PI3KInhibitorpi3kinhibitor

Chlorpropamide

By

Chlorpropamide

Product: MLN1117

Identifier : DBSNPE000892
Drug : DB00672 (Chlorpropamide)
Interacting Gene/Enzyme : Glucose-6-phosphate 1-dehydrogenase
Gene Name : G6PD
UniProt ID : P11413
Defining Change(s) :

  • 1006A->G

Allele Name : Torun
Genotype(s) : Not Available
Type(s) : ADR Inferred
Groups : G6PD deficiency
Description : Increased risk of hemolytic anemia.
References :

  1. Eichelbaum M, Evert B: Influence of pharmacogenetics on drug disposition and response. Clin Exp Pharmacol Physiol. 1996 Oct-Nov;23(10-11):983-5. [PubMed:8911746 ]
  2. Diabinese® (chlorpropamide)[package insert]. New York City, New York: Pfizer Labs, Division of Pfizer Inc; 2010. [Link]

PMID: 21601002

Chlorpropamide

By

Chlorpropamide

Product: NSC 601980 (analog)

Identifier : DBSNPE000893
Drug : DB00672 (Chlorpropamide)
Interacting Gene/Enzyme : Glucose-6-phosphate 1-dehydrogenase
Gene Name : G6PD
UniProt ID : P11413
Defining Change(s) :

  • 105_107delCAT

Allele Name : Sunderland
Genotype(s) : Not Available
Type(s) : ADR Inferred
Groups : G6PD deficiency
Description : Increased risk of hemolytic anemia.
References :

  1. Eichelbaum M, Evert B: Influence of pharmacogenetics on drug disposition and response. Clin Exp Pharmacol Physiol. 1996 Oct-Nov;23(10-11):983-5. [PubMed:8911746 ]
  2. Diabinese® (chlorpropamide)[package insert]. New York City, New York: Pfizer Labs, Division of Pfizer Inc; 2010. [Link]

PMID: 15900046

Chlorpropamide

By

Chlorpropamide

Product: Artemotil

Identifier : DBSNPE000894
Drug : DB00672 (Chlorpropamide)
Interacting Gene/Enzyme : Glucose-6-phosphate 1-dehydrogenase
Gene Name : G6PD
UniProt ID : P11413
Defining Change(s) :

  • 1081G->A

Allele Name : Iwatsuki
Genotype(s) : Not Available
Type(s) : ADR Inferred
Groups : G6PD deficiency
Description : Increased risk of hemolytic anemia.
References :

  1. Eichelbaum M, Evert B: Influence of pharmacogenetics on drug disposition and response. Clin Exp Pharmacol Physiol. 1996 Oct-Nov;23(10-11):983-5. [PubMed:8911746 ]
  2. Diabinese® (chlorpropamide)[package insert]. New York City, New York: Pfizer Labs, Division of Pfizer Inc; 2010. [Link]

PMID: 1999415

Chlorpropamide

By

Chlorpropamide

Product: THZ1-R

Identifier : DBSNPE000895
Drug : DB00672 (Chlorpropamide)
Interacting Gene/Enzyme : Glucose-6-phosphate 1-dehydrogenase
Gene Name : G6PD
UniProt ID : P11413
Defining Change(s) :

  • 1082C->T

Allele Name : Serres
Genotype(s) : Not Available
Type(s) : ADR Inferred
Groups : G6PD deficiency
Description : Increased risk of hemolytic anemia.
References :

  1. Eichelbaum M, Evert B: Influence of pharmacogenetics on drug disposition and response. Clin Exp Pharmacol Physiol. 1996 Oct-Nov;23(10-11):983-5. [PubMed:8911746 ]
  2. Diabinese® (chlorpropamide)[package insert]. New York City, New York: Pfizer Labs, Division of Pfizer Inc; 2010. [Link]

PMID: 22177475

Chlorpropamide

By

Chlorpropamide

Product: Leucomethylene blue (Mesylate)

Identifier : DBSNPE000896
Drug : DB00672 (Chlorpropamide)
Interacting Gene/Enzyme : Glucose-6-phosphate 1-dehydrogenase
Gene Name : G6PD
UniProt ID : P11413
Defining Change(s) :

  • 1084_1101delCTGAACGAGCGCAAGGCC

Allele Name : Tondela
Genotype(s) : Not Available
Type(s) : ADR Inferred
Groups : G6PD deficiency
Description : Increased risk of hemolytic anemia.
References :

  1. Eichelbaum M, Evert B: Influence of pharmacogenetics on drug disposition and response. Clin Exp Pharmacol Physiol. 1996 Oct-Nov;23(10-11):983-5. [PubMed:8911746 ]
  2. Diabinese® (chlorpropamide)[package insert]. New York City, New York: Pfizer Labs, Division of Pfizer Inc; 2010. [Link]

PMID: 20008854

Chlorpropamide

By

Chlorpropamide

Product: Fruquintinib

Identifier : DBSNPE000897
Drug : DB00672 (Chlorpropamide)
Interacting Gene/Enzyme : Glucose-6-phosphate 1-dehydrogenase
Gene Name : G6PD
UniProt ID : P11413
Defining Change(s) :

  • 1089C->A

Allele Name : Loma Linda
Genotype(s) : Not Available
Type(s) : ADR Inferred
Groups : G6PD deficiency
Description : Increased risk of hemolytic anemia.
References :

  1. Eichelbaum M, Evert B: Influence of pharmacogenetics on drug disposition and response. Clin Exp Pharmacol Physiol. 1996 Oct-Nov;23(10-11):983-5. [PubMed:8911746 ]
  2. Diabinese® (chlorpropamide)[package insert]. New York City, New York: Pfizer Labs, Division of Pfizer Inc; 2010. [Link]

PMID: 25086508

Chlorpropamide

By

Chlorpropamide

Product: Amezinium (methylsulfate)

Identifier : DBSNPE000899
Drug : DB00672 (Chlorpropamide)
Interacting Gene/Enzyme : Glucose-6-phosphate 1-dehydrogenase
Gene Name : G6PD
UniProt ID : P11413
Defining Change(s) :

  • 1096A->G

Allele Name : Tenri
Genotype(s) : Not Available
Type(s) : ADR Inferred
Groups : G6PD deficiency
Description : Increased risk of hemolytic anemia.
References :

  1. Eichelbaum M, Evert B: Influence of pharmacogenetics on drug disposition and response. Clin Exp Pharmacol Physiol. 1996 Oct-Nov;23(10-11):983-5. [PubMed:8911746 ]
  2. Diabinese® (chlorpropamide)[package insert]. New York City, New York: Pfizer Labs, Division of Pfizer Inc; 2010. [Link]

PMID: 24900872

Chlorpropamide

By

Chlorpropamide

Product: PF-CBP1 (hydrochloride)

Identifier : DBSNPE000900
Drug : DB00672 (Chlorpropamide)
Interacting Gene/Enzyme : Glucose-6-phosphate 1-dehydrogenase
Gene Name : G6PD
UniProt ID : P11413
Defining Change(s) :

  • 1132G>A

Allele Name : Montpellier
Genotype(s) : Not Available
Type(s) : ADR Inferred
Groups : G6PD deficiency
Description : Increased risk of hemolytic anemia.
References :

  1. Eichelbaum M, Evert B: Influence of pharmacogenetics on drug disposition and response. Clin Exp Pharmacol Physiol. 1996 Oct-Nov;23(10-11):983-5. [PubMed:8911746 ]
  2. Diabinese® (chlorpropamide)[package insert]. New York City, New York: Pfizer Labs, Division of Pfizer Inc; 2010. [Link]

PMID: 22217876

Chlorpropamide

By

Chlorpropamide

Product: PD1-PDL1 inhibitor 1

Identifier : DBSNPE000901
Drug : DB00672 (Chlorpropamide)
Interacting Gene/Enzyme : Glucose-6-phosphate 1-dehydrogenase
Gene Name : G6PD
UniProt ID : P11413
Defining Change(s) :

  • 1138A->G

Allele Name : Calvo Mackenna
Genotype(s) : Not Available
Type(s) : ADR Inferred
Groups : G6PD deficiency
Description : Increased risk of hemolytic anemia.
References :

  1. Eichelbaum M, Evert B: Influence of pharmacogenetics on drug disposition and response. Clin Exp Pharmacol Physiol. 1996 Oct-Nov;23(10-11):983-5. [PubMed:8911746 ]
  2. Diabinese® (chlorpropamide)[package insert]. New York City, New York: Pfizer Labs, Division of Pfizer Inc; 2010. [Link]

PMID: 22859723

Chlorpropamide

By

Chlorpropamide

Product: PF-915275

Identifier : DBSNPE000902
Drug : DB00672 (Chlorpropamide)
Interacting Gene/Enzyme : Glucose-6-phosphate 1-dehydrogenase
Gene Name : G6PD
UniProt ID : P11413
Defining Change(s) :

  • 1139T->C

Allele Name : Riley
Genotype(s) : Not Available
Type(s) : ADR Inferred
Groups : G6PD deficiency
Description : Increased risk of hemolytic anemia.
References :

  1. Eichelbaum M, Evert B: Influence of pharmacogenetics on drug disposition and response. Clin Exp Pharmacol Physiol. 1996 Oct-Nov;23(10-11):983-5. [PubMed:8911746 ]
  2. Diabinese® (chlorpropamide)[package insert]. New York City, New York: Pfizer Labs, Division of Pfizer Inc; 2010. [Link]

PMID: 22087278

Chlorpropamide

By

Chlorpropamide

Product: GW0742

Identifier : DBSNPE000903
Drug : DB00672 (Chlorpropamide)
Interacting Gene/Enzyme : Glucose-6-phosphate 1-dehydrogenase
Gene Name : G6PD
UniProt ID : P11413
Defining Change(s) :

  • 1141T->C

Allele Name : Olomouc
Genotype(s) : Not Available
Type(s) : ADR Inferred
Groups : G6PD deficiency
Description : Increased risk of hemolytic anemia.
References :

  1. Eichelbaum M, Evert B: Influence of pharmacogenetics on drug disposition and response. Clin Exp Pharmacol Physiol. 1996 Oct-Nov;23(10-11):983-5. [PubMed:8911746 ]
  2. Diabinese® (chlorpropamide)[package insert]. New York City, New York: Pfizer Labs, Division of Pfizer Inc; 2010. [Link]

PMID: 23853170

Chlorpropamide

By

Chlorpropamide

Product: NSC348884

Identifier : DBSNPE000904
Drug : DB00672 (Chlorpropamide)
Interacting Gene/Enzyme : Glucose-6-phosphate 1-dehydrogenase
Gene Name : G6PD
UniProt ID : P11413
Defining Change(s) :

  • 1153T->C

Allele Name : Tomah
Genotype(s) : Not Available
Type(s) : ADR Inferred
Groups : G6PD deficiency
Description : Increased risk of hemolytic anemia.
References :

  1. Eichelbaum M, Evert B: Influence of pharmacogenetics on drug disposition and response. Clin Exp Pharmacol Physiol. 1996 Oct-Nov;23(10-11):983-5. [PubMed:8911746 ]
  2. Diabinese® (chlorpropamide)[package insert]. New York City, New York: Pfizer Labs, Division of Pfizer Inc; 2010. [Link]

PMID: 21498659

Chlorpropamide

By

Chlorpropamide

Product: Finafloxacin

Identifier : DBSNPE000905
Drug : DB00672 (Chlorpropamide)
Interacting Gene/Enzyme : Glucose-6-phosphate 1-dehydrogenase
Gene Name : G6PD
UniProt ID : P11413
Defining Change(s) :

  • 1154G->T

Allele Name : Lynwood
Genotype(s) : Not Available
Type(s) : ADR Inferred
Groups : G6PD deficiency
Description : Increased risk of hemolytic anemia.
References :

  1. Eichelbaum M, Evert B: Influence of pharmacogenetics on drug disposition and response. Clin Exp Pharmacol Physiol. 1996 Oct-Nov;23(10-11):983-5. [PubMed:8911746 ]
  2. Diabinese® (chlorpropamide)[package insert]. New York City, New York: Pfizer Labs, Division of Pfizer Inc; 2010. [Link]

PMID: 19719777

Chlorpropamide

By

Chlorpropamide

Product: KDM5A-IN-1

Identifier : DBSNPE000906
Drug : DB00672 (Chlorpropamide)
Interacting Gene/Enzyme : Glucose-6-phosphate 1-dehydrogenase
Gene Name : G6PD
UniProt ID : P11413
Defining Change(s) :

  • 1155C->G

Allele Name : Madrid
Genotype(s) : Not Available
Type(s) : ADR Inferred
Groups : G6PD deficiency
Description : Increased risk of hemolytic anemia.
References :

  1. Eichelbaum M, Evert B: Influence of pharmacogenetics on drug disposition and response. Clin Exp Pharmacol Physiol. 1996 Oct-Nov;23(10-11):983-5. [PubMed:8911746 ]
  2. Diabinese® (chlorpropamide)[package insert]. New York City, New York: Pfizer Labs, Division of Pfizer Inc; 2010. [Link]

PMID: 20685848

Chlorpropamide

By

Chlorpropamide

Product: HIF-2α-IN-1

Identifier : DBSNPE000907
Drug : DB00672 (Chlorpropamide)
Interacting Gene/Enzyme : Glucose-6-phosphate 1-dehydrogenase
Gene Name : G6PD
UniProt ID : P11413
Defining Change(s) :

  • 1156A->G

Allele Name : Iowa, Walter Reed, Springfield
Genotype(s) : Not Available
Type(s) : ADR Inferred
Groups : G6PD deficiency
Description : Increased risk of hemolytic anemia.
References :

