177/1758834014566428. [PubMed:25755684 ]
  2. Tafinlar® (dabrafenib) capsules[package insert]. East Hanover, New Jersey: Novartis Pharmaceuticals Corporation; 2016. [Link]

PMID: 26451259

Dabrafenib

By

Dabrafenib

Product: Cycloguanil (D6 Nitrate)

Identifier : DBSNPE001189
Drug : DB08912 (Dabrafenib)
Interacting Gene/Enzyme : Glucose-6-phosphate 1-dehydrogenase
Gene Name : G6PD
UniProt ID : P11413
Defining Change(s) :

  • 835A->G

Allele Name : Haikou
Genotype(s) : Not Available
Type(s) : ADR Inferred
Groups : G6PD deficiency
Description : Increased risk of hemolytic anemia.
References :

  1. Welsh SJ, Corrie PG: Management of BRAF and MEK inhibitor toxicities in patients with metastatic melanoma. Ther Adv Med Oncol. 2015 Mar;7(2):122-36. doi: 10.1177/1758834014566428. [PubMed:25755684 ]
  2. Tafinlar® (dabrafenib) capsules[package insert]. East Hanover, New Jersey: Novartis Pharmaceuticals Corporation; 2016. [Link]

PMID: 20206233

Dabrafenib

By

Dabrafenib

Product: Ro 5126766

Identifier : DBSNPE001190
Drug : DB08912 (Dabrafenib)
Interacting Gene/Enzyme : Glucose-6-phosphate 1-dehydrogenase
Gene Name : G6PD
UniProt ID : P11413
Defining Change(s) :

  • 835A->T

Allele Name : Chinese-1
Genotype(s) : Not Available
Type(s) : ADR Inferred
Groups : G6PD deficiency
Description : Increased risk of hemolytic anemia.
References :

  1. Welsh SJ, Corrie PG: Management of BRAF and MEK inhibitor toxicities in patients with metastatic melanoma. Ther Adv Med Oncol. 2015 Mar;7(2):122-36. doi: 10.1177/1758834014566428. [PubMed:25755684 ]
  2. Tafinlar® (dabrafenib) capsules[package insert]. East Hanover, New Jersey: Novartis Pharmaceuticals Corporation; 2016. [Link]

PMID: 19144967

Dabrafenib

By

Dabrafenib

Product: GSK4112

Identifier : DBSNPE001191
Drug : DB08912 (Dabrafenib)
Interacting Gene/Enzyme : Glucose-6-phosphate 1-dehydrogenase
Gene Name : G6PD
UniProt ID : P11413
Defining Change(s) :

  • 848A>G

Allele Name : Mizushima
Genotype(s) : Not Available
Type(s) : ADR Inferred
Groups : G6PD deficiency
Description : Increased risk of hemolytic anemia.
References :

  1. Welsh SJ, Corrie PG: Management of BRAF and MEK inhibitor toxicities in patients with metastatic melanoma. Ther Adv Med Oncol. 2015 Mar;7(2):122-36. doi: 10.1177/1758834014566428. [PubMed:25755684 ]
  2. Tafinlar® (dabrafenib) capsules[package insert]. East Hanover, New Jersey: Novartis Pharmaceuticals Corporation; 2016. [Link]

PMID: 19422393

Dabrafenib

By

Dabrafenib

Product: 1-Methyl-7-nitroisatoic anhydride

Identifier : DBSNPE001192
Drug : DB08912 (Dabrafenib)
Interacting Gene/Enzyme : Glucose-6-phosphate 1-dehydrogenase
Gene Name : G6PD
UniProt ID : P11413
Defining Change(s) :

  • 853C->T

Allele Name : Osaka
Genotype(s) : Not Available
Type(s) : ADR Inferred
Groups : G6PD deficiency
Description : Increased risk of hemolytic anemia.
References :

  1. Welsh SJ, Corrie PG: Management of BRAF and MEK inhibitor toxicities in patients with metastatic melanoma. Ther Adv Med Oncol. 2015 Mar;7(2):122-36. doi: 10.1177/1758834014566428. [PubMed:25755684 ]
  2. Tafinlar® (dabrafenib) capsules[package insert]. East Hanover, New Jersey: Novartis Pharmaceuticals Corporation; 2016. [Link]

PMID: 18417693

Dabrafenib

By

Dabrafenib

Product: LMK-235

Identifier : DBSNPE001193
Drug : DB08912 (Dabrafenib)
Interacting Gene/Enzyme : Glucose-6-phosphate 1-dehydrogenase
Gene Name : G6PD
UniProt ID : P11413
Defining Change(s) :

  • 871G->A

Allele Name : Viangchan, Jammu
Genotype(s) : Not Available
Type(s) : ADR Inferred
Groups : G6PD deficiency
Description : Increased risk of hemolytic anemia.
References :

  1. Welsh SJ, Corrie PG: Management of BRAF and MEK inhibitor toxicities in patients with metastatic melanoma. Ther Adv Med Oncol. 2015 Mar;7(2):122-36. doi: 10.1177/1758834014566428. [PubMed:25755684 ]
  2. Tafinlar® (dabrafenib) capsules[package insert]. East Hanover, New Jersey: Novartis Pharmaceuticals Corporation; 2016. [Link]

PMID: 17596413

Dabrafenib

By

Dabrafenib

Product: Vps34-IN-1

Identifier : DBSNPE001194
Drug : DB08912 (Dabrafenib)
Interacting Gene/Enzyme : Glucose-6-phosphate 1-dehydrogenase
Gene Name : G6PD
UniProt ID : P11413
Defining Change(s) :

  • 916G->A

Allele Name : Seoul
Genotype(s) : Not Available
Type(s) : ADR Inferred
Groups : G6PD deficiency
Description : Increased risk of hemolytic anemia.
References :

  1. Welsh SJ, Corrie PG: Management of BRAF and MEK inhibitor toxicities in patients with metastatic melanoma. Ther Adv Med Oncol. 2015 Mar;7(2):122-36. doi: 10.1177/1758834014566428. [PubMed:25755684 ]
  2. Tafinlar® (dabrafenib) capsules[package insert]. East Hanover, New Jersey: Novartis Pharmaceuticals Corporation; 2016. [Link]

PMID: 15210585

Dabrafenib

By

Dabrafenib

Product: CO-1686 (hydrobromide)

Identifier : DBSNPE001195
Drug : DB08912 (Dabrafenib)
Interacting Gene/Enzyme : Glucose-6-phosphate 1-dehydrogenase
Gene Name : G6PD
UniProt ID : P11413
Defining Change(s) :

  • 929G->A

Allele Name : Ludhiana
Genotype(s) : Not Available
Type(s) : ADR Inferred
Groups : G6PD deficiency
Description : Increased risk of hemolytic anemia.
References :

  1. Welsh SJ, Corrie PG: Management of BRAF and MEK inhibitor toxicities in patients with metastatic melanoma. Ther Adv Med Oncol. 2015 Mar;7(2):122-36. doi: 10.1177/1758834014566428. [PubMed:25755684 ]
  2. Tafinlar® (dabrafenib) capsules[package insert]. East Hanover, New Jersey: Novartis Pharmaceuticals Corporation; 2016. [Link]

PMID: 8799569

Dabrafenib

By

Dabrafenib

Product: Rocaglamide

Identifier : DBSNPE001196
Drug : DB08912 (Dabrafenib)
Interacting Gene/Enzyme : Glucose-6-phosphate 1-dehydrogenase
Gene Name : G6PD
UniProt ID : P11413
Defining Change(s) :

  • 977C->A

Allele Name : Farroupilha
Genotype(s) : Not Available
Type(s) : ADR Inferred
Groups : G6PD deficiency
Description : Increased risk of hemolytic anemia.
References :

  1. Welsh SJ, Corrie PG: Management of BRAF and MEK inhibitor toxicities in patients with metastatic melanoma. Ther Adv Med Oncol. 2015 Mar;7(2):122-36. doi: 10.1177/1758834014566428. [PubMed:25755684 ]
  2. Tafinlar® (dabrafenib) capsules[package insert]. East Hanover, New Jersey: Novartis Pharmaceuticals Corporation; 2016. [Link]

PMID: 7650684

Dabrafenib

By

Dabrafenib

Product: Mavoglurant

Identifier : DBSNPE001197
Drug : DB08912 (Dabrafenib)
Interacting Gene/Enzyme : Glucose-6-phosphate 1-dehydrogenase
Gene Name : G6PD
UniProt ID : P11413
Defining Change(s) :

  • 1024C->T

Allele Name : Chinese-5
Genotype(s) : Not Available
Type(s) : ADR Inferred
Groups : G6PD deficiency
Description : Increased risk of hemolytic anemia.
References :

  1. Welsh SJ, Corrie PG: Management of BRAF and MEK inhibitor toxicities in patients with metastatic melanoma. Ther Adv Med Oncol. 2015 Mar;7(2):122-36. doi: 10.1177/1758834014566428. [PubMed:25755684 ]
  2. Tafinlar® (dabrafenib) capsules[package insert]. East Hanover, New Jersey: Novartis Pharmaceuticals Corporation; 2016. [Link]

PMID: 1964824

Dabrafenib

By

Dabrafenib

Product: TGR-1202 (hydrochloride)

Identifier : DBSNPE001198
Drug : DB08912 (Dabrafenib)
Interacting Gene/Enzyme : Glucose-6-phosphate 1-dehydrogenase
Gene Name : G6PD
UniProt ID : P11413
Defining Change(s) :

  • 130G>A

Allele Name : Rignano
Genotype(s) : Not Available
Type(s) : ADR Inferred
Groups : G6PD deficiency
Description : Increased risk of hemolytic anemia.
References :