  1. Eichelbaum M, Evert B: Influence of pharmacogenetics on drug disposition and response. Clin Exp Pharmacol Physiol. 1996 Oct-Nov;23(10-11):983-5. [PubMed:8911746 ]
  2. Diabinese® (chlorpropamide)[package insert]. New York City, New York: Pfizer Labs, Division of Pfizer Inc; 2010. [Link]

PMID: 24881566

Chlorpropamide

By

Chlorpropamide

Product: BET-IN-1

Identifier : DBSNPE000908
Drug : DB00672 (Chlorpropamide)
Interacting Gene/Enzyme : Glucose-6-phosphate 1-dehydrogenase
Gene Name : G6PD
UniProt ID : P11413
Defining Change(s) :

  • 1160G->A

Allele Name : Beverly Hills, Genova, Iwate, Niigata, Yamaguchi
Genotype(s) : Not Available
Type(s) : ADR Inferred
Groups : G6PD deficiency
Description : Increased risk of hemolytic anemia.
References :

  1. Eichelbaum M, Evert B: Influence of pharmacogenetics on drug disposition and response. Clin Exp Pharmacol Physiol. 1996 Oct-Nov;23(10-11):983-5. [PubMed:8911746 ]
  2. Diabinese® (chlorpropamide)[package insert]. New York City, New York: Pfizer Labs, Division of Pfizer Inc; 2010. [Link]

PMID: 22904345

Chlorpropamide

By

Chlorpropamide

Product: JW74

Identifier : DBSNPE000909
Drug : DB00672 (Chlorpropamide)
Interacting Gene/Enzyme : Glucose-6-phosphate 1-dehydrogenase
Gene Name : G6PD
UniProt ID : P11413
Defining Change(s) :

  • 1162A->G

Allele Name : Hartford
Genotype(s) : Not Available
Type(s) : ADR Inferred
Groups : G6PD deficiency
Description : Increased risk of hemolytic anemia.
References :

  1. Eichelbaum M, Evert B: Influence of pharmacogenetics on drug disposition and response. Clin Exp Pharmacol Physiol. 1996 Oct-Nov;23(10-11):983-5. [PubMed:8911746 ]
  2. Diabinese® (chlorpropamide)[package insert]. New York City, New York: Pfizer Labs, Division of Pfizer Inc; 2010. [Link]

PMID: 18550787

Chlorpropamide

By

Chlorpropamide

Product: BIBS 39

Identifier : DBSNPE000910
Drug : DB00672 (Chlorpropamide)
Interacting Gene/Enzyme : Glucose-6-phosphate 1-dehydrogenase
Gene Name : G6PD
UniProt ID : P11413
Defining Change(s) :

  • 1166A->G

Allele Name : Praha
Genotype(s) : Not Available
Type(s) : ADR Inferred
Groups : G6PD deficiency
Description : Increased risk of hemolytic anemia.
References :

  1. Eichelbaum M, Evert B: Influence of pharmacogenetics on drug disposition and response. Clin Exp Pharmacol Physiol. 1996 Oct-Nov;23(10-11):983-5. [PubMed:8911746 ]
  2. Diabinese® (chlorpropamide)[package insert]. New York City, New York: Pfizer Labs, Division of Pfizer Inc; 2010. [Link]

PMID: 16702987

Chlorpropamide

By

Chlorpropamide

Product: Orexin 2 Receptor Agonist

Identifier : DBSNPE000911
Drug : DB00672 (Chlorpropamide)
Interacting Gene/Enzyme : Glucose-6-phosphate 1-dehydrogenase
Gene Name : G6PD
UniProt ID : P11413
Defining Change(s) :

  • 1175T>C

Allele Name : Krakow
Genotype(s) : Not Available
Type(s) : ADR Inferred
Groups : G6PD deficiency
Description : Increased risk of hemolytic anemia.
References :

  1. Eichelbaum M, Evert B: Influence of pharmacogenetics on drug disposition and response. Clin Exp Pharmacol Physiol. 1996 Oct-Nov;23(10-11):983-5. [PubMed:8911746 ]
  2. Diabinese® (chlorpropamide)[package insert]. New York City, New York: Pfizer Labs, Division of Pfizer Inc; 2010. [Link]

PMID: 16439116

Chlorpropamide

By

Chlorpropamide

Product: Acalisib

Identifier : DBSNPE000912
Drug : DB00672 (Chlorpropamide)
Interacting Gene/Enzyme : Glucose-6-phosphate 1-dehydrogenase
Gene Name : G6PD
UniProt ID : P11413
Defining Change(s) :

  • 1177C->G

Allele Name : Wisconsin
Genotype(s) : Not Available
Type(s) : ADR Inferred
Groups : G6PD deficiency
Description : Increased risk of hemolytic anemia.
References :

  1. Eichelbaum M, Evert B: Influence of pharmacogenetics on drug disposition and response. Clin Exp Pharmacol Physiol. 1996 Oct-Nov;23(10-11):983-5. [PubMed:8911746 ]
  2. Diabinese® (chlorpropamide)[package insert]. New York City, New York: Pfizer Labs, Division of Pfizer Inc; 2010. [Link]

PMID: 28446241

Chlorpropamide

By

Chlorpropamide

Product: TAK-438 (free base)

Identifier : DBSNPE000913
Drug : DB00672 (Chlorpropamide)
Interacting Gene/Enzyme : Glucose-6-phosphate 1-dehydrogenase
Gene Name : G6PD
UniProt ID : P11413
Defining Change(s) :

  • 1178G->A

Allele Name : Nashville, Anaheim, Portici
Genotype(s) : Not Available
Type(s) : ADR Inferred
Groups : G6PD deficiency
Description : Increased risk of hemolytic anemia.
References :

  1. Eichelbaum M, Evert B: Influence of pharmacogenetics on drug disposition and response. Clin Exp Pharmacol Physiol. 1996 Oct-Nov;23(10-11):983-5. [PubMed:8911746 ]
  2. Diabinese® (chlorpropamide)[package insert]. New York City, New York: Pfizer Labs, Division of Pfizer Inc; 2010. [Link]

PMID: 20813258

Chlorpropamide

By

Chlorpropamide

Product: Propyphenazone

Identifier : DBSNPE000914
Drug : DB00672 (Chlorpropamide)
Interacting Gene/Enzyme : Glucose-6-phosphate 1-dehydrogenase
Gene Name : G6PD
UniProt ID : P11413
Defining Change(s) :

  • 1180G->C

Allele Name : Alhambra
Genotype(s) : Not Available
Type(s) : ADR Inferred
Groups : G6PD deficiency
Description : Increased risk of hemolytic anemia.
References :

  1. Eichelbaum M, Evert B: Influence of pharmacogenetics on drug disposition and response. Clin Exp Pharmacol Physiol. 1996 Oct-Nov;23(10-11):983-5. [PubMed:8911746 ]
  2. Diabinese® (chlorpropamide)[package insert]. New York City, New York: Pfizer Labs, Division of Pfizer Inc; 2010. [Link]

PMID: 22519963

Chlorpropamide

By

Chlorpropamide

Product: GSK137647A

Identifier : DBSNPE000915
Drug : DB00672 (Chlorpropamide)
Interacting Gene/Enzyme : Glucose-6-phosphate 1-dehydrogenase
Gene Name : G6PD
UniProt ID : P11413
Defining Change(s) :

  • 1187C->T

Allele Name : Bari
Genotype(s) : Not Available
Type(s) : ADR Inferred
Groups : G6PD deficiency
Description : Increased risk of hemolytic anemia.
References :

  1. Eichelbaum M, Evert B: Influence of pharmacogenetics on drug disposition and response. Clin Exp Pharmacol Physiol. 1996 Oct-Nov;23(10-11):983-5. [PubMed:8911746 ]
  2. Diabinese® (chlorpropamide)[package insert]. New York City, New York: Pfizer Labs, Division of Pfizer Inc; 2010. [Link]

PMID: 27326330

Chlorpropamide

By

Chlorpropamide

Product: UNC1079

Identifier : DBSNPE000916
Drug : DB00672 (Chlorpropamide)
Interacting Gene/Enzyme : Glucose-6-phosphate 1-dehydrogenase
Gene Name : G6PD
UniProt ID : P11413
Defining Change(s) :

  • 1192G->A

Allele Name : Puerto Limon
Genotype(s) : Not Available
Type(s) : ADR Inferred
Groups : G6PD deficiency
Description : Increased risk of hemolytic anemia.
References :

  1. Eichelbaum M, Evert B: Influence of pharmacogenetics on drug disposition and response. Clin Exp Pharmacol Physiol. 1996 Oct-Nov;23(10-11):983-5. [PubMed:8911746 ]
  2. Diabinese® (chlorpropamide)[package insert]. New York City, New York: Pfizer Labs, Division of Pfizer Inc; 2010. [Link]

PMID: 26962172

Chlorpropamide

By

Chlorpropamide

Product: F 11440

Identifier : DBSNPE000917
Drug : DB00672 (Chlorpropamide)
Interacting Gene/Enzyme : Glucose-6-phosphate 1-dehydrogenase
Gene Name : G6PD
UniProt ID : P11413
Defining Change(s) :

  • 1205C>A

Allele Name : Covao do Lobo
Genotype(s) : Not Available
Type(s) : ADR Inferred
Groups : G6PD deficiency
Description : Increased risk of hemolytic anemia.
References :

  1. Eichelbaum M, Evert B: Influence of pharmacogenetics on drug disposition and response. Clin Exp Pharmacol Physiol. 1996 Oct-Nov;23(10-11):983-5. [PubMed:8911746 ]
  2. Diabinese® (chlorpropamide)[package insert]. New York City, New York: Pfizer Labs, Division of Pfizer Inc; 2010. [Link]

PMID: 26683635

Chlorpropamide

By

Chlorpropamide

Product: C-DIM12

Identifier : DBSNPE000919
Drug : DB00672 (Chlorpropamide)
Interacting Gene/Enzyme : Glucose-6-phosphate 1-dehydrogenase
Gene Name : G6PD
UniProt ID : P11413
Defining Change(s) :

  • 1225C->T

Allele Name : Udivecht
Genotype(s) : Not Available
Type(s) : ADR Inferred
Groups : G6PD deficiency
Description : Increased risk of hemolytic anemia.
References :

  1. Eichelbaum M, Evert B: Influence of pharmacogenetics on drug disposition and response. Clin Exp Pharmacol Physiol. 1996 Oct-Nov;23(10-11):983-5. [PubMed:8911746 ]
  2. Diabinese® (chlorpropamide)[package insert]. New York City, New York: Pfizer Labs, Division of Pfizer Inc; 2010. [Link]

PMID: 26518871

Chlorpropamide

By

Chlorpropamide

Product: DG172 (dihydrochloride)

Identifier : DBSNPE000920
Drug : DB00672 (Chlorpropamide)
Interacting Gene/Enzyme : Glucose-6-phosphate 1-dehydrogenase
Gene Name : G6PD
UniProt ID : P11413
Defining Change(s) :

  • 1226C->G

Allele Name : Suwalki
Genotype(s) : Not Available
Type(s) : ADR Inferred
Groups : G6PD deficiency
Description : Increased risk of hemolytic anemia.
References :

  1. Eichelbaum M, Evert B: Influence of pharmacogenetics on drug disposition and response. Clin Exp Pharmacol Physiol. 1996 Oct-Nov;23(10-11):983-5. [PubMed:8911746 ]
  2. Diabinese® (chlorpropamide)[package insert]. New York City, New York: Pfizer Labs, Division of Pfizer Inc; 2010. [Link]

PMID: 23776696

Chlorpropamide

By

Chlorpropamide

Product: TY-52156

Identifier : DBSNPE000921
Drug : DB00672 (Chlorpropamide)
Interacting Gene/Enzyme : Glucose-6-phosphate 1-dehydrogenase
Gene Name : G6PD
UniProt ID : P11413
Defining Change(s) :

  • 1228G->T

Allele Name : Riverside
Genotype(s) : Not Available
Type(s) : ADR Inferred
Groups : G6PD deficiency
Description : Increased risk of hemolytic anemia.
References :

  1. Eichelbaum M, Evert B: Influence of pharmacogenetics on drug disposition and response. Clin Exp Pharmacol Physiol. 1996 Oct-Nov;23(10-11):983-5. [PubMed:8911746 ]
  2. Diabinese® (chlorpropamide)[package insert]. New York City, New York: Pfizer Labs, Division of Pfizer Inc; 2010. [Link]

PMID: 20888730

Chlorpropamide

By

Chlorpropamide

Product: KJ Pyr 9

Identifier : DBSNPE000922
Drug : DB00672 (Chlorpropamide)
Interacting Gene/Enzyme : Glucose-6-phosphate 1-dehydrogenase
Gene Name : G6PD
UniProt ID : P11413
Defining Change(s) :

  • 1229G->A

Allele Name : Japan, Shinagawa
Genotype(s) : Not Available
Type(s) : ADR Inferred
Groups : G6PD deficiency
Description : Increased risk of hemolytic anemia.
References :

  1. Eichelbaum M, Evert B: Influence of pharmacogenetics on drug disposition and response. Clin Exp Pharmacol Physiol. 1996 Oct-Nov;23(10-11):983-5. [PubMed:8911746 ]
  2. Diabinese® (chlorpropamide)[package insert]. New York City, New York: Pfizer Labs, Division of Pfizer Inc; 2010. [Link]

PMID: 19818732

Chlorpropamide

By

Chlorpropamide

Product: lumateperone (Tosylate)

Identifier : DBSNPE000923
Drug : DB00672 (Chlorpropamide)
Interacting Gene/Enzyme : Glucose-6-phosphate 1-dehydrogenase
Gene Name : G6PD
UniProt ID : P11413
Defining Change(s) :

  • 1229G->C

Allele Name : Kawasaki
Genotype(s) : Not Available
Type(s) : ADR Inferred
Groups : G6PD deficiency
Description : Increased risk of hemolytic anemia.
References :

  1. Eichelbaum M, Evert B: Influence of pharmacogenetics on drug disposition and response. Clin Exp Pharmacol Physiol. 1996 Oct-Nov;23(10-11):983-5. [PubMed:8911746 ]
  2. Diabinese® (chlorpropamide)[package insert]. New York City, New York: Pfizer Labs, Division of Pfizer Inc; 2010. [Link]

PMID: 25380412

Chlorpropamide

By

Chlorpropamide

Product: ABT-639

Identifier : DBSNPE000924
Drug : DB00672 (Chlorpropamide)
Interacting Gene/Enzyme : Glucose-6-phosphate 1-dehydrogenase
Gene Name : G6PD
UniProt ID : P11413
Defining Change(s) :

  • 1231A->G

Allele Name : Munich
Genotype(s) : Not Available
Type(s) : ADR Inferred
Groups : G6PD deficiency
Description : Increased risk of hemolytic anemia.
References :

  1. Eichelbaum M, Evert B: Influence of pharmacogenetics on drug disposition and response. Clin Exp Pharmacol Physiol. 1996 Oct-Nov;23(10-11):983-5. [PubMed:8911746 ]
  2. Diabinese® (chlorpropamide)[package insert]. New York City, New York: Pfizer Labs, Division of Pfizer Inc; 2010. [Link]

PMID: 20338520

Chlorpropamide

By

Chlorpropamide

Product: ZM241385

Identifier : DBSNPE000925
Drug : DB00672 (Chlorpropamide)
Interacting Gene/Enzyme : Glucose-6-phosphate 1-dehydrogenase
Gene Name : G6PD
UniProt ID : P11413
Defining Change(s) :

  • 1284C->A

Allele Name : Georgia
Genotype(s) : Not Available
Type(s) : ADR Inferred
Groups : G6PD deficiency
Description : Increased risk of hemolytic anemia.
References :

  1. Eichelbaum M, Evert B: Influence of pharmacogenetics on drug disposition and response. Clin Exp Pharmacol Physiol. 1996 Oct-Nov;23(10-11):983-5. [PubMed:8911746 ]
  2. Diabinese® (chlorpropamide)[package insert]. New York City, New York: Pfizer Labs, Division of Pfizer Inc; 2010. [Link]

PMID: 9488112

Chlorpropamide

By

Chlorpropamide

Product: MI-136

Identifier : DBSNPE000926
Drug : DB00672 (Chlorpropamide)
Interacting Gene/Enzyme : Glucose-6-phosphate 1-dehydrogenase
Gene Name : G6PD
UniProt ID : P11413
Defining Change(s) :

  • 1292T->G

Allele Name : Sumare
Genotype(s) : Not Available
Type(s) : ADR Inferred
Groups : G6PD deficiency
Description : Increased risk of hemolytic anemia.
References :

  1. Eichelbaum M, Evert B: Influence of pharmacogenetics on drug disposition and response. Clin Exp Pharmacol Physiol. 1996 Oct-Nov;23(10-11):983-5. [PubMed:8911746 ]
  2. Diabinese® (chlorpropamide)[package insert]. New York City, New York: Pfizer Labs, Division of Pfizer Inc; 2010. [Link]

PMID: 9240345

Chlorpropamide

By

Chlorpropamide

Product: Trovirdine

Identifier : DBSNPE000927
Drug : DB00672 (Chlorpropamide)
Interacting Gene/Enzyme : Glucose-6-phosphate 1-dehydrogenase
Gene Name : G6PD
UniProt ID : P11413
Defining Change(s) :

  • 1318C->T

Allele Name : Telti/Kobe
Genotype(s) : Not Available
Type(s) : ADR Inferred
Groups : G6PD deficiency
Description : Increased risk of hemolytic anemia.
References :

  1. Eichelbaum M, Evert B: Influence of pharmacogenetics on drug disposition and response. Clin Exp Pharmacol Physiol. 1996 Oct-Nov;23(10-11):983-5. [PubMed:8911746 ]
  2. Diabinese® (chlorpropamide)[package insert]. New York City, New York: Pfizer Labs, Division of Pfizer Inc; 2010. [Link]

PMID: 19955487

Chlorpropamide

By

Chlorpropamide

Product: Flumatinib

Identifier : DBSNPE000928
Drug : DB00672 (Chlorpropamide)
Interacting Gene/Enzyme : Glucose-6-phosphate 1-dehydrogenase
Gene Name : G6PD
UniProt ID : P11413
Defining Change(s) :

  • 1339G->A

Allele Name : Santiago de Cuba, Morioka
Genotype(s) : Not Available
Type(s) : ADR Inferred
Groups : G6PD deficiency
Description : Increased risk of hemolytic anemia.
References :

  1. Eichelbaum M, Evert B: Influence of pharmacogenetics on drug disposition and response. Clin Exp Pharmacol Physiol. 1996 Oct-Nov;23(10-11):983-5. [PubMed:8911746 ]
  2. Diabinese® (chlorpropamide)[package insert]. New York City, New York: Pfizer Labs, Division of Pfizer Inc; 2010. [Link]

PMID: 14598292

Chlorpropamide

By

Chlorpropamide

Product: GNF-7

Identifier : DBSNPE000929
Drug : DB00672 (Chlorpropamide)
Interacting Gene/Enzyme : Glucose-6-phosphate 1-dehydrogenase
Gene Name : G6PD
UniProt ID : P11413
Defining Change(s) :

  • 1358T->A

Allele Name : Harima
Genotype(s) : Not Available
Type(s) : ADR Inferred
Groups : G6PD deficiency
Description : Increased risk of hemolytic anemia.
References :

  1. Eichelbaum M, Evert B: Influence of pharmacogenetics on drug disposition and response. Clin Exp Pharmacol Physiol. 1996 Oct-Nov;23(10-11):983-5. [PubMed:8911746 ]
  2. Diabinese® (chlorpropamide)[package insert]. New York City, New York: Pfizer Labs, Division of Pfizer Inc; 2010. [Link]

PMID: 25894690

Chlorpropamide

By

Chlorpropamide

Product: NSC5844

Identifier : DBSNPE000930
Drug : DB00672 (Chlorpropamide)
Interacting Gene/Enzyme : Glucose-6-phosphate 1-dehydrogenase
Gene Name : G6PD
UniProt ID : P11413
Defining Change(s) :

  • 1366G->C

Allele Name : Figuera da Foz
Genotype(s) : Not Available
Type(s) : ADR Inferred
Groups : G6PD deficiency
Description : Increased risk of hemolytic anemia.
References :

  1. Eichelbaum M, Evert B: Influence of pharmacogenetics on drug disposition and response. Clin Exp Pharmacol Physiol. 1996 Oct-Nov;23(10-11):983-5. [PubMed:8911746 ]
  2. Diabinese® (chlorpropamide)[package insert]. New York City, New York: Pfizer Labs, Division of Pfizer Inc; 2010. [Link]

PMID: 25973543

Chlorpropamide

By

Chlorpropamide

Product: Peretinoin

Identifier : DBSNPE000931
Drug : DB00672 (Chlorpropamide)
Interacting Gene/Enzyme : Glucose-6-phosphate 1-dehydrogenase
Gene Name : G6PD
UniProt ID : P11413
Defining Change(s) :

  • 1367A>T

Allele Name : Amiens
Genotype(s) : Not Available
Type(s) : ADR Inferred
Groups : G6PD deficiency
Description : Increased risk of hemolytic anemia.
References :

  1. Eichelbaum M, Evert B: Influence of pharmacogenetics on drug disposition and response. Clin Exp Pharmacol Physiol. 1996 Oct-Nov;23(10-11):983-5. [PubMed:8911746 ]
  2. Diabinese® (chlorpropamide)[package insert]. New York City, New York: Pfizer Labs, Division of Pfizer Inc; 2010. [Link]

PMID: 26138239

Chlorpropamide

By

Chlorpropamide

Product: MK-2461

Identifier : DBSNPE000932
Drug : DB00672 (Chlorpropamide)
Interacting Gene/Enzyme : Glucose-6-phosphate 1-dehydrogenase
Gene Name : G6PD
UniProt ID : P11413
Defining Change(s) :

  • 1376G->T, 1502T->G

Allele Name : Bangkok Noi
Genotype(s) : Not Available
Type(s) : ADR Inferred
Groups : G6PD deficiency
Description : Increased risk of hemolytic anemia.
References :

  1. Eichelbaum M, Evert B: Influence of pharmacogenetics on drug disposition and response. Clin Exp Pharmacol Physiol. 1996 Oct-Nov;23(10-11):983-5. [PubMed:8911746 ]
  2. Diabinese® (chlorpropamide)[package insert]. New York City, New York: Pfizer Labs, Division of Pfizer Inc; 2010. [Link]

PMID: 25156440

Chlorpropamide

By

Chlorpropamide

Product: Glesatinib (hydrochloride)

Identifier : DBSNPE000933
Drug : DB00672 (Chlorpropamide)
Interacting Gene/Enzyme : Glucose-6-phosphate 1-dehydrogenase
Gene Name : G6PD
UniProt ID : P11413
Defining Change(s) :

  • 1462G->A

Allele Name : Fukaya
Genotype(s) : Not Available
Type(s) : ADR Inferred
Groups : G6PD deficiency
Description : Increased risk of hemolytic anemia.
References :

  1. Eichelbaum M, Evert B: Influence of pharmacogenetics on drug disposition and response. Clin Exp Pharmacol Physiol. 1996 Oct-Nov;23(10-11):983-5. [PubMed:8911746 ]
  2. Diabinese® (chlorpropamide)[package insert]. New York City, New York: Pfizer Labs, Division of Pfizer Inc; 2010. [Link]

PMID: 26579384

Chlorpropamide

By

Chlorpropamide

Product: Fexinidazole

Identifier : DBSNPE000934
Drug : DB00672 (Chlorpropamide)
Interacting Gene/Enzyme : Glucose-6-phosphate 1-dehydrogenase
Gene Name : G6PD
UniProt ID : P11413
Defining Change(s) :

  • 1463G->T

Allele Name : Campinas
Genotype(s) : Not Available
Type(s) : ADR Inferred
Groups : G6PD deficiency
Description : Increased risk of hemolytic anemia.
References :

  1. Eichelbaum M, Evert B: Influence of pharmacogenetics on drug disposition and response. Clin Exp Pharmacol Physiol. 1996 Oct-Nov;23(10-11):983-5. [PubMed:8911746 ]
  2. Diabinese® (chlorpropamide)[package insert]. New York City, New York: Pfizer Labs, Division of Pfizer Inc; 2010. [Link]

PMID: 25240927

Chlorpropamide

By

Chlorpropamide

Product: Ebselen

Identifier : DBSNPE000935
Drug : DB00672 (Chlorpropamide)
Interacting Gene/Enzyme : Glucose-6-phosphate 1-dehydrogenase
Gene Name : G6PD
UniProt ID : P11413
Defining Change(s) :

  • 1465C>T

Allele Name : Buenos Aires
Genotype(s) : Not Available
Type(s) : ADR Inferred
Groups : G6PD deficiency
Description : Increased risk of hemolytic anemia.
References :

  1. Eichelbaum M, Evert B: Influence of pharmacogenetics on drug disposition and response. Clin Exp Pharmacol Physiol. 1996 Oct-Nov;23(10-11):983-5. [PubMed:8911746 ]
  2. Diabinese® (chlorpropamide)[package insert]. New York City, New York: Pfizer Labs, Division of Pfizer Inc; 2010. [Link]

PMID: 22791892

Chlorpropamide

By

Chlorpropamide

Product: Vorapaxar

Identifier : DBSNPE000936
Drug : DB00672 (Chlorpropamide)
Interacting Gene/Enzyme : Glucose-6-phosphate 1-dehydrogenase
Gene Name : G6PD
UniProt ID : P11413
Defining Change(s) :

  • 1466C->T

Allele Name : Arakawa
Genotype(s) : Not Available
Type(s) : ADR Inferred
Groups : G6PD deficiency
Description : Increased risk of hemolytic anemia.
References :

  1. Eichelbaum M, Evert B: Influence of pharmacogenetics on drug disposition and response. Clin Exp Pharmacol Physiol. 1996 Oct-Nov;23(10-11):983-5. [PubMed:8911746 ]
  2. Diabinese® (chlorpropamide)[package insert]. New York City, New York: Pfizer Labs, Division of Pfizer Inc; 2010. [Link]

PMID: 22493675

Chlorpropamide

By

Chlorpropamide

Product: Ufenamate

Identifier : DBSNPE000937
Drug : DB00672 (Chlorpropamide)
Interacting Gene/Enzyme : Glucose-6-phosphate 1-dehydrogenase
Gene Name : G6PD
UniProt ID : P11413
Defining Change(s) :

  • 1488_1490delGAA

Allele Name : Brighton
Genotype(s) : Not Available
Type(s) : ADR Inferred
Groups : G6PD deficiency
Description : Increased risk of hemolytic anemia.
References :

  1. Eichelbaum M, Evert B: Influence of pharmacogenetics on drug disposition and response. Clin Exp Pharmacol Physiol. 1996 Oct-Nov;23(10-11):983-5. [PubMed:8911746 ]
  2. Diabinese® (chlorpropamide)[package insert]. New York City, New York: Pfizer Labs, Division of Pfizer Inc; 2010. [Link]

PMID: 22791896

Chlorpropamide

By

Chlorpropamide

Product: Nobiletin

Identifier : DBSNPE000938
Drug : DB00672 (Chlorpropamide)
Interacting Gene/Enzyme : Glucose-6-phosphate 1-dehydrogenase
Gene Name : G6PD
UniProt ID : P11413
Defining Change(s) :