  1. Welsh SJ, Corrie PG: Management of BRAF and MEK inhibitor toxicities in patients with metastatic melanoma. Ther Adv Med Oncol. 2015 Mar;7(2):122-36. doi: 10.1177/1758834014566428. [PubMed:25755684 ]
  2. Tafinlar® (dabrafenib) capsules[package insert]. East Hanover, New Jersey: Novartis Pharmaceuticals Corporation; 2016. [Link]

PMID: 19625621

Dabrafenib

By

Dabrafenib

Product: TGR-1202

Identifier : DBSNPE001199
Drug : DB08912 (Dabrafenib)
Interacting Gene/Enzyme : Glucose-6-phosphate 1-dehydrogenase
Gene Name : G6PD
UniProt ID : P11413
Defining Change(s) :

  • 131C->G

Allele Name : Orissa
Genotype(s) : Not Available
Type(s) : ADR Inferred
Groups : G6PD deficiency
Description : Increased risk of hemolytic anemia.
References :

  1. Welsh SJ, Corrie PG: Management of BRAF and MEK inhibitor toxicities in patients with metastatic melanoma. Ther Adv Med Oncol. 2015 Mar;7(2):122-36. doi: 10.1177/1758834014566428. [PubMed:25755684 ]
  2. Tafinlar® (dabrafenib) capsules[package insert]. East Hanover, New Jersey: Novartis Pharmaceuticals Corporation; 2016. [Link]

PMID: 18826595

Dabrafenib

By

Dabrafenib

Product: PRE-084 (hydrochloride)

Identifier : DBSNPE001200
Drug : DB08912 (Dabrafenib)
Interacting Gene/Enzyme : Glucose-6-phosphate 1-dehydrogenase
Gene Name : G6PD
UniProt ID : P11413
Defining Change(s) :

  • 1380G>C

Allele Name : G6PDNice
Genotype(s) : Not Available
Type(s) : ADR Inferred
Groups : G6PD deficiency
Description : Increased risk of hemolytic anemia.
References :

  1. Welsh SJ, Corrie PG: Management of BRAF and MEK inhibitor toxicities in patients with metastatic melanoma. Ther Adv Med Oncol. 2015 Mar;7(2):122-36. doi: 10.1177/1758834014566428. [PubMed:25755684 ]
  2. Tafinlar® (dabrafenib) capsules[package insert]. East Hanover, New Jersey: Novartis Pharmaceuticals Corporation; 2016. [Link]

PMID: 18667158

Dabrafenib

By

Dabrafenib

Product: Deferiprone

Identifier : DBSNPE001201
Drug : DB08912 (Dabrafenib)
Interacting Gene/Enzyme : Glucose-6-phosphate 1-dehydrogenase
Gene Name : G6PD
UniProt ID : P11413
Defining Change(s) :

  • 1387C->T

Allele Name : Kamiube, Keelung
Genotype(s) : Not Available
Type(s) : ADR Inferred
Groups : G6PD deficiency
Description : Increased risk of hemolytic anemia.
References :

  1. Welsh SJ, Corrie PG: Management of BRAF and MEK inhibitor toxicities in patients with metastatic melanoma. Ther Adv Med Oncol. 2015 Mar;7(2):122-36. doi: 10.1177/1758834014566428. [PubMed:25755684 ]
  2. Tafinlar® (dabrafenib) capsules[package insert]. East Hanover, New Jersey: Novartis Pharmaceuticals Corporation; 2016. [Link]

PMID: 11082110

Dabrafenib

By

Dabrafenib

Product: Rhein

Identifier : DBSNPE001202
Drug : DB08912 (Dabrafenib)
Interacting Gene/Enzyme : Glucose-6-phosphate 1-dehydrogenase
Gene Name : G6PD
UniProt ID : P11413
Defining Change(s) :

  • 1400C->G

Allele Name : Neapolis
Genotype(s) : Not Available
Type(s) : ADR Inferred
Groups : G6PD deficiency
Description : Increased risk of hemolytic anemia.
References :

  1. Welsh SJ, Corrie PG: Management of BRAF and MEK inhibitor toxicities in patients with metastatic melanoma. Ther Adv Med Oncol. 2015 Mar;7(2):122-36. doi: 10.1177/1758834014566428. [PubMed:25755684 ]
  2. Tafinlar® (dabrafenib) capsules[package insert]. East Hanover, New Jersey: Novartis Pharmaceuticals Corporation; 2016. [Link]

PMID: 15298075

Dabrafenib

By

Dabrafenib

Product: Vatalanib (free base)

Identifier : DBSNPE001203
Drug : DB08912 (Dabrafenib)
Interacting Gene/Enzyme : Glucose-6-phosphate 1-dehydrogenase
Gene Name : G6PD
UniProt ID : P11413
Defining Change(s) :

  • 143T->C

Allele Name : Aures
Genotype(s) : Not Available
Type(s) : ADR Inferred
Groups : G6PD deficiency
Description : Increased risk of hemolytic anemia.
References :

  1. Welsh SJ, Corrie PG: Management of BRAF and MEK inhibitor toxicities in patients with metastatic melanoma. Ther Adv Med Oncol. 2015 Mar;7(2):122-36. doi: 10.1177/1758834014566428. [PubMed:25755684 ]
  2. Tafinlar® (dabrafenib) capsules[package insert]. East Hanover, New Jersey: Novartis Pharmaceuticals Corporation; 2016. [Link]

PMID: 6304315

Dabrafenib

By

Dabrafenib

Product: PTACH

Identifier : DBSNPE001204
Drug : DB08912 (Dabrafenib)
Interacting Gene/Enzyme : Glucose-6-phosphate 1-dehydrogenase
Gene Name : G6PD
UniProt ID : P11413
Defining Change(s) :

  • 1442C->G

Allele Name : Split
Genotype(s) : Not Available
Type(s) : ADR Inferred
Groups : G6PD deficiency
Description : Increased risk of hemolytic anemia.
References :

  1. Welsh SJ, Corrie PG: Management of BRAF and MEK inhibitor toxicities in patients with metastatic melanoma. Ther Adv Med Oncol. 2015 Mar;7(2):122-36. doi: 10.1177/1758834014566428. [PubMed:25755684 ]
  2. Tafinlar® (dabrafenib) capsules[package insert]. East Hanover, New Jersey: Novartis Pharmaceuticals Corporation; 2016. [Link]

PMID: 25080596

Dabrafenib

By

Dabrafenib

Product: Yohimbine (Hydrochloride)

Identifier : DBSNPE001205
Drug : DB08912 (Dabrafenib)
Interacting Gene/Enzyme : Glucose-6-phosphate 1-dehydrogenase
Gene Name : G6PD
UniProt ID : P11413
Defining Change(s) :

  • 148C->T

Allele Name : Kambos
Genotype(s) : Not Available
Type(s) : ADR Inferred
Groups : G6PD deficiency
Description : Increased risk of hemolytic anemia.
References :

  1. Welsh SJ, Corrie PG: Management of BRAF and MEK inhibitor toxicities in patients with metastatic melanoma. Ther Adv Med Oncol. 2015 Mar;7(2):122-36. doi: 10.1177/1758834014566428. [PubMed:25755684 ]
  2. Tafinlar® (dabrafenib) capsules[package insert]. East Hanover, New Jersey: Novartis Pharmaceuticals Corporation; 2016. [Link]

PMID: 23870245

Dabrafenib

By

Dabrafenib

Product: Palmatine (chloride)

Identifier : DBSNPE001206
Drug : DB08912 (Dabrafenib)
Interacting Gene/Enzyme : Glucose-6-phosphate 1-dehydrogenase
Gene Name : G6PD
UniProt ID : P11413
Defining Change(s) :

  • 170G>A

Allele Name : Palesdivina
Genotype(s) : Not Available
Type(s) : ADR Inferred
Groups : G6PD deficiency
Description : Increased risk of hemolytic anemia.
References :

  1. Welsh SJ, Corrie PG: Management of BRAF and MEK inhibitor toxicities in patients with metastatic melanoma. Ther Adv Med Oncol. 2015 Mar;7(2):122-36. doi: 10.1177/1758834014566428. [PubMed:25755684 ]
  2. Tafinlar® (dabrafenib) capsules[package insert]. East Hanover, New Jersey: Novartis Pharmaceuticals Corporation; 2016. [Link]

PMID: 20574422

Dabrafenib

By

Dabrafenib

Product: Tiamulin (fumarate)

Identifier : DBSNPE001207
Drug : DB08912 (Dabrafenib)
Interacting Gene/Enzyme : Glucose-6-phosphate 1-dehydrogenase
Gene Name : G6PD
UniProt ID : P11413
Defining Change(s) :

  • 172G->A

Allele Name : Metaponto
Genotype(s) : Not Available
Type(s) : ADR Inferred
Groups : G6PD deficiency
Description : Increased risk of hemolytic anemia.
References :

  1. Welsh SJ, Corrie PG: Management of BRAF and MEK inhibitor toxicities in patients with metastatic melanoma. Ther Adv Med Oncol. 2015 Mar;7(2):122-36. doi: 10.1177/1758834014566428. [PubMed:25755684 ]
  2. Tafinlar® (dabrafenib) capsules[package insert]. East Hanover, New Jersey: Novartis Pharmaceuticals Corporation; 2016. [Link]

PMID: 19100735

Dabrafenib

By

Dabrafenib

Product: R112

Identifier : DBSNPE001208
Drug : DB08912 (Dabrafenib)
Interacting Gene/Enzyme : Glucose-6-phosphate 1-dehydrogenase
Gene Name : G6PD
UniProt ID : P11413
Defining Change(s) :