  • 159G->C

Allele Name : Kozukata
Genotype(s) : Not Available
Type(s) : ADR Inferred
Groups : G6PD deficiency
Description : Increased risk of hemolytic anemia.
References :

  1. Eichelbaum M, Evert B: Influence of pharmacogenetics on drug disposition and response. Clin Exp Pharmacol Physiol. 1996 Oct-Nov;23(10-11):983-5. [PubMed:8911746 ]
  2. Diabinese® (chlorpropamide)[package insert]. New York City, New York: Pfizer Labs, Division of Pfizer Inc; 2010. [Link]

PMID: 22988910

Chlorpropamide

By

Chlorpropamide

Product: NT157

Identifier : DBSNPE000939
Drug : DB00672 (Chlorpropamide)
Interacting Gene/Enzyme : Glucose-6-phosphate 1-dehydrogenase
Gene Name : G6PD
UniProt ID : P11413
Defining Change(s) :

  • 180_182delTCT

Allele Name : Amsterdam
Genotype(s) : Not Available
Type(s) : ADR Inferred
Groups : G6PD deficiency
Description : Increased risk of hemolytic anemia.
References :

  1. Eichelbaum M, Evert B: Influence of pharmacogenetics on drug disposition and response. Clin Exp Pharmacol Physiol. 1996 Oct-Nov;23(10-11):983-5. [PubMed:8911746 ]
  2. Diabinese® (chlorpropamide)[package insert]. New York City, New York: Pfizer Labs, Division of Pfizer Inc; 2010. [Link]

PMID: 22763448

Chlorpropamide

By

Chlorpropamide

Product: Calcitriol Impurities D

Identifier : DBSNPE000941
Drug : DB00672 (Chlorpropamide)
Interacting Gene/Enzyme : Glucose-6-phosphate 1-dehydrogenase
Gene Name : G6PD
UniProt ID : P11413
Defining Change(s) :

  • 224T->C

Allele Name : Swansea
Genotype(s) : Not Available
Type(s) : ADR Inferred
Groups : G6PD deficiency
Description : Increased risk of hemolytic anemia.
References :

  1. Eichelbaum M, Evert B: Influence of pharmacogenetics on drug disposition and response. Clin Exp Pharmacol Physiol. 1996 Oct-Nov;23(10-11):983-5. [PubMed:8911746 ]
  2. Diabinese® (chlorpropamide)[package insert]. New York City, New York: Pfizer Labs, Division of Pfizer Inc; 2010. [Link]

PMID: 18834954

Chlorpropamide

By

Chlorpropamide

Product: Calcitriol Impurities A

Identifier : DBSNPE000942
Drug : DB00672 (Chlorpropamide)
Interacting Gene/Enzyme : Glucose-6-phosphate 1-dehydrogenase
Gene Name : G6PD
UniProt ID : P11413
Defining Change(s) :

  • 281_283delAGA

Allele Name : Urayasu
Genotype(s) : Not Available
Type(s) : ADR Inferred
Groups : G6PD deficiency
Description : Increased risk of hemolytic anemia.
References :

  1. Eichelbaum M, Evert B: Influence of pharmacogenetics on drug disposition and response. Clin Exp Pharmacol Physiol. 1996 Oct-Nov;23(10-11):983-5. [PubMed:8911746 ]
  2. Diabinese® (chlorpropamide)[package insert]. New York City, New York: Pfizer Labs, Division of Pfizer Inc; 2010. [Link]

PMID: 15889083

Chlorpropamide

By

Chlorpropamide

Product: Calcipotriol Impurity C

Identifier : DBSNPE000943
Drug : DB00672 (Chlorpropamide)
Interacting Gene/Enzyme : Glucose-6-phosphate 1-dehydrogenase
Gene Name : G6PD
UniProt ID : P11413
Defining Change(s) :

  • 317C->G544C->T592C->T

Allele Name : Vancouver
Genotype(s) : Not Available
Type(s) : ADR Inferred
Groups : G6PD deficiency
Description : Increased risk of hemolytic anemia.
References :

  1. Eichelbaum M, Evert B: Influence of pharmacogenetics on drug disposition and response. Clin Exp Pharmacol Physiol. 1996 Oct-Nov;23(10-11):983-5. [PubMed:8911746 ]
  2. Diabinese® (chlorpropamide)[package insert]. New York City, New York: Pfizer Labs, Division of Pfizer Inc; 2010. [Link]

PMID: 14871245

Chlorpropamide

By

Chlorpropamide

Product: alpha-Asarone

Identifier : DBSNPE000944
Drug : DB00672 (Chlorpropamide)
Interacting Gene/Enzyme : Glucose-6-phosphate 1-dehydrogenase
Gene Name : G6PD
UniProt ID : P11413
Defining Change(s) :

  • 376A->G, 1159C->T

Allele Name : Mt Sinai
Genotype(s) : Not Available
Type(s) : ADR Inferred
Groups : G6PD deficiency
Description : Increased risk of hemolytic anemia.
References :

  1. Eichelbaum M, Evert B: Influence of pharmacogenetics on drug disposition and response. Clin Exp Pharmacol Physiol. 1996 Oct-Nov;23(10-11):983-5. [PubMed:8911746 ]
  2. Diabinese® (chlorpropamide)[package insert]. New York City, New York: Pfizer Labs, Division of Pfizer Inc; 2010. [Link]

PMID: 10602697

Chlorpropamide

By

Chlorpropamide

Product: Tenacissoside H

Identifier : DBSNPE000945
Drug : DB00672 (Chlorpropamide)
Interacting Gene/Enzyme : Glucose-6-phosphate 1-dehydrogenase
Gene Name : G6PD
UniProt ID : P11413
Defining Change(s) :

  • 488G->A

Allele Name : Plymouth
Genotype(s) : Not Available
Type(s) : ADR Inferred
Groups : G6PD deficiency
Description : Increased risk of hemolytic anemia.
References :

  1. Eichelbaum M, Evert B: Influence of pharmacogenetics on drug disposition and response. Clin Exp Pharmacol Physiol. 1996 Oct-Nov;23(10-11):983-5. [PubMed:8911746 ]
  2. Diabinese® (chlorpropamide)[package insert]. New York City, New York: Pfizer Labs, Division of Pfizer Inc; 2010. [Link]

PMID: 26368825

Chlorpropamide

By

Chlorpropamide

Product: 3-Bromopyruvic acid

Identifier : DBSNPE000946
Drug : DB00672 (Chlorpropamide)
Interacting Gene/Enzyme : Glucose-6-phosphate 1-dehydrogenase
Gene Name : G6PD
UniProt ID : P11413
Defining Change(s) :

  • 514C->T

Allele Name : Volendam
Genotype(s) : Not Available
Type(s) : ADR Inferred
Groups : G6PD deficiency
Description : Increased risk of hemolytic anemia.
References :

  1. Eichelbaum M, Evert B: Influence of pharmacogenetics on drug disposition and response. Clin Exp Pharmacol Physiol. 1996 Oct-Nov;23(10-11):983-5. [PubMed:8911746 ]
  2. Diabinese® (chlorpropamide)[package insert]. New York City, New York: Pfizer Labs, Division of Pfizer Inc; 2010. [Link]

PMID: 25212830

Chlorpropamide

By

Chlorpropamide

Product: MK-571 (sodium salt)

Identifier : DBSNPE000947
Drug : DB00672 (Chlorpropamide)
Interacting Gene/Enzyme : Glucose-6-phosphate 1-dehydrogenase
Gene Name : G6PD
UniProt ID : P11413
Defining Change(s) :

  • 527A->G

Allele Name : Shinshu
Genotype(s) : Not Available
Type(s) : ADR Inferred
Groups : G6PD deficiency
Description : Increased risk of hemolytic anemia.
References :

  1. Eichelbaum M, Evert B: Influence of pharmacogenetics on drug disposition and response. Clin Exp Pharmacol Physiol. 1996 Oct-Nov;23(10-11):983-5. [PubMed:8911746 ]
  2. Diabinese® (chlorpropamide)[package insert]. New York City, New York: Pfizer Labs, Division of Pfizer Inc; 2010. [Link]

PMID: 24333178

Chlorpropamide

By

Chlorpropamide

Product: LJH685

Identifier : DBSNPE000948
Drug : DB00672 (Chlorpropamide)
Interacting Gene/Enzyme : Glucose-6-phosphate 1-dehydrogenase
Gene Name : G6PD
UniProt ID : P11413
Defining Change(s) :

  • 535A->T

Allele Name : Chikugo
Genotype(s) : Not Available
Type(s) : ADR Inferred
Groups : G6PD deficiency
Description : Increased risk of hemolytic anemia.
References :

  1. Eichelbaum M, Evert B: Influence of pharmacogenetics on drug disposition and response. Clin Exp Pharmacol Physiol. 1996 Oct-Nov;23(10-11):983-5. [PubMed:8911746 ]
  2. Diabinese® (chlorpropamide)[package insert]. New York City, New York: Pfizer Labs, Division of Pfizer Inc; 2010. [Link]

PMID: 23536566

Chlorpropamide

By

Chlorpropamide

Product: Tasimelteon

Identifier : DBSNPE000949
Drug : DB00672 (Chlorpropamide)
Interacting Gene/Enzyme : Glucose-6-phosphate 1-dehydrogenase
Gene Name : G6PD
UniProt ID : P11413
Defining Change(s) :

  • 561_563delCTC

Allele Name : Tsukui
Genotype(s) : Not Available
Type(s) : ADR Inferred
Groups : G6PD deficiency
Description : Increased risk of hemolytic anemia.
References :

  1. Eichelbaum M, Evert B: Influence of pharmacogenetics on drug disposition and response. Clin Exp Pharmacol Physiol. 1996 Oct-Nov;23(10-11):983-5. [PubMed:8911746 ]
  2. Diabinese® (chlorpropamide)[package insert]. New York City, New York: Pfizer Labs, Division of Pfizer Inc; 2010. [Link]

PMID: 21419761

Chlorpropamide

By

Chlorpropamide

Product: Bax inhibitor peptide V5

Identifier : DBSNPE000950
Drug : DB00672 (Chlorpropamide)
Interacting Gene/Enzyme : Glucose-6-phosphate 1-dehydrogenase
Gene Name : G6PD
UniProt ID : P11413
Defining Change(s) :

  • 573C>G

Allele Name : Pedoplis-Ckaro
Genotype(s) : Not Available
Type(s) : ADR Inferred
Groups : G6PD deficiency
Description : Increased risk of hemolytic anemia.
References :

  1. Eichelbaum M, Evert B: Influence of pharmacogenetics on drug disposition and response. Clin Exp Pharmacol Physiol. 1996 Oct-Nov;23(10-11):983-5. [PubMed:8911746 ]
  2. Diabinese® (chlorpropamide)[package insert]. New York City, New York: Pfizer Labs, Division of Pfizer Inc; 2010. [Link]

PMID: 19047154

Chlorpropamide

By

Chlorpropamide

Product: Neuromedin N

Identifier : DBSNPE000951
Drug : DB00672 (Chlorpropamide)
Interacting Gene/Enzyme : Glucose-6-phosphate 1-dehydrogenase
Gene Name : G6PD
UniProt ID : P11413
Defining Change(s) :

  • 593G->C

Allele Name : Santiago
Genotype(s) : Not Available
Type(s) : ADR Inferred
Groups : G6PD deficiency
Description : Increased risk of hemolytic anemia.
References :

  1. Eichelbaum M, Evert B: Influence of pharmacogenetics on drug disposition and response. Clin Exp Pharmacol Physiol. 1996 Oct-Nov;23(10-11):983-5. [PubMed:8911746 ]
  2. Diabinese® (chlorpropamide)[package insert]. New York City, New York: Pfizer Labs, Division of Pfizer Inc; 2010. [Link]

PMID: 10945623

Chlorpropamide

By

Chlorpropamide

Product: TRAP-6

Identifier : DBSNPE000952
Drug : DB00672 (Chlorpropamide)
Interacting Gene/Enzyme : Glucose-6-phosphate 1-dehydrogenase
Gene Name : G6PD
UniProt ID : P11413
Defining Change(s) :

  • 637G->T

Allele Name : Minnesota, Marion, Gastonia, LeJeune
Genotype(s) : Not Available
Type(s) : ADR Inferred
Groups : G6PD deficiency
Description : Increased risk of hemolytic anemia.
References :

  1. Eichelbaum M, Evert B: Influence of pharmacogenetics on drug disposition and response. Clin Exp Pharmacol Physiol. 1996 Oct-Nov;23(10-11):983-5. [PubMed:8911746 ]
  2. Diabinese® (chlorpropamide)[package insert]. New York City, New York: Pfizer Labs, Division of Pfizer Inc; 2010. [Link]

PMID: 23421678

Chlorpropamide

By

Chlorpropamide

Product: Sodium lauryl polyoxyethylene ether sulfate

Identifier : DBSNPE000953
Drug : DB00672 (Chlorpropamide)
Interacting Gene/Enzyme : Glucose-6-phosphate 1-dehydrogenase
Gene Name : G6PD
UniProt ID : P11413
Defining Change(s) :

  • 637G->T, 1037A->T

Allele Name : Cincinnati
Genotype(s) : Not Available
Type(s) : ADR Inferred
Groups : G6PD deficiency
Description : Increased risk of hemolytic anemia.
References :

  1. Eichelbaum M, Evert B: Influence of pharmacogenetics on drug disposition and response. Clin Exp Pharmacol Physiol. 1996 Oct-Nov;23(10-11):983-5. [PubMed:8911746 ]
  2. Diabinese® (chlorpropamide)[package insert]. New York City, New York: Pfizer Labs, Division of Pfizer Inc; 2010. [Link]

PMID: 20153646

Chlorpropamide

By

Chlorpropamide

Product: BML-284

Identifier : DBSNPE000954
Drug : DB00672 (Chlorpropamide)
Interacting Gene/Enzyme : Glucose-6-phosphate 1-dehydrogenase
Gene Name : G6PD
UniProt ID : P11413
Defining Change(s) :

  • 648T->G

Allele Name : Harilaou
Genotype(s) : Not Available
Type(s) : ADR Inferred
Groups : G6PD deficiency
Description : Increased risk of hemolytic anemia.
References :

  1. Eichelbaum M, Evert B: Influence of pharmacogenetics on drug disposition and response. Clin Exp Pharmacol Physiol. 1996 Oct-Nov;23(10-11):983-5. [PubMed:8911746 ]
  2. Diabinese® (chlorpropamide)[package insert]. New York City, New York: Pfizer Labs, Division of Pfizer Inc; 2010. [Link]

PMID: 18824607

Chlorpropamide

By

Chlorpropamide

Product: Rapastinel

Identifier : DBSNPE000956
Drug : DB00672 (Chlorpropamide)
Interacting Gene/Enzyme : Glucose-6-phosphate 1-dehydrogenase
Gene Name : G6PD
UniProt ID : P11413
Defining Change(s) :

  • 695G->A

Allele Name : Asahikawa
Genotype(s) : Not Available
Type(s) : ADR Inferred
Groups : G6PD deficiency
Description : Increased risk of hemolytic anemia.
References :

  1. Eichelbaum M, Evert B: Influence of pharmacogenetics on drug disposition and response. Clin Exp Pharmacol Physiol. 1996 Oct-Nov;23(10-11):983-5. [PubMed:8911746 ]
  2. Diabinese® (chlorpropamide)[package insert]. New York City, New York: Pfizer Labs, Division of Pfizer Inc; 2010. [Link]

PMID: 17200363

Chlorpropamide

By

Chlorpropamide

Product: BMS-687453

Identifier : DBSNPE000957
Drug : DB00672 (Chlorpropamide)
Interacting Gene/Enzyme : Glucose-6-phosphate 1-dehydrogenase
Gene Name : G6PD
UniProt ID : P11413
Defining Change(s) :

  • 713A->G

Allele Name : Durham
Genotype(s) : Not Available
Type(s) : ADR Inferred
Groups : G6PD deficiency
Description : Increased risk of hemolytic anemia.
References :

  1. Eichelbaum M, Evert B: Influence of pharmacogenetics on drug disposition and response. Clin Exp Pharmacol Physiol. 1996 Oct-Nov;23(10-11):983-5. [PubMed:8911746 ]
  2. Diabinese® (chlorpropamide)[package insert]. New York City, New York: Pfizer Labs, Division of Pfizer Inc; 2010. [Link]

PMID: 16580199

Chlorpropamide

By

Chlorpropamide

Product: Danirixin

Identifier : DBSNPE000958
Drug : DB00672 (Chlorpropamide)
Interacting Gene/Enzyme : Glucose-6-phosphate 1-dehydrogenase
Gene Name : G6PD
UniProt ID : P11413
Defining Change(s) :

  • 724_729delGGCACT

Allele Name : Stonybrook
Genotype(s) : Not Available
Type(s) : ADR Inferred
Groups : G6PD deficiency
Description : Increased risk of hemolytic anemia.
References :

  1. Eichelbaum M, Evert B: Influence of pharmacogenetics on drug disposition and response. Clin Exp Pharmacol Physiol. 1996 Oct-Nov;23(10-11):983-5. [PubMed:8911746 ]
  2. Diabinese® (chlorpropamide)[package insert]. New York City, New York: Pfizer Labs, Division of Pfizer Inc; 2010. [Link]

PMID: 25686603

Chlorpropamide

By

Chlorpropamide

Product: CH5183284

Identifier : DBSNPE000959
Drug : DB00672 (Chlorpropamide)
Interacting Gene/Enzyme : Glucose-6-phosphate 1-dehydrogenase
Gene Name : G6PD
UniProt ID : P11413
Defining Change(s) :

  • 769C->G

Allele Name : Wayne
Genotype(s) : Not Available
Type(s) : ADR Inferred
Groups : G6PD deficiency
Description : Increased risk of hemolytic anemia.
References :

  1. Eichelbaum M, Evert B: Influence of pharmacogenetics on drug disposition and response. Clin Exp Pharmacol Physiol. 1996 Oct-Nov;23(10-11):983-5. [PubMed:8911746 ]
  2. Diabinese® (chlorpropamide)[package insert]. New York City, New York: Pfizer Labs, Division of Pfizer Inc; 2010. [Link]

PMID: 19010843

Chlorpropamide

By

Chlorpropamide

Product: SNG-1153

Identifier : DBSNPE000960
Drug : DB00672 (Chlorpropamide)
Interacting Gene/Enzyme : Glucose-6-phosphate 1-dehydrogenase
Gene Name : G6PD
UniProt ID : P11413
Defining Change(s) :

  • 806G->A

Allele Name : Aveiro
Genotype(s) : Not Available
Type(s) : ADR Inferred
Groups : G6PD deficiency
Description : Increased risk of hemolytic anemia.
References :

  1. Eichelbaum M, Evert B: Influence of pharmacogenetics on drug disposition and response. Clin Exp Pharmacol Physiol. 1996 Oct-Nov;23(10-11):983-5. [PubMed:8911746 ]
  2. Diabinese® (chlorpropamide)[package insert]. New York City, New York: Pfizer Labs, Division of Pfizer Inc; 2010. [Link]

PMID: 18202011

Chlorpropamide

By

Chlorpropamide

Product: Digitoxin

Identifier : DBSNPE000961
Drug : DB00672 (Chlorpropamide)
Interacting Gene/Enzyme : Glucose-6-phosphate 1-dehydrogenase
Gene Name : G6PD
UniProt ID : P11413
Defining Change(s) :

  • 820G->A

Allele Name : Cleveland Corum
Genotype(s) : Not Available
Type(s) : ADR Inferred
Groups : G6PD deficiency
Description : Increased risk of hemolytic anemia.
References :

  1. Eichelbaum M, Evert B: Influence of pharmacogenetics on drug disposition and response. Clin Exp Pharmacol Physiol. 1996 Oct-Nov;23(10-11):983-5. [PubMed:8911746 ]
  2. Diabinese® (chlorpropamide)[package insert]. New York City, New York: Pfizer Labs, Division of Pfizer Inc; 2010. [Link]

PMID: 23963178

Chlorpropamide

By

Chlorpropamide

Product: KM11060

Identifier : DBSNPE000963
Drug : DB00672 (Chlorpropamide)
Interacting Gene/Enzyme : Glucose-6-phosphate 1-dehydrogenase
Gene Name : G6PD
UniProt ID : P11413
Defining Change(s) :

  • 825G>C

Allele Name : Bangkok
Genotype(s) : Not Available
Type(s) : ADR Inferred
Groups : G6PD deficiency
Description : Increased risk of hemolytic anemia.
References :

  1. Eichelbaum M, Evert B: Influence of pharmacogenetics on drug disposition and response. Clin Exp Pharmacol Physiol. 1996 Oct-Nov;23(10-11):983-5. [PubMed:8911746 ]
  2. Diabinese® (chlorpropamide)[package insert]. New York City, New York: Pfizer Labs, Division of Pfizer Inc; 2010. [Link]

PMID: 12443771

Chlorpropamide

By

Chlorpropamide

Product: Halofuginone

Identifier : DBSNPE000964
Drug : DB00672 (Chlorpropamide)
Interacting Gene/Enzyme : Glucose-6-phosphate 1-dehydrogenase
Gene Name : G6PD
UniProt ID : P11413
Defining Change(s) :

  • 826C->T

Allele Name : Sugao
Genotype(s) : Not Available
Type(s) : ADR Inferred
Groups : G6PD deficiency
Description : Increased risk of hemolytic anemia.
References :

  1. Eichelbaum M, Evert B: Influence of pharmacogenetics on drug disposition and response. Clin Exp Pharmacol Physiol. 1996 Oct-Nov;23(10-11):983-5. [PubMed:8911746 ]
  2. Diabinese® (chlorpropamide)[package insert]. New York City, New York: Pfizer Labs, Division of Pfizer Inc; 2010. [Link]

PMID: 21359402

Chlorpropamide

By

Chlorpropamide

Product: Oleandrin

Identifier : DBSNPE000965
Drug : DB00672 (Chlorpropamide)
Interacting Gene/Enzyme : Glucose-6-phosphate 1-dehydrogenase
Gene Name : G6PD
UniProt ID : P11413
Defining Change(s) :

  • 832T->C

Allele Name : La Jolla
Genotype(s) : Not Available
Type(s) : ADR Inferred
Groups : G6PD deficiency
Description : Increased risk of hemolytic anemia.
References :

  1. Eichelbaum M, Evert B: Influence of pharmacogenetics on drug disposition and response. Clin Exp Pharmacol Physiol. 1996 Oct-Nov;23(10-11):983-5. [PubMed:8911746 ]
  2. Diabinese® (chlorpropamide)[package insert]. New York City, New York: Pfizer Labs, Division of Pfizer Inc; 2010. [Link]

PMID: 15743179

Chlorpropamide

By

Chlorpropamide

Product: EPZ020411 (hydrochloride)

Identifier : DBSNPE000966
Drug : DB00672 (Chlorpropamide)
Interacting Gene/Enzyme : Glucose-6-phosphate 1-dehydrogenase
Gene Name : G6PD
UniProt ID : P11413
Defining Change(s) :

  • 833C->T

Allele Name : Wexham
Genotype(s) : Not Available
Type(s) : ADR Inferred
Groups : G6PD deficiency
Description : Increased risk of hemolytic anemia.
References :

  1. Eichelbaum M, Evert B: Influence of pharmacogenetics on drug disposition and response. Clin Exp Pharmacol Physiol. 1996 Oct-Nov;23(10-11):983-5. [PubMed:8911746 ]
  2. Diabinese® (chlorpropamide)[package insert]. New York City, New York: Pfizer Labs, Division of Pfizer Inc; 2010. [Link]

PMID: 21306896

Chlorpropamide

By

Chlorpropamide

Product: YM-90709

Identifier : DBSNPE000967
Drug : DB00672 (Chlorpropamide)
Interacting Gene/Enzyme : Glucose-6-phosphate 1-dehydrogenase
Gene Name : G6PD
UniProt ID : P11413
Defining Change(s) :

  • 851T>C

Allele Name : Piodivkow
Genotype(s) : Not Available
Type(s) : ADR Inferred
Groups : G6PD deficiency
Description : Increased risk of hemolytic anemia.
References :

  1. Eichelbaum M, Evert B: Influence of pharmacogenetics on drug disposition and response. Clin Exp Pharmacol Physiol. 1996 Oct-Nov;23(10-11):983-5. [PubMed:8911746 ]
  2. Diabinese® (chlorpropamide)[package insert]. New York City, New York: Pfizer Labs, Division of Pfizer Inc; 2010. [Link]

PMID: 10037737

Chlorpropamide

By

Chlorpropamide

Product: Seco Rapamycin (sodium salt)

Identifier : DBSNPE000968
Drug : DB00672 (Chlorpropamide)
Interacting Gene/Enzyme : Glucose-6-phosphate 1-dehydrogenase
Gene Name : G6PD
UniProt ID : P11413
Defining Change(s) :

  • 910G->T

Allele Name : West Virginia
Genotype(s) : Not Available
Type(s) : ADR Inferred
Groups : G6PD deficiency
Description : Increased risk of hemolytic anemia.
References :

  1. Eichelbaum M, Evert B: Influence of pharmacogenetics on drug disposition and response. Clin Exp Pharmacol Physiol. 1996 Oct-Nov;23(10-11):983-5. [PubMed:8911746 ]
  2. Diabinese® (chlorpropamide)[package insert]. New York City, New York: Pfizer Labs, Division of Pfizer Inc; 2010. [Link]

PMID: 9651163

Chlorpropamide

By

Chlorpropamide

Product: BMS-191095

Identifier : DBSNPE000969
Drug : DB00672 (Chlorpropamide)
Interacting Gene/Enzyme : Glucose-6-phosphate 1-dehydrogenase
Gene Name : G6PD
UniProt ID : P11413
Defining Change(s) :

  • 921G->C

Allele Name : Omiya
Genotype(s) : Not Available
Type(s) : ADR Inferred
Groups : G6PD deficiency
Description : Increased risk of hemolytic anemia.
References :

  1. Eichelbaum M, Evert B: Influence of pharmacogenetics on drug disposition and response. Clin Exp Pharmacol Physiol. 1996 Oct-Nov;23(10-11):983-5. [PubMed:8911746 ]
  2. Diabinese® (chlorpropamide)[package insert]. New York City, New York: Pfizer Labs, Division of Pfizer Inc; 2010. [Link]

PMID: 9920285

Chlorpropamide

By

Chlorpropamide

Product: Thiazole Orange

Identifier : DBSNPE000970
Drug : DB00672 (Chlorpropamide)
Interacting Gene/Enzyme : Glucose-6-phosphate 1-dehydrogenase
Gene Name : G6PD
UniProt ID : P11413
Defining Change(s) :

  • 953_976delCCACCAAAGGGTACCTGGAC GACC

Allele Name : Nara
Genotype(s) : Not Available
Type(s) : ADR Inferred
Groups : G6PD deficiency
Description : Increased risk of hemolytic anemia.
References :