  • 185C->T

Allele Name : Musashino
Genotype(s) : Not Available
Type(s) : ADR Inferred
Groups : G6PD deficiency
Description : Increased risk of hemolytic anemia.
References :

  1. Welsh SJ, Corrie PG: Management of BRAF and MEK inhibitor toxicities in patients with metastatic melanoma. Ther Adv Med Oncol. 2015 Mar;7(2):122-36. doi: 10.1177/1758834014566428. [PubMed:25755684 ]
  2. Tafinlar® (dabrafenib) capsules[package insert]. East Hanover, New Jersey: Novartis Pharmaceuticals Corporation; 2016. [Link]

PMID: 9797041

Dabrafenib

By

Dabrafenib

Product: Dantrolene (sodium)

Identifier : DBSNPE001209
Drug : DB08912 (Dabrafenib)
Interacting Gene/Enzyme : Glucose-6-phosphate 1-dehydrogenase
Gene Name : G6PD
UniProt ID : P11413
Defining Change(s) :

  • 202G->A

Allele Name : Asahi
Genotype(s) : Not Available
Type(s) : ADR Inferred
Groups : G6PD deficiency
Description : Increased risk of hemolytic anemia.
References :

  1. Welsh SJ, Corrie PG: Management of BRAF and MEK inhibitor toxicities in patients with metastatic melanoma. Ther Adv Med Oncol. 2015 Mar;7(2):122-36. doi: 10.1177/1758834014566428. [PubMed:25755684 ]
  2. Tafinlar® (dabrafenib) capsules[package insert]. East Hanover, New Jersey: Novartis Pharmaceuticals Corporation; 2016. [Link]

PMID: 8863850

Dabrafenib

By

Dabrafenib

Product: AZD3264

Identifier : DBSNPE001210
Drug : DB08912 (Dabrafenib)
Interacting Gene/Enzyme : Glucose-6-phosphate 1-dehydrogenase
Gene Name : G6PD
UniProt ID : P11413
Defining Change(s) :

  • 202G->A
  • 376A->G

Allele Name : A- (202), Ferrara I
Genotype(s) : Not Available
Type(s) : ADR Inferred
Groups : G6PD deficiency
Description : Increased risk of hemolytic anemia.
References :

  1. Welsh SJ, Corrie PG: Management of BRAF and MEK inhibitor toxicities in patients with metastatic melanoma. Ther Adv Med Oncol. 2015 Mar;7(2):122-36. doi: 10.1177/1758834014566428. [PubMed:25755684 ]
  2. Tafinlar® (dabrafenib) capsules[package insert]. East Hanover, New Jersey: Novartis Pharmaceuticals Corporation; 2016. [Link]

PMID: 25297980

Dabrafenib

By

Dabrafenib

Product: AMG319

Identifier : DBSNPE001178
Drug : DB08912 (Dabrafenib)
Interacting Gene/Enzyme : Glucose-6-phosphate 1-dehydrogenase
Gene Name : G6PD
UniProt ID : P11413
Defining Change(s) :

  • 473G>A

Allele Name : Shenzen
Genotype(s) : Not Available
Type(s) : ADR Inferred
Groups : G6PD deficiency
Description : Increased risk of hemolytic anemia.
References :

  1. Welsh SJ, Corrie PG: Management of BRAF and MEK inhibitor toxicities in patients with metastatic melanoma. Ther Adv Med Oncol. 2015 Mar;7(2):122-36. doi: 10.1177/1758834014566428. [PubMed:25755684 ]
  2. Tafinlar® (dabrafenib) capsules[package insert]. East Hanover, New Jersey: Novartis Pharmaceuticals Corporation; 2016. [Link]

PMID: 26451259

Dabrafenib

By

Dabrafenib

Product: N-acetyl Dapsone (D4)

Identifier : DBSNPE001179
Drug : DB08912 (Dabrafenib)
Interacting Gene/Enzyme : Glucose-6-phosphate 1-dehydrogenase
Gene Name : G6PD
UniProt ID : P11413
Defining Change(s) :

  • 493A->G

Allele Name : Taipei “Chinese- 3”
Genotype(s) : Not Available
Type(s) : ADR Inferred
Groups : G6PD deficiency
Description : Increased risk of hemolytic anemia.
References :

  1. Welsh SJ, Corrie PG: Management of BRAF and MEK inhibitor toxicities in patients with metastatic melanoma. Ther Adv Med Oncol. 2015 Mar;7(2):122-36. doi: 10.1177/1758834014566428. [PubMed:25755684 ]
  2. Tafinlar® (dabrafenib) capsules[package insert]. East Hanover, New Jersey: Novartis Pharmaceuticals Corporation; 2016. [Link]

PMID: 25870544

Dabrafenib

By

Dabrafenib

Product: Quizalofop-p-ethyl

Identifier : DBSNPE001180
Drug : DB08912 (Dabrafenib)
Interacting Gene/Enzyme : Glucose-6-phosphate 1-dehydrogenase
Gene Name : G6PD
UniProt ID : P11413
Defining Change(s) :

  • 496C>T

Allele Name : Toledo
Genotype(s) : Not Available
Type(s) : ADR Inferred
Groups : G6PD deficiency
Description : Increased risk of hemolytic anemia.
References :

  1. Welsh SJ, Corrie PG: Management of BRAF and MEK inhibitor toxicities in patients with metastatic melanoma. Ther Adv Med Oncol. 2015 Mar;7(2):122-36. doi: 10.1177/1758834014566428. [PubMed:25755684 ]
  2. Tafinlar® (dabrafenib) capsules[package insert]. East Hanover, New Jersey: Novartis Pharmaceuticals Corporation; 2016. [Link]

PMID: 25855177

Dabrafenib

By

Dabrafenib

Product: Simetryn

Identifier : DBSNPE001181
Drug : DB08912 (Dabrafenib)
Interacting Gene/Enzyme : Glucose-6-phosphate 1-dehydrogenase
Gene Name : G6PD
UniProt ID : P11413
Defining Change(s) :

  • 497G->A

Allele Name : Naone
Genotype(s) : Not Available
Type(s) : ADR Inferred
Groups : G6PD deficiency
Description : Increased risk of hemolytic anemia.
References :

  1. Welsh SJ, Corrie PG: Management of BRAF and MEK inhibitor toxicities in patients with metastatic melanoma. Ther Adv Med Oncol. 2015 Mar;7(2):122-36. doi: 10.1177/1758834014566428. [PubMed:25755684 ]
  2. Tafinlar® (dabrafenib) capsules[package insert]. East Hanover, New Jersey: Novartis Pharmaceuticals Corporation; 2016. [Link]

PMID: 26019342

Dabrafenib

By

Dabrafenib

Product: Prochlorperazine (D8 dimeleate)

Identifier : DBSNPE001182
Drug : DB08912 (Dabrafenib)
Interacting Gene/Enzyme : Glucose-6-phosphate 1-dehydrogenase
Gene Name : G6PD
UniProt ID : P11413
Defining Change(s) :

  • 517T->C

Allele Name : Nankang
Genotype(s) : Not Available
Type(s) : ADR Inferred
Groups : G6PD deficiency
Description : Increased risk of hemolytic anemia.
References :

  1. Welsh SJ, Corrie PG: Management of BRAF and MEK inhibitor toxicities in patients with metastatic melanoma. Ther Adv Med Oncol. 2015 Mar;7(2):122-36. doi: 10.1177/1758834014566428. [PubMed:25755684 ]
  2. Tafinlar® (dabrafenib) capsules[package insert]. East Hanover, New Jersey: Novartis Pharmaceuticals Corporation; 2016. [Link]

PMID: 25755278

Dabrafenib

By

Dabrafenib

Product: TP-10

Identifier : DBSNPE001183
Drug : DB08912 (Dabrafenib)
Interacting Gene/Enzyme : Glucose-6-phosphate 1-dehydrogenase
Gene Name : G6PD
UniProt ID : P11413
Defining Change(s) :

  • 519C->G

Allele Name : Miaoli
Genotype(s) : Not Available
Type(s) : ADR Inferred
Groups : G6PD deficiency
Description : Increased risk of hemolytic anemia.
References :

  1. Welsh SJ, Corrie PG: Management of BRAF and MEK inhibitor toxicities in patients with metastatic melanoma. Ther Adv Med Oncol. 2015 Mar;7(2):122-36. doi: 10.1177/1758834014566428. [PubMed:25755684 ]
  2. Tafinlar® (dabrafenib) capsules[package insert]. East Hanover, New Jersey: Novartis Pharmaceuticals Corporation; 2016. [Link]

PMID: 24316475

Dabrafenib

By

Dabrafenib

Product: Enalaprilat D5

Identifier : DBSNPE001184
Drug : DB08912 (Dabrafenib)
Interacting Gene/Enzyme : Glucose-6-phosphate 1-dehydrogenase
Gene Name : G6PD
UniProt ID : P11413
Defining Change(s) :

  • 563C->T

Allele Name : Mediterranean, Dallas, Panama‚ Sassari, Cagliari, Birmingham
Genotype(s) : Not Available
Type(s) : ADR Inferred
Groups : G6PD deficiency
Description : Increased risk of hemolytic anemia.
References :

  1. Welsh SJ, Corrie PG: Management of BRAF and MEK inhibitor toxicities in patients with metastatic melanoma. Ther Adv Med Oncol. 2015 Mar;7(2):122-36. doi: 10.1177/1758834014566428. [PubMed:25755684 ]
  2. Tafinlar® (dabrafenib) capsules[package insert]. East Hanover, New Jersey: Novartis Pharmaceuticals Corporation; 2016. [Link]