  1. Eichelbaum M, Evert B: Influence of pharmacogenetics on drug disposition and response. Clin Exp Pharmacol Physiol. 1996 Oct-Nov;23(10-11):983-5. [PubMed:8911746 ]
  2. Diabinese® (chlorpropamide)[package insert]. New York City, New York: Pfizer Labs, Division of Pfizer Inc; 2010. [Link]

PMID: 20657775

Chlorpropamide

By

Chlorpropamide

Product: RN-1734

Identifier : DBSNPE000971
Drug : DB00672 (Chlorpropamide)
Interacting Gene/Enzyme : Glucose-6-phosphate 1-dehydrogenase
Gene Name : G6PD
UniProt ID : P11413
Defining Change(s) :

  • 962G->A

Allele Name : Manhattan
Genotype(s) : Not Available
Type(s) : ADR Inferred
Groups : G6PD deficiency
Description : Increased risk of hemolytic anemia.
References :

  1. Eichelbaum M, Evert B: Influence of pharmacogenetics on drug disposition and response. Clin Exp Pharmacol Physiol. 1996 Oct-Nov;23(10-11):983-5. [PubMed:8911746 ]
  2. Diabinese® (chlorpropamide)[package insert]. New York City, New York: Pfizer Labs, Division of Pfizer Inc; 2010. [Link]

PMID: 10639280

Chlorpropamide

By

Chlorpropamide

Product: K858

Identifier : DBSNPE000972
Drug : DB00672 (Chlorpropamide)
Interacting Gene/Enzyme : Glucose-6-phosphate 1-dehydrogenase
Gene Name : G6PD
UniProt ID : P11413
Defining Change(s) :

  • 964T->C

Allele Name : Rehevot
Genotype(s) : Not Available
Type(s) : ADR Inferred
Groups : G6PD deficiency
Description : Increased risk of hemolytic anemia.
References :

  1. Eichelbaum M, Evert B: Influence of pharmacogenetics on drug disposition and response. Clin Exp Pharmacol Physiol. 1996 Oct-Nov;23(10-11):983-5. [PubMed:8911746 ]
  2. Diabinese® (chlorpropamide)[package insert]. New York City, New York: Pfizer Labs, Division of Pfizer Inc; 2010. [Link]

PMID: 25788671

Chlorpropamide

By

Chlorpropamide

Product: Potassium clavulanate cellulose

Identifier : DBSNPE000973
Drug : DB00672 (Chlorpropamide)
Interacting Gene/Enzyme : Glucose-6-phosphate 1-dehydrogenase
Gene Name : G6PD
UniProt ID : P11413
Defining Change(s) :

  • 99A->G
  • 1360C->T

Allele Name : Honiara
Genotype(s) : Not Available
Type(s) : ADR Inferred
Groups : G6PD deficiency
Description : Increased risk of hemolytic anemia.
References :

  1. Eichelbaum M, Evert B: Influence of pharmacogenetics on drug disposition and response. Clin Exp Pharmacol Physiol. 1996 Oct-Nov;23(10-11):983-5. [PubMed:8911746 ]
  2. Diabinese® (chlorpropamide)[package insert]. New York City, New York: Pfizer Labs, Division of Pfizer Inc; 2010. [Link]

PMID: 14626450

Chlorpropamide

By

Chlorpropamide

Product: Mirin

Identifier : DBSNPE000974
Drug : DB00672 (Chlorpropamide)
Interacting Gene/Enzyme : Glucose-6-phosphate 1-dehydrogenase
Gene Name : G6PD
UniProt ID : P11413
Defining Change(s) :

  • 1246G->A

Allele Name : Tokyo, Fukushima
Genotype(s) : Not Available
Type(s) : ADR Inferred
Groups : G6PD deficiency
Description : Increased risk of hemolytic anemia.
References :

  1. Eichelbaum M, Evert B: Influence of pharmacogenetics on drug disposition and response. Clin Exp Pharmacol Physiol. 1996 Oct-Nov;23(10-11):983-5. [PubMed:8911746 ]
  2. Diabinese® (chlorpropamide)[package insert]. New York City, New York: Pfizer Labs, Division of Pfizer Inc; 2010. [Link]

PMID: 12483548

Chlorpropamide

By

Chlorpropamide

Product: 3PO

Identifier : DBSNPE000975
Drug : DB00672 (Chlorpropamide)
Interacting Gene/Enzyme : Glucose-6-phosphate 1-dehydrogenase
Gene Name : G6PD
UniProt ID : P11413
Defining Change(s) :

  • 1003G->A

Allele Name : Chatham
Genotype(s) : Not Available
Type(s) : ADR Inferred
Groups : G6PD deficiency
Description : Increased risk of hemolytic anemia.
References :

  1. Eichelbaum M, Evert B: Influence of pharmacogenetics on drug disposition and response. Clin Exp Pharmacol Physiol. 1996 Oct-Nov;23(10-11):983-5. [PubMed:8911746 ]
  2. Diabinese® (chlorpropamide)[package insert]. New York City, New York: Pfizer Labs, Division of Pfizer Inc; 2010. [Link]

PMID: 25222747

Chlorpropamide

By

Chlorpropamide

Product: (+)-Bicuculline

Identifier : DBSNPE000976
Drug : DB00672 (Chlorpropamide)
Interacting Gene/Enzyme : Glucose-6-phosphate 1-dehydrogenase
Gene Name : G6PD
UniProt ID : P11413
Defining Change(s) :

  • 1004C->A

Allele Name : Fushan
Genotype(s) : Not Available
Type(s) : ADR Inferred
Groups : G6PD deficiency
Description : Increased risk of hemolytic anemia.
References :

  1. Eichelbaum M, Evert B: Influence of pharmacogenetics on drug disposition and response. Clin Exp Pharmacol Physiol. 1996 Oct-Nov;23(10-11):983-5. [PubMed:8911746 ]
  2. Diabinese® (chlorpropamide)[package insert]. New York City, New York: Pfizer Labs, Division of Pfizer Inc; 2010. [Link]

PMID: 21423276

Chlorpropamide

By

Chlorpropamide

Product: Tangeretin

Identifier : DBSNPE000977
Drug : DB00672 (Chlorpropamide)
Interacting Gene/Enzyme : Glucose-6-phosphate 1-dehydrogenase
Gene Name : G6PD
UniProt ID : P11413
Defining Change(s) :

  • 1052G->T

Allele Name : Partenope
Genotype(s) : Not Available
Type(s) : ADR Inferred
Groups : G6PD deficiency
Description : Increased risk of hemolytic anemia.
References :

  1. Eichelbaum M, Evert B: Influence of pharmacogenetics on drug disposition and response. Clin Exp Pharmacol Physiol. 1996 Oct-Nov;23(10-11):983-5. [PubMed:8911746 ]
  2. Diabinese® (chlorpropamide)[package insert]. New York City, New York: Pfizer Labs, Division of Pfizer Inc; 2010. [Link]

PMID: 20671228

Chlorpropamide

By

Chlorpropamide

Product: Hematoporphyrin (dihydrochloride)

Identifier : DBSNPE000978
Drug : DB00672 (Chlorpropamide)
Interacting Gene/Enzyme : Glucose-6-phosphate 1-dehydrogenase
Gene Name : G6PD
UniProt ID : P11413
Defining Change(s) :

  • 1057C->T

Allele Name : Ierapediva
Genotype(s) : Not Available
Type(s) : ADR Inferred
Groups : G6PD deficiency
Description : Increased risk of hemolytic anemia.
References :

  1. Eichelbaum M, Evert B: Influence of pharmacogenetics on drug disposition and response. Clin Exp Pharmacol Physiol. 1996 Oct-Nov;23(10-11):983-5. [PubMed:8911746 ]
  2. Diabinese® (chlorpropamide)[package insert]. New York City, New York: Pfizer Labs, Division of Pfizer Inc; 2010. [Link]

PMID: 20625401

Chlorpropamide

By

Chlorpropamide

Product: XEN907

Identifier : DBSNPE000979
Drug : DB00672 (Chlorpropamide)
Interacting Gene/Enzyme : Glucose-6-phosphate 1-dehydrogenase
Gene Name : G6PD
UniProt ID : P11413
Defining Change(s) :

  • 1193A->G

Allele Name : Anadia
Genotype(s) : Not Available
Type(s) : ADR Inferred
Groups : G6PD deficiency
Description : Increased risk of hemolytic anemia.
References :

  1. Eichelbaum M, Evert B: Influence of pharmacogenetics on drug disposition and response. Clin Exp Pharmacol Physiol. 1996 Oct-Nov;23(10-11):983-5. [PubMed:8911746 ]
  2. Diabinese® (chlorpropamide)[package insert]. New York City, New York: Pfizer Labs, Division of Pfizer Inc; 2010. [Link]

PMID: 26804163

Chlorpropamide

By

Chlorpropamide

Product: SID 3712249

Identifier : DBSNPE000980
Drug : DB00672 (Chlorpropamide)
Interacting Gene/Enzyme : Glucose-6-phosphate 1-dehydrogenase
Gene Name : G6PD
UniProt ID : P11413
Defining Change(s) :

  • 1220A->C

Allele Name : Abeno
Genotype(s) : Not Available
Type(s) : ADR Inferred
Groups : G6PD deficiency
Description : Increased risk of hemolytic anemia.
References :

  1. Eichelbaum M, Evert B: Influence of pharmacogenetics on drug disposition and response. Clin Exp Pharmacol Physiol. 1996 Oct-Nov;23(10-11):983-5. [PubMed:8911746 ]
  2. Diabinese® (chlorpropamide)[package insert]. New York City, New York: Pfizer Labs, Division of Pfizer Inc; 2010. [Link]

PMID: 26755653

Chlorpropamide

By

Chlorpropamide

Product: Antibiotic-202

Identifier : DBSNPE000981
Drug : DB00672 (Chlorpropamide)
Interacting Gene/Enzyme : Glucose-6-phosphate 1-dehydrogenase
Gene Name : G6PD
UniProt ID : P11413
Defining Change(s) :

  • 1291G->A

Allele Name : Surabaya
Genotype(s) : Not Available
Type(s) : ADR Inferred
Groups : G6PD deficiency
Description : Increased risk of hemolytic anemia.
References :

  1. Eichelbaum M, Evert B: Influence of pharmacogenetics on drug disposition and response. Clin Exp Pharmacol Physiol. 1996 Oct-Nov;23(10-11):983-5. [PubMed:8911746 ]
  2. Diabinese® (chlorpropamide)[package insert]. New York City, New York: Pfizer Labs, Division of Pfizer Inc; 2010. [Link]

PMID: 20151671

Chlorpropamide

By

Chlorpropamide

Product: PF-04929113 (Mesylate)

Identifier : DBSNPE000982
Drug : DB00672 (Chlorpropamide)
Interacting Gene/Enzyme : Glucose-6-phosphate 1-dehydrogenase
Gene Name : G6PD
UniProt ID : P11413
Defining Change(s) :

  • 1316G->C

Allele Name : Pawnee
Genotype(s) : Not Available
Type(s) : ADR Inferred
Groups : G6PD deficiency
Description : Increased risk of hemolytic anemia.
References :

  1. Eichelbaum M, Evert B: Influence of pharmacogenetics on drug disposition and response. Clin Exp Pharmacol Physiol. 1996 Oct-Nov;23(10-11):983-5. [PubMed:8911746 ]
  2. Diabinese® (chlorpropamide)[package insert]. New York City, New York: Pfizer Labs, Division of Pfizer Inc; 2010. [Link]

PMID: 24033337

Chlorpropamide

By

Chlorpropamide

Product: KIN1408

Identifier : DBSNPE000983
Drug : DB00672 (Chlorpropamide)
Interacting Gene/Enzyme : Glucose-6-phosphate 1-dehydrogenase
Gene Name : G6PD
UniProt ID : P11413
Defining Change(s) :

  • 1342A->G

Allele Name : S. Antioco
Genotype(s) : Not Available
Type(s) : ADR Inferred
Groups : G6PD deficiency
Description : Increased risk of hemolytic anemia.
References :

  1. Eichelbaum M, Evert B: Influence of pharmacogenetics on drug disposition and response. Clin Exp Pharmacol Physiol. 1996 Oct-Nov;23(10-11):983-5. [PubMed:8911746 ]
  2. Diabinese® (chlorpropamide)[package insert]. New York City, New York: Pfizer Labs, Division of Pfizer Inc; 2010. [Link]

PMID: 24278362

Chlorpropamide

By

Chlorpropamide

Product: BCTC

Identifier : DBSNPE000984
Drug : DB00672 (Chlorpropamide)
Interacting Gene/Enzyme : Glucose-6-phosphate 1-dehydrogenase
Gene Name : G6PD
UniProt ID : P11413
Defining Change(s) :

  • 1347G->C

Allele Name : Cassano
Genotype(s) : Not Available
Type(s) : ADR Inferred
Groups : G6PD deficiency
Description : Increased risk of hemolytic anemia.
References :

  1. Eichelbaum M, Evert B: Influence of pharmacogenetics on drug disposition and response. Clin Exp Pharmacol Physiol. 1996 Oct-Nov;23(10-11):983-5. [PubMed:8911746 ]
  2. Diabinese® (chlorpropamide)[package insert]. New York City, New York: Pfizer Labs, Division of Pfizer Inc; 2010. [Link]

PMID: 7903353

Chlorpropamide

By

Chlorpropamide

Product: Pleconaril

Identifier : DBSNPE000985
Drug : DB00672 (Chlorpropamide)
Interacting Gene/Enzyme : Glucose-6-phosphate 1-dehydrogenase
Gene Name : G6PD
UniProt ID : P11413
Defining Change(s) :

  • 1347G->C
  • 1360C->T

Allele Name : Hermoupolis
Genotype(s) : Not Available
Type(s) : ADR Inferred
Groups : G6PD deficiency
Description : Increased risk of hemolytic anemia.
References :

  1. Eichelbaum M, Evert B: Influence of pharmacogenetics on drug disposition and response. Clin Exp Pharmacol Physiol. 1996 Oct-Nov;23(10-11):983-5. [PubMed:8911746 ]
  2. Diabinese® (chlorpropamide)[package insert]. New York City, New York: Pfizer Labs, Division of Pfizer Inc; 2010. [Link]

PMID: 73185

Chlorpropamide

By

Chlorpropamide

Product: DAA-1106

Identifier : DBSNPE000986
Drug : DB00672 (Chlorpropamide)
Interacting Gene/Enzyme : Glucose-6-phosphate 1-dehydrogenase
Gene Name : G6PD
UniProt ID : P11413
Defining Change(s) :

  • 1360C->T

Allele Name : Union,Maewo, Chinese-2, Kalo
Genotype(s) : Not Available
Type(s) : ADR Inferred
Groups : G6PD deficiency
Description : Increased risk of hemolytic anemia.
References :

  1. Eichelbaum M, Evert B: Influence of pharmacogenetics on drug disposition and response. Clin Exp Pharmacol Physiol. 1996 Oct-Nov;23(10-11):983-5. [PubMed:8911746 ]
  2. Diabinese® (chlorpropamide)[package insert]. New York City, New York: Pfizer Labs, Division of Pfizer Inc; 2010. [Link]

PMID: 22277057

Chlorpropamide

By

Chlorpropamide

Product: Dimethylenastron

Identifier : DBSNPE000987
Drug : DB00672 (Chlorpropamide)
Interacting Gene/Enzyme : Glucose-6-phosphate 1-dehydrogenase
Gene Name : G6PD
UniProt ID : P11413
Defining Change(s) :

  • 1361G->A

Allele Name : Andalus
Genotype(s) : Not Available
Type(s) : ADR Inferred
Groups : G6PD deficiency
Description : Increased risk of hemolytic anemia.
References :

  1. Eichelbaum M, Evert B: Influence of pharmacogenetics on drug disposition and response. Clin Exp Pharmacol Physiol. 1996 Oct-Nov;23(10-11):983-5. [PubMed:8911746 ]
  2. Diabinese® (chlorpropamide)[package insert]. New York City, New York: Pfizer Labs, Division of Pfizer Inc; 2010. [Link]

PMID: 23881501

Chlorpropamide

By

Chlorpropamide

Product: MS023

Identifier : DBSNPE000988
Drug : DB00672 (Chlorpropamide)
Interacting Gene/Enzyme : Glucose-6-phosphate 1-dehydrogenase
Gene Name : G6PD
UniProt ID : P11413
Defining Change(s) :

  • 1376G->C

Allele Name : Cosenza
Genotype(s) : Not Available
Type(s) : ADR Inferred
Groups : G6PD deficiency
Description : Increased risk of hemolytic anemia.
References :

  1. Eichelbaum M, Evert B: Influence of pharmacogenetics on drug disposition and response. Clin Exp Pharmacol Physiol. 1996 Oct-Nov;23(10-11):983-5. [PubMed:8911746 ]
  2. Diabinese® (chlorpropamide)[package insert]. New York City, New York: Pfizer Labs, Division of Pfizer Inc; 2010. [Link]

PMID: 23977224

Chlorpropamide

By

Chlorpropamide

Product: Endoxifen (E-isomer hydrochloride)

Identifier : DBSNPE000989
Drug : DB00672 (Chlorpropamide)
Interacting Gene/Enzyme : Glucose-6-phosphate 1-dehydrogenase
Gene Name : G6PD
UniProt ID : P11413
Defining Change(s) :

  • 1376G->T

Allele Name : Canton, Taiwan- Hakka, Gifu-like, Agrigento-like
Genotype(s) : Not Available
Type(s) : ADR Inferred
Groups : G6PD deficiency
Description : Increased risk of hemolytic anemia.
References :

  1. Eichelbaum M, Evert B: Influence of pharmacogenetics on drug disposition and response. Clin Exp Pharmacol Physiol. 1996 Oct-Nov;23(10-11):983-5. [PubMed:8911746 ]
  2. Diabinese® (chlorpropamide)[package insert]. New York City, New York: Pfizer Labs, Division of Pfizer Inc; 2010. [Link]

PMID: 20105183

Chlorpropamide

By

Chlorpropamide

Product: GTS-21 (dihydrochloride)

Identifier : DBSNPE000990
Drug : DB00672 (Chlorpropamide)
Interacting Gene/Enzyme : Glucose-6-phosphate 1-dehydrogenase
Gene Name : G6PD
UniProt ID : P11413
Defining Change(s) :

  • 1387C->A

Allele Name : Flores
Genotype(s) : Not Available
Type(s) : ADR Inferred
Groups : G6PD deficiency
Description : Increased risk of hemolytic anemia.
References :

  1. Eichelbaum M, Evert B: Influence of pharmacogenetics on drug disposition and response. Clin Exp Pharmacol Physiol. 1996 Oct-Nov;23(10-11):983-5. [PubMed:8911746 ]
  2. Diabinese® (chlorpropamide)[package insert]. New York City, New York: Pfizer Labs, Division of Pfizer Inc; 2010. [Link]

PMID: 24328216

Chlorpropamide

By

Chlorpropamide

Product: Ansamitocin P 3

Identifier : DBSNPE000991
Drug : DB00672 (Chlorpropamide)
Interacting Gene/Enzyme : Glucose-6-phosphate 1-dehydrogenase
Gene Name : G6PD
UniProt ID : P11413
Defining Change(s) :

  • 1388G->A

Allele Name : Kaiping, Anant, Dhon, Sapporo-like, Wosera
Genotype(s) : Not Available
Type(s) : ADR Inferred
Groups : G6PD deficiency
Description : Increased risk of hemolytic anemia.
References :

  1. Eichelbaum M, Evert B: Influence of pharmacogenetics on drug disposition and response. Clin Exp Pharmacol Physiol. 1996 Oct-Nov;23(10-11):983-5. [PubMed:8911746 ]
  2. Diabinese® (chlorpropamide)[package insert]. New York City, New York: Pfizer Labs, Division of Pfizer Inc; 2010. [Link]

PMID: 24753407

Chlorpropamide

By

Chlorpropamide

Product: JNJ-63533054

Identifier : DBSNPE000992
Drug : DB00672 (Chlorpropamide)
Interacting Gene/Enzyme : Glucose-6-phosphate 1-dehydrogenase
Gene Name : G6PD
UniProt ID : P11413
Defining Change(s) :

  • 169C->T

Allele Name : Kamogawa
Genotype(s) : Not Available
Type(s) : ADR Inferred
Groups : G6PD deficiency
Description : Increased risk of hemolytic anemia.
References :

  1. Eichelbaum M, Evert B: Influence of pharmacogenetics on drug disposition and response. Clin Exp Pharmacol Physiol. 1996 Oct-Nov;23(10-11):983-5. [PubMed:8911746 ]
  2. Diabinese® (chlorpropamide)[package insert]. New York City, New York: Pfizer Labs, Division of Pfizer Inc; 2010. [Link]

PMID: 23157641

Chlorpropamide

By

Chlorpropamide

Product: NAN-190 (hydrobromide)

Identifier : DBSNPE000993
Drug : DB00672 (Chlorpropamide)
Interacting Gene/Enzyme : Glucose-6-phosphate 1-dehydrogenase
Gene Name : G6PD
UniProt ID : P11413
Defining Change(s) :

  • 179T>C

Allele Name : Costanzo
Genotype(s) : Not Available
Type(s) : ADR Inferred
Groups : G6PD deficiency
Description : Increased risk of hemolytic anemia.
References :

  1. Eichelbaum M, Evert B: Influence of pharmacogenetics on drug disposition and response. Clin Exp Pharmacol Physiol. 1996 Oct-Nov;23(10-11):983-5. [PubMed:8911746 ]
  2. Diabinese® (chlorpropamide)[package insert]. New York City, New York: Pfizer Labs, Division of Pfizer Inc; 2010. [Link]

PMID: 348301

Chlorpropamide

By

Chlorpropamide

Product: ILK-IN-2

Identifier : DBSNPE000994
Drug : DB00672 (Chlorpropamide)
Interacting Gene/Enzyme : Glucose-6-phosphate 1-dehydrogenase
Gene Name : G6PD
UniProt ID : P11413
Defining Change(s) :

  • 185C->A

Allele Name : Amazonia
Genotype(s) : Not Available
Type(s) : ADR Inferred
Groups : G6PD deficiency
Description : Increased risk of hemolytic anemia.
References :

  1. Eichelbaum M, Evert B: Influence of pharmacogenetics on drug disposition and response. Clin Exp Pharmacol Physiol. 1996 Oct-Nov;23(10-11):983-5. [PubMed:8911746 ]
  2. Diabinese® (chlorpropamide)[package insert]. New York City, New York: Pfizer Labs, Division of Pfizer Inc; 2010. [Link]

PMID: 46112

Chlorpropamide

By

Chlorpropamide

Product: Daucosterol

Identifier : DBSNPE000995
Drug : DB00672 (Chlorpropamide)
Interacting Gene/Enzyme : Glucose-6-phosphate 1-dehydrogenase
Gene Name : G6PD
UniProt ID : P11413
Defining Change(s) :

  • 196T->A

Allele Name : Songklanagarind
Genotype(s) : Not Available
Type(s) : ADR Inferred
Groups : G6PD deficiency
Description : Increased risk of hemolytic anemia.
References :

  1. Eichelbaum M, Evert B: Influence of pharmacogenetics on drug disposition and response. Clin Exp Pharmacol Physiol. 1996 Oct-Nov;23(10-11):983-5. [PubMed:8911746 ]
  2. Diabinese® (chlorpropamide)[package insert]. New York City, New York: Pfizer Labs, Division of Pfizer Inc; 2010. [Link]

PMID: 26120058

Chlorpropamide

By

Chlorpropamide

Product: MIR96-IN-1

Identifier : DBSNPE000996
Drug : DB00672 (Chlorpropamide)
Interacting Gene/Enzyme : Glucose-6-phosphate 1-dehydrogenase
Gene Name : G6PD
UniProt ID : P11413
Defining Change(s) :

  • 202G->A
  • 871G->A

Allele Name : Hechi
Genotype(s) : Not Available
Type(s) : ADR Inferred
Groups : G6PD deficiency
Description : Increased risk of hemolytic anemia.
References :

  1. Eichelbaum M, Evert B: Influence of pharmacogenetics on drug disposition and response. Clin Exp Pharmacol Physiol. 1996 Oct-Nov;23(10-11):983-5. [PubMed:8911746 ]
  2. Diabinese® (chlorpropamide)[package insert]. New York City, New York: Pfizer Labs, Division of Pfizer Inc; 2010. [Link]

PMID: 19052546

Chlorpropamide

By

Chlorpropamide

Product: Eliglustat (hemitartrate)

Identifier : DBSNPE000997
Drug : DB00672 (Chlorpropamide)
Interacting Gene/Enzyme : Glucose-6-phosphate 1-dehydrogenase
Gene Name : G6PD
UniProt ID : P11413
Defining Change(s) :

  • 208T->C

Allele Name : Namouru
Genotype(s) : Not Available
Type(s) : ADR Inferred
Groups : G6PD deficiency
Description : Increased risk of hemolytic anemia.
References :

  1. Eichelbaum M, Evert B: Influence of pharmacogenetics on drug disposition and response. Clin Exp Pharmacol Physiol. 1996 Oct-Nov;23(10-11):983-5. [PubMed:8911746 ]
  2. Diabinese® (chlorpropamide)[package insert]. New York City, New York: Pfizer Labs, Division of Pfizer Inc; 2010. [Link]

PMID: 25058910

Chlorpropamide

By

Chlorpropamide

Product: Eliglustat

Identifier : DBSNPE000998
Drug : DB00672 (Chlorpropamide)
Interacting Gene/Enzyme : Glucose-6-phosphate 1-dehydrogenase
Gene Name : G6PD
UniProt ID : P11413
Defining Change(s) :

  • 352T>C

Allele Name : Bao Loc
Genotype(s) : Not Available
Type(s) : ADR Inferred
Groups : G6PD deficiency
Description : Increased risk of hemolytic anemia.
References :

  1. Eichelbaum M, Evert B: Influence of pharmacogenetics on drug disposition and response. Clin Exp Pharmacol Physiol. 1996 Oct-Nov;23(10-11):983-5. [PubMed:8911746 ]
  2. Diabinese® (chlorpropamide)[package insert]. New York City, New York: Pfizer Labs, Division of Pfizer Inc; 2010. [Link]

PMID: 22654517

Chlorpropamide

By

Chlorpropamide

Product: (-)-Indolactam V

Identifier : DBSNPE000999
Drug : DB00672 (Chlorpropamide)
Interacting Gene/Enzyme : Glucose-6-phosphate 1-dehydrogenase
Gene Name : G6PD
UniProt ID : P11413
Defining Change(s) :

  • 375G->T, 379G->T383T->C384C>T

Allele Name : Crispim
Genotype(s) : Not Available
Type(s) : ADR Inferred
Groups : G6PD deficiency
Description : Increased risk of hemolytic anemia.
References :

  1. Eichelbaum M, Evert B: Influence of pharmacogenetics on drug disposition and response. Clin Exp Pharmacol Physiol. 1996 Oct-Nov;23(10-11):983-5. [PubMed:8911746 ]
  2. Diabinese® (chlorpropamide)[package insert]. New York City, New York: Pfizer Labs, Division of Pfizer Inc; 2010. [Link]