PMID: 23567109

Dabrafenib

By

Dabrafenib

Product: (±)-Methotrimeprazine (D6)

Identifier : DBSNPE001185
Drug : DB08912 (Dabrafenib)
Interacting Gene/Enzyme : Glucose-6-phosphate 1-dehydrogenase
Gene Name : G6PD
UniProt ID : P11413
Defining Change(s) :

  • 592C->T

Allele Name : Coimbra Shunde
Genotype(s) : Not Available
Type(s) : ADR Inferred
Groups : G6PD deficiency
Description : Increased risk of hemolytic anemia.
References :

  1. Welsh SJ, Corrie PG: Management of BRAF and MEK inhibitor toxicities in patients with metastatic melanoma. Ther Adv Med Oncol. 2015 Mar;7(2):122-36. doi: 10.1177/1758834014566428. [PubMed:25755684 ]
  2. Tafinlar® (dabrafenib) capsules[package insert]. East Hanover, New Jersey: Novartis Pharmaceuticals Corporation; 2016. [Link]

PMID: 24303159

Dabrafenib

By

Dabrafenib

Product: L-685458

Identifier : DBSNPE001186
Drug : DB08912 (Dabrafenib)
Interacting Gene/Enzyme : Glucose-6-phosphate 1-dehydrogenase
Gene Name : G6PD
UniProt ID : P11413
Defining Change(s) :

  • 593G>A

Allele Name : Nilgiri
Genotype(s) : Not Available
Type(s) : ADR Inferred
Groups : G6PD deficiency
Description : Increased risk of hemolytic anemia.
References :

  1. Welsh SJ, Corrie PG: Management of BRAF and MEK inhibitor toxicities in patients with metastatic melanoma. Ther Adv Med Oncol. 2015 Mar;7(2):122-36. doi: 10.1177/1758834014566428. [PubMed:25755684 ]
  2. Tafinlar® (dabrafenib) capsules[package insert]. East Hanover, New Jersey: Novartis Pharmaceuticals Corporation; 2016. [Link]

PMID: 23850595

Dabrafenib

By

Dabrafenib

Product: DASA-58

Identifier : DBSNPE001187
Drug : DB08912 (Dabrafenib)
Interacting Gene/Enzyme : Glucose-6-phosphate 1-dehydrogenase
Gene Name : G6PD
UniProt ID : P11413
Defining Change(s) :

  • 679C->T

Allele Name : Radlowo
Genotype(s) : Not Available
Type(s) : ADR Inferred
Groups : G6PD deficiency
Description : Increased risk of hemolytic anemia.
References :

  1. Welsh SJ, Corrie PG: Management of BRAF and MEK inhibitor toxicities in patients with metastatic melanoma. Ther Adv Med Oncol. 2015 Mar;7(2):122-36. doi: 10.1177/1758834014566428. [PubMed:25755684 ]
  2. Tafinlar® (dabrafenib) capsules[package insert]. East Hanover, New Jersey: Novartis Pharmaceuticals Corporation; 2016. [Link]

PMID: 21931544

Dabrafenib

By

Dabrafenib

Product: Haloperidol (D4)

Identifier : DBSNPE001188
Drug : DB08912 (Dabrafenib)
Interacting Gene/Enzyme : Glucose-6-phosphate 1-dehydrogenase
Gene Name : G6PD
UniProt ID : P11413
Defining Change(s) :

  • 811G>C

Allele Name : Roubaix
Genotype(s) : Not Available
Type(s) : ADR Inferred
Groups : G6PD deficiency
Description : Increased risk of hemolytic anemia.
References :

  1. Welsh SJ, Corrie PG: Management of BRAF and MEK inhibitor toxicities in patients with metastatic melanoma. Ther Adv Med Oncol. 2015 Mar;7(2):122-36. doi: 10.1177/1758834014566428. [PubMed:25755684 ]
  2. Tafinlar® (dabrafenib) capsules[package insert]. East Hanover, New Jersey: Novartis Pharmaceuticals Corporation; 2016. [Link]

PMID: 21131947

Dabrafenib

By

Dabrafenib

Product: Cycloguanil (D6 Nitrate)

Identifier : DBSNPE001189
Drug : DB08912 (Dabrafenib)
Interacting Gene/Enzyme : Glucose-6-phosphate 1-dehydrogenase
Gene Name : G6PD
UniProt ID : P11413
Defining Change(s) :

  • 835A->G

Allele Name : Haikou
Genotype(s) : Not Available
Type(s) : ADR Inferred
Groups : G6PD deficiency
Description : Increased risk of hemolytic anemia.
References :

  1. Welsh SJ, Corrie PG: Management of BRAF and MEK inhibitor toxicities in patients with metastatic melanoma. Ther Adv Med Oncol. 2015 Mar;7(2):122-36. doi: 10.1177/1758834014566428. [PubMed:25755684 ]
  2. Tafinlar® (dabrafenib) capsules[package insert]. East Hanover, New Jersey: Novartis Pharmaceuticals Corporation; 2016. [Link]

PMID: 20206233

Dabrafenib

By

Dabrafenib

Product: Ro 5126766

Identifier : DBSNPE001190
Drug : DB08912 (Dabrafenib)
Interacting Gene/Enzyme : Glucose-6-phosphate 1-dehydrogenase
Gene Name : G6PD
UniProt ID : P11413
Defining Change(s) :

  • 835A->T

Allele Name : Chinese-1
Genotype(s) : Not Available
Type(s) : ADR Inferred
Groups : G6PD deficiency
Description : Increased risk of hemolytic anemia.
References :

  1. Welsh SJ, Corrie PG: Management of BRAF and MEK inhibitor toxicities in patients with metastatic melanoma. Ther Adv Med Oncol. 2015 Mar;7(2):122-36. doi: 10.1177/1758834014566428. [PubMed:25755684 ]
  2. Tafinlar® (dabrafenib) capsules[package insert]. East Hanover, New Jersey: Novartis Pharmaceuticals Corporation; 2016. [Link]

PMID: 19144967

Dabrafenib

By

Dabrafenib

Product: GSK4112

Identifier : DBSNPE001191
Drug : DB08912 (Dabrafenib)
Interacting Gene/Enzyme : Glucose-6-phosphate 1-dehydrogenase
Gene Name : G6PD
UniProt ID : P11413
Defining Change(s) :

  • 848A>G

Allele Name : Mizushima
Genotype(s) : Not Available
Type(s) : ADR Inferred
Groups : G6PD deficiency
Description : Increased risk of hemolytic anemia.
References :

  1. Welsh SJ, Corrie PG: Management of BRAF and MEK inhibitor toxicities in patients with metastatic melanoma. Ther Adv Med Oncol. 2015 Mar;7(2):122-36. doi: 10.1177/1758834014566428. [PubMed:25755684 ]
  2. Tafinlar® (dabrafenib) capsules[package insert]. East Hanover, New Jersey: Novartis Pharmaceuticals Corporation; 2016. [Link]

PMID: 19422393

Dabrafenib

By

Dabrafenib

Product: 1-Methyl-7-nitroisatoic anhydride

Identifier : DBSNPE001192
Drug : DB08912 (Dabrafenib)
Interacting Gene/Enzyme : Glucose-6-phosphate 1-dehydrogenase
Gene Name : G6PD
UniProt ID : P11413
Defining Change(s) :

  • 853C->T

Allele Name : Osaka
Genotype(s) : Not Available
Type(s) : ADR Inferred
Groups : G6PD deficiency
Description : Increased risk of hemolytic anemia.
References :

  1. Welsh SJ, Corrie PG: Management of BRAF and MEK inhibitor toxicities in patients with metastatic melanoma. Ther Adv Med Oncol. 2015 Mar;7(2):122-36. doi: 10.1177/1758834014566428. [PubMed:25755684 ]
  2. Tafinlar® (dabrafenib) capsules[package insert]. East Hanover, New Jersey: Novartis Pharmaceuticals Corporation; 2016. [Link]

PMID: 18417693

Dabrafenib

By

Dabrafenib

Product: LMK-235

Identifier : DBSNPE001193
Drug : DB08912 (Dabrafenib)
Interacting Gene/Enzyme : Glucose-6-phosphate 1-dehydrogenase
Gene Name : G6PD
UniProt ID : P11413
Defining Change(s) :

  • 871G->A

Allele Name : Viangchan, Jammu
Genotype(s) : Not Available
Type(s) : ADR Inferred
Groups : G6PD deficiency
Description : Increased risk of hemolytic anemia.
References :

  1. Welsh SJ, Corrie PG: Management of BRAF and MEK inhibitor toxicities in patients with metastatic melanoma. Ther Adv Med Oncol. 2015 Mar;7(2):122-36. doi: 10.1177/1758834014566428. [PubMed:25755684 ]
  2. Tafinlar® (dabrafenib) capsules[package insert]. East Hanover, New Jersey: Novartis Pharmaceuticals Corporation; 2016. [Link]

PMID: 17596413

Dabrafenib

By

Dabrafenib

Product: Vps34-IN-1

Identifier : DBSNPE001194
Drug : DB08912 (Dabrafenib)
Interacting Gene/Enzyme : Glucose-6-phosphate 1-dehydrogenase
Gene Name : G6PD
UniProt ID : P11413
Defining Change(s) :

  • 916G->A

Allele Name : Seoul
Genotype(s) : Not Available
Type(s) : ADR Inferred
Groups : G6PD deficiency
Description : Increased risk of hemolytic anemia.
References :

  1. Welsh SJ, Corrie PG: Management of BRAF and MEK inhibitor toxicities in patients with metastatic melanoma. Ther Adv Med Oncol. 2015 Mar;7(2):122-36. doi: 10.1177/1758834014566428. [PubMed:25755684 ]
  2. Tafinlar® (dabrafenib) capsules[package insert]. East Hanover, New Jersey: Novartis Pharmaceuticals Corporation; 2016. [Link]

PMID: 15210585

Dabrafenib

By

Dabrafenib

Product: CO-1686 (hydrobromide)

Identifier : DBSNPE001195
Drug : DB08912 (Dabrafenib)
Interacting Gene/Enzyme : Glucose-6-phosphate 1-dehydrogenase
Gene Name : G6PD
UniProt ID : P11413
Defining Change(s) :

  • 929G->A

Allele Name : Ludhiana
Genotype(s) : Not Available
Type(s) : ADR Inferred
Groups : G6PD deficiency
Description : Increased risk of hemolytic anemia.
References :

  1. Welsh SJ, Corrie PG: Management of BRAF and MEK inhibitor toxicities in patients with metastatic melanoma. Ther Adv Med Oncol. 2015 Mar;7(2):122-36. doi: 10.1177/1758834014566428. [PubMed:25755684 ]
  2. Tafinlar® (dabrafenib) capsules[package insert]. East Hanover, New Jersey: Novartis Pharmaceuticals Corporation; 2016. [Link]

PMID: 8799569

Dabrafenib

By

Dabrafenib

Product: Rocaglamide

Identifier : DBSNPE001196
Drug : DB08912 (Dabrafenib)
Interacting Gene/Enzyme : Glucose-6-phosphate 1-dehydrogenase
Gene Name : G6PD
UniProt ID : P11413
Defining Change(s) :

  • 977C->A

Allele Name : Farroupilha
Genotype(s) : Not Available
Type(s) : ADR Inferred
Groups : G6PD deficiency
Description : Increased risk of hemolytic anemia.
References :

  1. Welsh SJ, Corrie PG: Management of BRAF and MEK inhibitor toxicities in patients with metastatic melanoma. Ther Adv Med Oncol. 2015 Mar;7(2):122-36. doi: 10.1177/1758834014566428. [PubMed:25755684 ]
  2. Tafinlar® (dabrafenib) capsules[package insert]. East Hanover, New Jersey: Novartis Pharmaceuticals Corporation; 2016. [Link]

PMID: 7650684

Dabrafenib

By

Dabrafenib

Product: Mavoglurant

Identifier : DBSNPE001197
Drug : DB08912 (Dabrafenib)
Interacting Gene/Enzyme : Glucose-6-phosphate 1-dehydrogenase
Gene Name : G6PD
UniProt ID : P11413
Defining Change(s) :

  • 1024C->T

Allele Name : Chinese-5
Genotype(s) : Not Available
Type(s) : ADR Inferred
Groups : G6PD deficiency
Description : Increased risk of hemolytic anemia.
References :

  1. Welsh SJ, Corrie PG: Management of BRAF and MEK inhibitor toxicities in patients with metastatic melanoma. Ther Adv Med Oncol. 2015 Mar;7(2):122-36. doi: 10.1177/1758834014566428. [PubMed:25755684 ]
  2. Tafinlar® (dabrafenib) capsules[package insert]. East Hanover, New Jersey: Novartis Pharmaceuticals Corporation; 2016. [Link]

PMID: 1964824

Dabrafenib

By

Dabrafenib

Product: TGR-1202 (hydrochloride)

Identifier : DBSNPE001198
Drug : DB08912 (Dabrafenib)
Interacting Gene/Enzyme : Glucose-6-phosphate 1-dehydrogenase
Gene Name : G6PD
UniProt ID : P11413
Defining Change(s) :

  • 130G>A

Allele Name : Rignano
Genotype(s) : Not Available
Type(s) : ADR Inferred
Groups : G6PD deficiency
Description : Increased risk of hemolytic anemia.
References :

  1. Welsh SJ, Corrie PG: Management of BRAF and MEK inhibitor toxicities in patients with metastatic melanoma. Ther Adv Med Oncol. 2015 Mar;7(2):122-36. doi: 10.1177/1758834014566428. [PubMed:25755684 ]
  2. Tafinlar® (dabrafenib) capsules[package insert]. East Hanover, New Jersey: Novartis Pharmaceuticals Corporation; 2016. [Link]

PMID: 19625621

Dabrafenib

By

Dabrafenib

Product: TGR-1202

Identifier : DBSNPE001199
Drug : DB08912 (Dabrafenib)
Interacting Gene/Enzyme : Glucose-6-phosphate 1-dehydrogenase
Gene Name : G6PD
UniProt ID : P11413
Defining Change(s) :

  • 131C->G

Allele Name : Orissa
Genotype(s) : Not Available
Type(s) : ADR Inferred
Groups : G6PD deficiency
Description : Increased risk of hemolytic anemia.
References :

  1. Welsh SJ, Corrie PG: Management of BRAF and MEK inhibitor toxicities in patients with metastatic melanoma. Ther Adv Med Oncol. 2015 Mar;7(2):122-36. doi: 10.1177/1758834014566428. [PubMed:25755684 ]
  2. Tafinlar® (dabrafenib) capsules[package insert]. East Hanover, New Jersey: Novartis Pharmaceuticals Corporation; 2016. [Link]

PMID: 18826595

Dabrafenib

By

Dabrafenib

Product: PRE-084 (hydrochloride)

Identifier : DBSNPE001200
Drug : DB08912 (Dabrafenib)
Interacting Gene/Enzyme : Glucose-6-phosphate 1-dehydrogenase
Gene Name : G6PD
UniProt ID : P11413
Defining Change(s) :

  • 1380G>C

Allele Name : G6PDNice
Genotype(s) : Not Available
Type(s) : ADR Inferred
Groups : G6PD deficiency
Description : Increased risk of hemolytic anemia.
References :

  1. Welsh SJ, Corrie PG: Management of BRAF and MEK inhibitor toxicities in patients with metastatic melanoma. Ther Adv Med Oncol. 2015 Mar;7(2):122-36. doi: 10.1177/1758834014566428. [PubMed:25755684 ]
  2. Tafinlar® (dabrafenib) capsules[package insert]. East Hanover, New Jersey: Novartis Pharmaceuticals Corporation; 2016. [Link]

PMID: 18667158

Dabrafenib

By

Dabrafenib

Product: Deferiprone

Identifier : DBSNPE001201
Drug : DB08912 (Dabrafenib)
Interacting Gene/Enzyme : Glucose-6-phosphate 1-dehydrogenase
Gene Name : G6PD
UniProt ID : P11413
Defining Change(s) :

  • 1387C->T

Allele Name : Kamiube, Keelung
Genotype(s) : Not Available
Type(s) : ADR Inferred
Groups : G6PD deficiency
Description : Increased risk of hemolytic anemia.
References :

  1. Welsh SJ, Corrie PG: Management of BRAF and MEK inhibitor toxicities in patients with metastatic melanoma. Ther Adv Med Oncol. 2015 Mar;7(2):122-36. doi: 10.1177/1758834014566428. [PubMed:25755684 ]
  2. Tafinlar® (dabrafenib) capsules[package insert]. East Hanover, New Jersey: Novartis Pharmaceuticals Corporation; 2016. [Link]

PMID: 11082110

Dabrafenib

By

Dabrafenib

Product: Rhein

Identifier : DBSNPE001202
Drug : DB08912 (Dabrafenib)
Interacting Gene/Enzyme : Glucose-6-phosphate 1-dehydrogenase
Gene Name : G6PD
UniProt ID : P11413
Defining Change(s) :

  • 1400C->G

Allele Name : Neapolis
Genotype(s) : Not Available
Type(s) : ADR Inferred
Groups : G6PD deficiency
Description : Increased risk of hemolytic anemia.
References :

  1. Welsh SJ, Corrie PG: Management of BRAF and MEK inhibitor toxicities in patients with metastatic melanoma. Ther Adv Med Oncol. 2015 Mar;7(2):122-36. doi: 10.1177/1758834014566428. [PubMed:25755684 ]
  2. Tafinlar® (dabrafenib) capsules[package insert]. East Hanover, New Jersey: Novartis Pharmaceuticals Corporation; 2016. [Link]

PMID: 15298075

Dabrafenib

By

Dabrafenib

Product: Vatalanib (free base)

Identifier : DBSNPE001203
Drug : DB08912 (Dabrafenib)
Interacting Gene/Enzyme : Glucose-6-phosphate 1-dehydrogenase
Gene Name : G6PD
UniProt ID : P11413
Defining Change(s) :

  • 143T->C

Allele Name : Aures
Genotype(s) : Not Available
Type(s) : ADR Inferred
Groups : G6PD deficiency
Description : Increased risk of hemolytic anemia.
References :

  1. Welsh SJ, Corrie PG: Management of BRAF and MEK inhibitor toxicities in patients with metastatic melanoma. Ther Adv Med Oncol. 2015 Mar;7(2):122-36. doi: 10.1177/1758834014566428. [PubMed:25755684 ]
  2. Tafinlar® (dabrafenib) capsules[package insert]. East Hanover, New Jersey: Novartis Pharmaceuticals Corporation; 2016. [Link]

PMID: 6304315

Dabrafenib

By

Dabrafenib

Product: PTACH

Identifier : DBSNPE001204
Drug : DB08912 (Dabrafenib)
Interacting Gene/Enzyme : Glucose-6-phosphate 1-dehydrogenase
Gene Name : G6PD
UniProt ID : P11413
Defining Change(s) :

  • 1442C->G

Allele Name : Split
Genotype(s) : Not Available
Type(s) : ADR Inferred
Groups : G6PD deficiency
Description : Increased risk of hemolytic anemia.
References :

  1. Welsh SJ, Corrie PG: Management of BRAF and MEK inhibitor toxicities in patients with metastatic melanoma. Ther Adv Med Oncol. 2015 Mar;7(2):122-36. doi: 10.1177/1758834014566428. [PubMed:25755684 ]
  2. Tafinlar® (dabrafenib) capsules[package insert]. East Hanover, New Jersey: Novartis Pharmaceuticals Corporation; 2016. [Link]

PMID: 25080596

Dabrafenib

By

Dabrafenib

Product: Yohimbine (Hydrochloride)

Identifier : DBSNPE001205
Drug : DB08912 (Dabrafenib)
Interacting Gene/Enzyme : Glucose-6-phosphate 1-dehydrogenase
Gene Name : G6PD
UniProt ID : P11413
Defining Change(s) :

  • 148C->T

Allele Name : Kambos
Genotype(s) : Not Available
Type(s) : ADR Inferred
Groups : G6PD deficiency
Description : Increased risk of hemolytic anemia.
References :

  1. Welsh SJ, Corrie PG: Management of BRAF and MEK inhibitor toxicities in patients with metastatic melanoma. Ther Adv Med Oncol. 2015 Mar;7(2):122-36. doi: 10.1177/1758834014566428. [PubMed:25755684 ]
  2. Tafinlar® (dabrafenib) capsules[package insert]. East Hanover, New Jersey: Novartis Pharmaceuticals Corporation; 2016. [Link]

PMID: 23870245

Dabrafenib

By

Dabrafenib

Product: Palmatine (chloride)

Identifier : DBSNPE001206
Drug : DB08912 (Dabrafenib)
Interacting Gene/Enzyme : Glucose-6-phosphate 1-dehydrogenase
Gene Name : G6PD
UniProt ID : P11413
Defining Change(s) :

  • 170G>A

Allele Name : Palesdivina
Genotype(s) : Not Available
Type(s) : ADR Inferred
Groups : G6PD deficiency
Description : Increased risk of hemolytic anemia.
References :

  1. Welsh SJ, Corrie PG: Management of BRAF and MEK inhibitor toxicities in patients with metastatic melanoma. Ther Adv Med Oncol. 2015 Mar;7(2):122-36. doi: 10.1177/1758834014566428. [PubMed:25755684 ]
  2. Tafinlar® (dabrafenib) capsules[package insert]. East Hanover, New Jersey: Novartis Pharmaceuticals Corporation; 2016. [Link]

PMID: 20574422

Dabrafenib

By

Dabrafenib

Product: Tiamulin (fumarate)

Identifier : DBSNPE001207
Drug : DB08912 (Dabrafenib)
Interacting Gene/Enzyme : Glucose-6-phosphate 1-dehydrogenase
Gene Name : G6PD
UniProt ID : P11413
Defining Change(s) :

  • 172G->A

Allele Name : Metaponto
Genotype(s) : Not Available
Type(s) : ADR Inferred
Groups : G6PD deficiency
Description : Increased risk of hemolytic anemia.
References :

  1. Welsh SJ, Corrie PG: Management of BRAF and MEK inhibitor toxicities in patients with metastatic melanoma. Ther Adv Med Oncol. 2015 Mar;7(2):122-36. doi: 10.1177/1758834014566428. [PubMed:25755684 ]
  2. Tafinlar® (dabrafenib) capsules[package insert]. East Hanover, New Jersey: Novartis Pharmaceuticals Corporation; 2016. [Link]

PMID: 19100735

Dabrafenib

By

Dabrafenib

Product: R112

Identifier : DBSNPE001208
Drug : DB08912 (Dabrafenib)
Interacting Gene/Enzyme : Glucose-6-phosphate 1-dehydrogenase
Gene Name : G6PD
UniProt ID : P11413
Defining Change(s) :

  • 185C->T

Allele Name : Musashino
Genotype(s) : Not Available
Type(s) : ADR Inferred
Groups : G6PD deficiency
Description : Increased risk of hemolytic anemia.
References :

  1. Welsh SJ, Corrie PG: Management of BRAF and MEK inhibitor toxicities in patients with metastatic melanoma. Ther Adv Med Oncol. 2015 Mar;7(2):122-36. doi: 10.1177/1758834014566428. [PubMed:25755684 ]
  2. Tafinlar® (dabrafenib) capsules[package insert]. East Hanover, New Jersey: Novartis Pharmaceuticals Corporation; 2016. [Link]

PMID: 9797041

Dabrafenib

By

Dabrafenib

Product: Dantrolene (sodium)

Identifier : DBSNPE001209
Drug : DB08912 (Dabrafenib)
Interacting Gene/Enzyme : Glucose-6-phosphate 1-dehydrogenase
Gene Name : G6PD
UniProt ID : P11413
Defining Change(s) :

  • 202G->A

Allele Name : Asahi
Genotype(s) : Not Available
Type(s) : ADR Inferred
Groups : G6PD deficiency
Description : Increased risk of hemolytic anemia.
References :

  1. Welsh SJ, Corrie PG: Management of BRAF and MEK inhibitor toxicities in patients with metastatic melanoma. Ther Adv Med Oncol. 2015 Mar;7(2):122-36. doi: 10.1177/1758834014566428. [PubMed:25755684 ]
  2. Tafinlar® (dabrafenib) capsules[package insert]. East Hanover, New Jersey: Novartis Pharmaceuticals Corporation; 2016. [Link]

PMID: 8863850

Dabrafenib

By

Dabrafenib

Product: AZD3264

Identifier : DBSNPE001210
Drug : DB08912 (Dabrafenib)
Interacting Gene/Enzyme : Glucose-6-phosphate 1-dehydrogenase
Gene Name : G6PD
UniProt ID : P11413
Defining Change(s) :

  • 202G->A
  • 376A->G

Allele Name : A- (202), Ferrara I
Genotype(s) : Not Available
Type(s) : ADR Inferred
Groups : G6PD deficiency
Description : Increased risk of hemolytic anemia.
References :

  1. Welsh SJ, Corrie PG: Management of BRAF and MEK inhibitor toxicities in patients with metastatic melanoma. Ther Adv Med Oncol. 2015 Mar;7(2):122-36. doi: 10.1177/1758834014566428. [PubMed:25755684 ]
  2. Tafinlar® (dabrafenib) capsules[package insert]. East Hanover, New Jersey: Novartis Pharmaceuticals Corporation; 2016. [Link]

PMID: 25297980

Dabrafenib

By

Dabrafenib

Product: MN-64

Identifier : DBSNPE001211
Drug : DB08912 (Dabrafenib)
Interacting Gene/Enzyme : Glucose-6-phosphate 1-dehydrogenase
Gene Name : G6PD
UniProt ID : P11413
Defining Change(s) :

  • 209A->G

Allele Name : Murcia Oristano
Genotype(s) : Not Available
Type(s) : ADR Inferred
Groups : G6PD deficiency
Description : Increased risk of hemolytic anemia.
References :

  1. Welsh SJ, Corrie PG: Management of BRAF and MEK inhibitor toxicities in patients with metastatic melanoma. Ther Adv Med Oncol. 2015 Mar;7(2):122-36. doi: 10.1177/1758834014566428. [PubMed:25755684 ]
  2. Tafinlar® (dabrafenib) capsules[package insert]. East Hanover, New Jersey: Novartis Pharmaceuticals Corporation; 2016. [Link]

PMID: 2851353

Dabrafenib

By

Dabrafenib

Product: BML-210

Identifier : DBSNPE001212
Drug : DB08912 (Dabrafenib)
Interacting Gene/Enzyme : Glucose-6-phosphate 1-dehydrogenase
Gene Name : G6PD
UniProt ID : P11413
Defining Change(s) :

  • 241C->T

Allele Name : Ube Konan
Genotype(s) : Not Available
Type(s) : ADR Inferred
Groups : G6PD deficiency
Description : Increased risk of hemolytic anemia.
References :

  1. Welsh SJ, Corrie PG: Management of BRAF and MEK inhibitor toxicities in patients with metastatic melanoma. Ther Adv Med Oncol. 2015 Mar;7(2):122-36. doi: 10.1177/1758834014566428. [PubMed:25755684 ]
  2. Tafinlar® (dabrafenib) capsules[package insert]. East Hanover, New Jersey: Novartis Pharmaceuticals Corporation; 2016. [Link]

PMID: 3015310

Dabrafenib

By

Dabrafenib

Product: Pimelic Diphenylamide 106

Identifier : DBSNPE001213
Drug : DB08912 (Dabrafenib)
Interacting Gene/Enzyme : Glucose-6-phosphate 1-dehydrogenase
Gene Name : G6PD
UniProt ID : P11413
Defining Change(s) :

  • 242G->A

Allele Name : Lagosanto
Genotype(s) : Not Available
Type(s) : ADR Inferred
Groups : G6PD deficiency
Description : Increased risk of hemolytic anemia.
References :

  1. Welsh SJ, Corrie PG: Management of BRAF and MEK inhibitor toxicities in patients with metastatic melanoma. Ther Adv Med Oncol. 2015 Mar;7(2):122-36. doi: 10.1177/1758834014566428. [PubMed:25755684 ]
  2. Tafinlar® (dabrafenib) capsules[package insert]. East Hanover, New Jersey: Novartis Pharmaceuticals Corporation; 2016. [Link]

PMID: 19535226

Dabrafenib

By

Dabrafenib

Product: WDR5-0103

Identifier : DBSNPE001214
Drug : DB08912 (Dabrafenib)
Interacting Gene/Enzyme : Glucose-6-phosphate 1-dehydrogenase
Gene Name : G6PD
UniProt ID : P11413
Defining Change(s) :

  • 274C->T

Allele Name : Guangzhou
Genotype(s) : Not Available
Type(s) : ADR Inferred
Groups : G6PD deficiency
Description : Increased risk of hemolytic anemia.
References :

  1. Welsh SJ, Corrie PG: Management of BRAF and MEK inhibitor toxicities in patients with metastatic melanoma. Ther Adv Med Oncol. 2015 Mar;7(2):122-36. doi: 10.1177/1758834014566428. [PubMed:25755684 ]
  2. Tafinlar® (dabrafenib) capsules[package insert]. East Hanover, New Jersey: Novartis Pharmaceuticals Corporation; 2016. [Link]

PMID: 448364

Dabrafenib

By

Dabrafenib

Product: UF010

Identifier : DBSNPE001215
Drug : DB08912 (Dabrafenib)
Interacting Gene/Enzyme : Glucose-6-phosphate 1-dehydrogenase
Gene Name : G6PD
UniProt ID : P11413
Defining Change(s) :

  • 323T->A

Allele Name : Hammersmith
Genotype(s) : Not Available
Type(s) : ADR Inferred
Groups : G6PD deficiency
Description : Increased risk of hemolytic anemia.
References :

  1. Welsh SJ, Corrie PG: Management of BRAF and MEK inhibitor toxicities in patients with metastatic melanoma. Ther Adv Med Oncol. 2015 Mar;7(2):122-36. doi: 10.1177/1758834014566428. [PubMed:25755684 ]
  2. Tafinlar® (dabrafenib) capsules[package insert]. East Hanover, New Jersey: Novartis Pharmaceuticals Corporation; 2016. [Link]

PMID: 19474325

Dabrafenib

By

Dabrafenib

Product: APTO-253

Identifier : DBSNPE001216
Drug : DB08912 (Dabrafenib)
Interacting Gene/Enzyme : Glucose-6-phosphate 1-dehydrogenase
Gene Name : G6PD
UniProt ID : P11413
Defining Change(s) :

  • 34G->T

Allele Name : Sinnai
Genotype(s) : Not Available
Type(s) : ADR Inferred
Groups : G6PD deficiency
Description : Increased risk of hemolytic anemia.
References :

  1. Welsh SJ, Corrie PG: Management of BRAF and MEK inhibitor toxicities in patients with metastatic melanoma. Ther Adv Med Oncol. 2015 Mar;7(2):122-36. doi: 10.1177/1758834014566428. [PubMed:25755684 ]
  2. Tafinlar® (dabrafenib) capsules[package insert]. East Hanover, New Jersey: Novartis Pharmaceuticals Corporation; 2016. [Link]

PMID: 18202657

Dabrafenib

By

Dabrafenib

Product: Talampanel

Identifier : DBSNPE001217
Drug : DB08912 (Dabrafenib)
Interacting Gene/Enzyme : Glucose-6-phosphate 1-dehydrogenase
Gene Name : G6PD
UniProt ID : P11413
Defining Change(s) :

  • 376A->G
  • 680G->T

Allele Name : A- (680)
Genotype(s) : Not Available
Type(s) : ADR Inferred
Groups : G6PD deficiency
Description : Increased risk of hemolytic anemia.
References :

  1. Welsh SJ, Corrie PG: Management of BRAF and MEK inhibitor toxicities in patients with metastatic melanoma. Ther Adv Med Oncol. 2015 Mar;7(2):122-36. doi: 10.1177/1758834014566428. [PubMed:25755684 ]
  2. Tafinlar® (dabrafenib) capsules[package insert]. East Hanover, New Jersey: Novartis Pharmaceuticals Corporation; 2016. [Link]

PMID: 16331290

Dabrafenib

By

Dabrafenib

Product: Dantrolene (sodium hemiheptahydrate)

Identifier : DBSNPE001218
Drug : DB08912 (Dabrafenib)
Interacting Gene/Enzyme : Glucose-6-phosphate 1-dehydrogenase
Gene Name : G6PD
UniProt ID : P11413
Defining Change(s) :

  • 376A->G
  • 968T->C

Allele Name : A- (968), Betica,Selma, Guantanamo
Genotype(s) : Not Available
Type(s) : ADR Inferred
Groups : G6PD deficiency
Description : Increased risk of hemolytic anemia.
References :

  1. Welsh SJ, Corrie PG: Management of BRAF and MEK inhibitor toxicities in patients with metastatic melanoma. Ther Adv Med Oncol. 2015 Mar;7(2):122-36. doi: 10.1177/1758834014566428. [PubMed:25755684 ]
  2. Tafinlar® (dabrafenib) capsules[package insert]. East Hanover, New Jersey: Novartis Pharmaceuticals Corporation; 2016. [Link]

PMID: 14680756

Dabrafenib

By

Dabrafenib

Product: Varlitinib

Identifier : DBSNPE001219
Drug : DB08912 (Dabrafenib)
Interacting Gene/Enzyme : Glucose-6-phosphate 1-dehydrogenase
Gene Name : G6PD
UniProt ID : P11413
Defining Change(s) :

  • 383T>G

Allele Name : Salerno Pyrgos
Genotype(s) : Not Available
Type(s) : ADR Inferred
Groups : G6PD deficiency
Description : Increased risk of hemolytic anemia.
References :

  1. Welsh SJ, Corrie PG: Management of BRAF and MEK inhibitor toxicities in patients with metastatic melanoma. Ther Adv Med Oncol. 2015 Mar;7(2):122-36. doi: 10.1177/1758834014566428. [PubMed:25755684 ]
  2. Tafinlar® (dabrafenib) capsules[package insert]. East Hanover, New Jersey: Novartis Pharmaceuticals Corporation; 2016. [Link]

PMID: 20147571

Dabrafenib

By

Dabrafenib

Product: Nav1.7-IN-2

Identifier : DBSNPE001220
Drug : DB08912 (Dabrafenib)
Interacting Gene/Enzyme : Glucose-6-phosphate 1-dehydrogenase
Gene Name : G6PD
UniProt ID : P11413
Defining Change(s) :

  • 392G->T

Allele Name : Quing Yan
Genotype(s) : Not Available
Type(s) : ADR Inferred
Groups : G6PD deficiency
Description : Increased risk of hemolytic anemia.
References :

  1. Welsh SJ, Corrie PG: Management of BRAF and MEK inhibitor toxicities in patients with metastatic melanoma. Ther Adv Med Oncol. 2015 Mar;7(2):122-36. doi: 10.1177/1758834014566428. [PubMed:25755684 ]
  2. Tafinlar® (dabrafenib) capsules[package insert]. East Hanover, New Jersey: Novartis Pharmaceuticals Corporation; 2016. [Link]

PMID: 18187530

Dabrafenib

By

Dabrafenib

Product: AB-MECA

Identifier : DBSNPE001221
Drug : DB08912 (Dabrafenib)
Interacting Gene/Enzyme : Glucose-6-phosphate 1-dehydrogenase
Gene Name : G6PD
UniProt ID : P11413
Defining Change(s) :

  • 40G->A

Allele Name : Lages
Genotype(s) : Not Available
Type(s) : ADR Inferred
Groups : G6PD deficiency
Description : Increased risk of hemolytic anemia.
References :

  1. Welsh SJ, Corrie PG: Management of BRAF and MEK inhibitor toxicities in patients with metastatic melanoma. Ther Adv Med Oncol. 2015 Mar;7(2):122-36. doi: 10.1177/1758834014566428. [PubMed:25755684 ]
  2. Tafinlar® (dabrafenib) capsules[package insert]. East Hanover, New Jersey: Novartis Pharmaceuticals Corporation; 2016. [Link]

PMID: 19704033

Dabrafenib

By

Dabrafenib

Product: Chlorthal-dimethyl

Identifier : DBSNPE001222
Drug : DB08912 (Dabrafenib)
Interacting Gene/Enzyme : Glucose-6-phosphate 1-dehydrogenase
Gene Name : G6PD
UniProt ID : P11413
Defining Change(s) :

  • 466G->A

Allele Name : Ilesha
Genotype(s) : Not Available
Type(s) : ADR Inferred
Groups : G6PD deficiency
Description : Increased risk of hemolytic anemia.
References :

  1. Welsh SJ, Corrie PG: Management of BRAF and MEK inhibitor toxicities in patients with metastatic melanoma. Ther Adv Med Oncol. 2015 Mar;7(2):122-36. doi: 10.1177/1758834014566428. [PubMed:25755684 ]
  2. Tafinlar® (dabrafenib) capsules[package insert]. East Hanover, New Jersey: Novartis Pharmaceuticals Corporation; 2016. [Link]

PMID: 15537339

Dabrafenib

By

Dabrafenib

Product: Pyriproxyfen

Identifier : DBSNPE001223
Drug : DB08912 (Dabrafenib)
Interacting Gene/Enzyme : Glucose-6-phosphate 1-dehydrogenase
Gene Name : G6PD
UniProt ID : P11413
Defining Change(s) :

  • 487G->A

Allele Name : Mahidol
Genotype(s) : Not Available
Type(s) : ADR Inferred
Groups : G6PD deficiency
Description : Increased risk of hemolytic anemia.
References :

  1. Welsh SJ, Corrie PG: Management of BRAF and MEK inhibitor toxicities in patients with metastatic melanoma. Ther Adv Med Oncol. 2015 Mar;7(2):122-36. doi: 10.1177/1758834014566428. [PubMed:25755684 ]
  2. Tafinlar® (dabrafenib) capsules[package insert]. East Hanover, New Jersey: Novartis Pharmaceuticals Corporation; 2016. [Link]

PMID: 19469479

Dabrafenib

By

Dabrafenib

Product: Propanil

Identifier : DBSNPE001224
Drug : DB08912 (Dabrafenib)
Interacting Gene/Enzyme : Glucose-6-phosphate 1-dehydrogenase
Gene Name : G6PD
UniProt ID : P11413
Defining Change(s) :

  • 542A->T

Allele Name : Malaga
Genotype(s) : Not Available
Type(s) : ADR Inferred
Groups : G6PD deficiency
Description : Increased risk of hemolytic anemia.
References :

  1. Welsh SJ, Corrie PG: Management of BRAF and MEK inhibitor toxicities in patients with metastatic melanoma. Ther Adv Med Oncol. 2015 Mar;7(2):122-36. doi: 10.1177/1758834014566428. [PubMed:25755684 ]
  2. Tafinlar® (dabrafenib) capsules[package insert]. East Hanover, New Jersey: Novartis Pharmaceuticals Corporation; 2016. [Link]

PMID: 11428922

Dabrafenib

By

Dabrafenib

Product: Phosalone

Identifier : DBSNPE001225
Drug : DB08912 (Dabrafenib)
Interacting Gene/Enzyme : Glucose-6-phosphate 1-dehydrogenase
Gene Name : G6PD
UniProt ID : P11413
Defining Change(s) :

  • 634A->G

Allele Name : Sibari
Genotype(s) : Not Available
Type(s) : ADR Inferred
Groups : G6PD deficiency
Description : Increased risk of hemolytic anemia.
References :

  1. Welsh SJ, Corrie PG: Management of BRAF and MEK inhibitor toxicities in patients with metastatic melanoma. Ther Adv Med Oncol. 2015 Mar;7(2):122-36. doi: 10.1177/1758834014566428. [PubMed:25755684 ]
  2. Tafinlar® (dabrafenib) capsules[package insert]. East Hanover, New Jersey: Novartis Pharmaceuticals Corporation; 2016. [Link]

PMID: 21190016

Dabrafenib

By

Dabrafenib

Product: Cloquintocet-mexyl

Identifier : DBSNPE001226
Drug : DB08912 (Dabrafenib)
Interacting Gene/Enzyme : Glucose-6-phosphate 1-dehydrogenase
Gene Name : G6PD
UniProt ID : P11413
Defining Change(s) :

  • 680G->A

Allele Name : Mexico City
Genotype(s) : Not Available
Type(s) : ADR Inferred
Groups : G6PD deficiency
Description : Increased risk of hemolytic anemia.
References :

  1. Welsh SJ, Corrie PG: Management of BRAF and MEK inhibitor toxicities in patients with metastatic melanoma. Ther Adv Med Oncol. 2015 Mar;7(2):122-36. doi: 10.1177/1758834014566428. [PubMed:25755684 ]
  2. Tafinlar® (dabrafenib) capsules[package insert]. East Hanover, New Jersey: Novartis Pharmaceuticals Corporation; 2016. [Link]

PMID: 16291941

Dabrafenib

By

Dabrafenib

Product: Thifluzamide

Identifier : DBSNPE001227
Drug : DB08912 (Dabrafenib)
Interacting Gene/Enzyme : Glucose-6-phosphate 1-dehydrogenase
Gene Name : G6PD
UniProt ID : P11413
Defining Change(s) :

  • 703C->T

Allele Name : Nanning
Genotype(s) : Not Available
Type(s) : ADR Inferred
Groups : G6PD deficiency
Description : Increased risk of hemolytic anemia.
References :

  1. Welsh SJ, Corrie PG: Management of BRAF and MEK inhibitor toxicities in patients with metastatic melanoma. Ther Adv Med Oncol. 2015 Mar;7(2):122-36. doi: 10.1177/1758834014566428. [PubMed:25755684 ]
  2. Tafinlar® (dabrafenib) capsules[package insert]. East Hanover, New Jersey: Novartis Pharmaceuticals Corporation; 2016. [Link]

PMID: 16567532

Dabrafenib

By

Dabrafenib

Product: Diniconazole

Identifier : DBSNPE001228
Drug : DB08912 (Dabrafenib)
Interacting Gene/Enzyme : Glucose-6-phosphate 1-dehydrogenase
Gene Name : G6PD
UniProt ID : P11413
Defining Change(s) :

  • 844G->C

Allele Name : Seattle, Lodi, Modena, Ferrara II, Athens-like
Genotype(s) : Not Available
Type(s) : ADR Inferred
Groups : G6PD deficiency
Description : Increased risk of hemolytic anemia.
References :

  1. Welsh SJ, Corrie PG: Management of BRAF and MEK inhibitor toxicities in patients with metastatic melanoma. Ther Adv Med Oncol. 2015 Mar;7(2):122-36. doi: 10.1177/1758834014566428. [PubMed:25755684 ]
  2. Tafinlar® (dabrafenib) capsules[package insert]. East Hanover, New Jersey: Novartis Pharmaceuticals Corporation; 2016. [Link]

PMID: 16442250

Dabrafenib

By

Dabrafenib

Product: Levodropropizine

Identifier : DBSNPE001229
Drug : DB08912 (Dabrafenib)
Interacting Gene/Enzyme : Glucose-6-phosphate 1-dehydrogenase
Gene Name : G6PD
UniProt ID : P11413
Defining Change(s) :

  • 844G->T

Allele Name : Bajo Maumere
Genotype(s) : Not Available
Type(s) : ADR Inferred
Groups : G6PD deficiency
Description : Increased risk of hemolytic anemia.
References :

  1. Welsh SJ, Corrie PG: Management of BRAF and MEK inhibitor toxicities in patients with metastatic melanoma. Ther Adv Med Oncol. 2015 Mar;7(2):122-36. doi: 10.1177/1758834014566428. [PubMed:25755684 ]
  2. Tafinlar® (dabrafenib) capsules[package insert]. East Hanover, New Jersey: Novartis Pharmaceuticals Corporation; 2016. [Link]

PMID: 10390643

Dabrafenib

By

Dabrafenib

Product: Oxadiazon

Identifier : DBSNPE001230
Drug : DB08912 (Dabrafenib)
Interacting Gene/Enzyme : Glucose-6-phosphate 1-dehydrogenase
Gene Name : G6PD
UniProt ID : P11413
Defining Change(s) :

  • 854G->A

Allele Name : Montalbano
Genotype(s) : Not Available
Type(s) : ADR Inferred
Groups : G6PD deficiency
Description : Increased risk of hemolytic anemia.
References :

  1. Welsh SJ, Corrie PG: Management of BRAF and MEK inhibitor toxicities in patients with metastatic melanoma. Ther Adv Med Oncol. 2015 Mar;7(2):122-36. doi: 10.1177/1758834014566428. [PubMed:25755684 ]
  2. Tafinlar® (dabrafenib) capsules[package insert]. East Hanover, New Jersey: Novartis Pharmaceuticals Corporation; 2016. [Link]

PMID: 1247886

Dabrafenib

By

Dabrafenib

Product: Metaldehyde

Identifier : DBSNPE001231
Drug : DB08912 (Dabrafenib)
Interacting Gene/Enzyme : Glucose-6-phosphate 1-dehydrogenase
Gene Name : G6PD
UniProt ID : P11413
Defining Change(s) :

  • 949G->A

Allele Name : Kalyan-Kerala, Jamnaga, Rohini
Genotype(s) : Not Available
Type(s) : ADR Inferred
Groups : G6PD deficiency
Description : Increased risk of hemolytic anemia.
References :

  1. Welsh SJ, Corrie PG: Management of BRAF and MEK inhibitor toxicities in patients with metastatic melanoma. Ther Adv Med Oncol. 2015 Mar;7(2):122-36. doi: 10.1177/1758834014566428. [PubMed:25755684 ]
  2. Tafinlar® (dabrafenib) capsules[package insert]. East Hanover, New Jersey: Novartis Pharmaceuticals Corporation; 2016. [Link]

PMID: 25822789

Dabrafenib

By

Dabrafenib

Product: Imazapic

Identifier : DBSNPE001232
Drug : DB08912 (Dabrafenib)
Interacting Gene/Enzyme : Glucose-6-phosphate 1-dehydrogenase
Gene Name : G6PD
UniProt ID : P11413
Defining Change(s) :

  • 95A->G

Allele Name : Gaohe
Genotype(s) : Not Available
Type(s) : ADR Inferred
Groups : G6PD deficiency
Description : Increased risk of hemolytic anemia.
References :

  1. Welsh SJ, Corrie PG: Management of BRAF and MEK inhibitor toxicities in patients with metastatic melanoma. Ther Adv Med Oncol. 2015 Mar;7(2):122-36. doi: 10.1177/1758834014566428. [PubMed:25755684 ]
  2. Tafinlar® (dabrafenib) capsules[package insert]. East Hanover, New Jersey: Novartis Pharmaceuticals Corporation; 2016. [Link]

PMID: 26230520

By

Related Post

You Missed

Uncategorized

VEGFA (Human) Recombinant Protein

Uncategorized

Scgb1a1 (Rat) Recombinant Protein

Uncategorized

MSTN (Human) Recombinant Protein

Uncategorized

FLT3LG (Human) Recombinant Protein (P01)