PMID: 8253089

Chlorpropamide

By

Chlorpropamide

Product: GW274150

Identifier : DBSNPE001000
Drug : DB00672 (Chlorpropamide)
Interacting Gene/Enzyme : Glucose-6-phosphate 1-dehydrogenase
Gene Name : G6PD
UniProt ID : P11413
Defining Change(s) :

  • 376A->G
  • 463C->G

Allele Name : Acrokorinthos
Genotype(s) : Not Available
Type(s) : ADR Inferred
Groups : G6PD deficiency
Description : Increased risk of hemolytic anemia.
References :

  1. Eichelbaum M, Evert B: Influence of pharmacogenetics on drug disposition and response. Clin Exp Pharmacol Physiol. 1996 Oct-Nov;23(10-11):983-5. [PubMed:8911746 ]
  2. Diabinese® (chlorpropamide)[package insert]. New York City, New York: Pfizer Labs, Division of Pfizer Inc; 2010. [Link]

PMID: 2461559

Chlorpropamide

By

Chlorpropamide

Product: Daprodustat

Identifier : DBSNPE001001
Drug : DB00672 (Chlorpropamide)
Interacting Gene/Enzyme : Glucose-6-phosphate 1-dehydrogenase
Gene Name : G6PD
UniProt ID : P11413
Defining Change(s) :

  • 376A->G
  • 542A->T

Allele Name : Santa Maria
Genotype(s) : Not Available
Type(s) : ADR Inferred
Groups : G6PD deficiency
Description : Increased risk of hemolytic anemia.
References :

  1. Eichelbaum M, Evert B: Influence of pharmacogenetics on drug disposition and response. Clin Exp Pharmacol Physiol. 1996 Oct-Nov;23(10-11):983-5. [PubMed:8911746 ]
  2. Diabinese® (chlorpropamide)[package insert]. New York City, New York: Pfizer Labs, Division of Pfizer Inc; 2010. [Link]

PMID: 2449244

Chlorpropamide

By

Chlorpropamide

Product: SC66

Identifier : DBSNPE001002
Drug : DB00672 (Chlorpropamide)
Interacting Gene/Enzyme : Glucose-6-phosphate 1-dehydrogenase
Gene Name : G6PD
UniProt ID : P11413
Defining Change(s) :

  • 376A->G
  • 871G->A

Allele Name : Ananindeua
Genotype(s) : Not Available
Type(s) : ADR Inferred
Groups : G6PD deficiency
Description : Increased risk of hemolytic anemia.
References :

  1. Eichelbaum M, Evert B: Influence of pharmacogenetics on drug disposition and response. Clin Exp Pharmacol Physiol. 1996 Oct-Nov;23(10-11):983-5. [PubMed:8911746 ]
  2. Diabinese® (chlorpropamide)[package insert]. New York City, New York: Pfizer Labs, Division of Pfizer Inc; 2010. [Link]

PMID: 7028425

Chlorpropamide

By

Chlorpropamide

Product: AN3199

Identifier : DBSNPE001003
Drug : DB00672 (Chlorpropamide)
Interacting Gene/Enzyme : Glucose-6-phosphate 1-dehydrogenase
Gene Name : G6PD
UniProt ID : P11413
Defining Change(s) :

  • 383T->C

Allele Name : Vanua Lava
Genotype(s) : Not Available
Type(s) : ADR Inferred
Groups : G6PD deficiency
Description : Increased risk of hemolytic anemia.
References :

  1. Eichelbaum M, Evert B: Influence of pharmacogenetics on drug disposition and response. Clin Exp Pharmacol Physiol. 1996 Oct-Nov;23(10-11):983-5. [PubMed:8911746 ]
  2. Diabinese® (chlorpropamide)[package insert]. New York City, New York: Pfizer Labs, Division of Pfizer Inc; 2010. [Link]

PMID: 26950745

Chlorpropamide

By

Chlorpropamide

Product: AN3199

Identifier : DBSNPE001003
Drug : DB00672 (Chlorpropamide)
Interacting Gene/Enzyme : Glucose-6-phosphate 1-dehydrogenase
Gene Name : G6PD
UniProt ID : P11413
Defining Change(s) :

  • 383T->C

Allele Name : Vanua Lava
Genotype(s) : Not Available
Type(s) : ADR Inferred
Groups : G6PD deficiency
Description : Increased risk of hemolytic anemia.
References :

  1. Eichelbaum M, Evert B: Influence of pharmacogenetics on drug disposition and response. Clin Exp Pharmacol Physiol. 1996 Oct-Nov;23(10-11):983-5. [PubMed:8911746 ]
  2. Diabinese® (chlorpropamide)[package insert]. New York City, New York: Pfizer Labs, Division of Pfizer Inc; 2010. [Link]

PMID: 26950745

Chlorpropamide

By

Chlorpropamide

Product: 4EGI-1

Identifier : DBSNPE001004
Drug : DB00672 (Chlorpropamide)
Interacting Gene/Enzyme : Glucose-6-phosphate 1-dehydrogenase
Gene Name : G6PD
UniProt ID : P11413
Defining Change(s) :

  • 406C->T

Allele Name : Valladolid
Genotype(s) : Not Available
Type(s) : ADR Inferred
Groups : G6PD deficiency
Description : Increased risk of hemolytic anemia.
References :

  1. Eichelbaum M, Evert B: Influence of pharmacogenetics on drug disposition and response. Clin Exp Pharmacol Physiol. 1996 Oct-Nov;23(10-11):983-5. [PubMed:8911746 ]
  2. Diabinese® (chlorpropamide)[package insert]. New York City, New York: Pfizer Labs, Division of Pfizer Inc; 2010. [Link]

PMID: 26324940

Chlorpropamide

By

Chlorpropamide

Product: 4EGI-1

Identifier : DBSNPE001004
Drug : DB00672 (Chlorpropamide)
Interacting Gene/Enzyme : Glucose-6-phosphate 1-dehydrogenase
Gene Name : G6PD
UniProt ID : P11413
Defining Change(s) :

  • 406C->T

Allele Name : Valladolid
Genotype(s) : Not Available
Type(s) : ADR Inferred
Groups : G6PD deficiency
Description : Increased risk of hemolytic anemia.
References :

  1. Eichelbaum M, Evert B: Influence of pharmacogenetics on drug disposition and response. Clin Exp Pharmacol Physiol. 1996 Oct-Nov;23(10-11):983-5. [PubMed:8911746 ]
  2. Diabinese® (chlorpropamide)[package insert]. New York City, New York: Pfizer Labs, Division of Pfizer Inc; 2010. [Link]

PMID: 26324940

Chlorpropamide

By

Chlorpropamide

Product: ROR gama modulator 1

Identifier : DBSNPE001005
Drug : DB00672 (Chlorpropamide)
Interacting Gene/Enzyme : Glucose-6-phosphate 1-dehydrogenase
Gene Name : G6PD
UniProt ID : P11413
Defining Change(s) :

  • 409C->T

Allele Name : Belem
Genotype(s) : Not Available
Type(s) : ADR Inferred
Groups : G6PD deficiency
Description : Increased risk of hemolytic anemia.
References :

  1. Eichelbaum M, Evert B: Influence of pharmacogenetics on drug disposition and response. Clin Exp Pharmacol Physiol. 1996 Oct-Nov;23(10-11):983-5. [PubMed:8911746 ]
  2. Diabinese® (chlorpropamide)[package insert]. New York City, New York: Pfizer Labs, Division of Pfizer Inc; 2010. [Link]

PMID: 25599551

Chlorpropamide

By

Chlorpropamide

Product: ROR gama modulator 1

Identifier : DBSNPE001005
Drug : DB00672 (Chlorpropamide)
Interacting Gene/Enzyme : Glucose-6-phosphate 1-dehydrogenase
Gene Name : G6PD
UniProt ID : P11413
Defining Change(s) :

  • 409C->T

Allele Name : Belem
Genotype(s) : Not Available
Type(s) : ADR Inferred
Groups : G6PD deficiency
Description : Increased risk of hemolytic anemia.
References :

  1. Eichelbaum M, Evert B: Influence of pharmacogenetics on drug disposition and response. Clin Exp Pharmacol Physiol. 1996 Oct-Nov;23(10-11):983-5. [PubMed:8911746 ]
  2. Diabinese® (chlorpropamide)[package insert]. New York City, New York: Pfizer Labs, Division of Pfizer Inc; 2010. [Link]

PMID: 25599551

Chlorpropamide

By

Chlorpropamide

Product: Integrin Antagonist 1 (hydrochloride)

Identifier : DBSNPE001006
Drug : DB00672 (Chlorpropamide)
Interacting Gene/Enzyme : Glucose-6-phosphate 1-dehydrogenase
Gene Name : G6PD
UniProt ID : P11413
Defining Change(s) :

  • 442G->A

Allele Name : Liuzhou
Genotype(s) : Not Available
Type(s) : ADR Inferred
Groups : G6PD deficiency
Description : Increased risk of hemolytic anemia.
References :

  1. Eichelbaum M, Evert B: Influence of pharmacogenetics on drug disposition and response. Clin Exp Pharmacol Physiol. 1996 Oct-Nov;23(10-11):983-5. [PubMed:8911746 ]
  2. Diabinese® (chlorpropamide)[package insert]. New York City, New York: Pfizer Labs, Division of Pfizer Inc; 2010. [Link]

PMID: 26564855

Chlorpropamide

By

Chlorpropamide

Product: Integrin Antagonist 1 (hydrochloride)

Identifier : DBSNPE001006
Drug : DB00672 (Chlorpropamide)
Interacting Gene/Enzyme : Glucose-6-phosphate 1-dehydrogenase
Gene Name : G6PD
UniProt ID : P11413
Defining Change(s) :

  • 442G->A

Allele Name : Liuzhou
Genotype(s) : Not Available
Type(s) : ADR Inferred
Groups : G6PD deficiency
Description : Increased risk of hemolytic anemia.
References :

  1. Eichelbaum M, Evert B: Influence of pharmacogenetics on drug disposition and response. Clin Exp Pharmacol Physiol. 1996 Oct-Nov;23(10-11):983-5. [PubMed:8911746 ]
  2. Diabinese® (chlorpropamide)[package insert]. New York City, New York: Pfizer Labs, Division of Pfizer Inc; 2010. [Link]

PMID: 26564855

Chlorpropamide

By

Chlorpropamide

Product: PI3Kα inhibitor 1

Identifier : DBSNPE001007
Drug : DB00672 (Chlorpropamide)
Interacting Gene/Enzyme : Glucose-6-phosphate 1-dehydrogenase
Gene Name : G6PD
UniProt ID : P11413
Defining Change(s) :

  • 473G>A

Allele Name : Shenzen
Genotype(s) : Not Available
Type(s) : ADR Inferred
Groups : G6PD deficiency
Description : Increased risk of hemolytic anemia.
References :

  1. Eichelbaum M, Evert B: Influence of pharmacogenetics on drug disposition and response. Clin Exp Pharmacol Physiol. 1996 Oct-Nov;23(10-11):983-5. [PubMed:8911746 ]
  2. Diabinese® (chlorpropamide)[package insert]. New York City, New York: Pfizer Labs, Division of Pfizer Inc; 2010. [Link]

PMID: 27484239

Chlorpropamide

By

Chlorpropamide

Product: PI3Kα inhibitor 1

Identifier : DBSNPE001007
Drug : DB00672 (Chlorpropamide)
Interacting Gene/Enzyme : Glucose-6-phosphate 1-dehydrogenase
Gene Name : G6PD
UniProt ID : P11413
Defining Change(s) :

  • 473G>A

Allele Name : Shenzen
Genotype(s) : Not Available
Type(s) : ADR Inferred
Groups : G6PD deficiency
Description : Increased risk of hemolytic anemia.
References :

  1. Eichelbaum M, Evert B: Influence of pharmacogenetics on drug disposition and response. Clin Exp Pharmacol Physiol. 1996 Oct-Nov;23(10-11):983-5. [PubMed:8911746 ]
  2. Diabinese® (chlorpropamide)[package insert]. New York City, New York: Pfizer Labs, Division of Pfizer Inc; 2010. [Link]

PMID: 27484239

Chlorpropamide

By

Chlorpropamide

Product: Indirubin-3monoxime

Identifier : DBSNPE001008
Drug : DB00672 (Chlorpropamide)
Interacting Gene/Enzyme : Glucose-6-phosphate 1-dehydrogenase
Gene Name : G6PD
UniProt ID : P11413
Defining Change(s) :

  • 493A->G

Allele Name : Taipei “Chinese- 3”
Genotype(s) : Not Available
Type(s) : ADR Inferred
Groups : G6PD deficiency
Description : Increased risk of hemolytic anemia.
References :

  1. Eichelbaum M, Evert B: Influence of pharmacogenetics on drug disposition and response. Clin Exp Pharmacol Physiol. 1996 Oct-Nov;23(10-11):983-5. [PubMed:8911746 ]
  2. Diabinese® (chlorpropamide)[package insert]. New York City, New York: Pfizer Labs, Division of Pfizer Inc; 2010. [Link]

PMID: 27523609

Chlorpropamide

By

Chlorpropamide

Product: Indirubin-3monoxime

Identifier : DBSNPE001008
Drug : DB00672 (Chlorpropamide)
Interacting Gene/Enzyme : Glucose-6-phosphate 1-dehydrogenase
Gene Name : G6PD
UniProt ID : P11413
Defining Change(s) :

  • 493A->G

Allele Name : Taipei “Chinese- 3”
Genotype(s) : Not Available
Type(s) : ADR Inferred
Groups : G6PD deficiency
Description : Increased risk of hemolytic anemia.
References :

  1. Eichelbaum M, Evert B: Influence of pharmacogenetics on drug disposition and response. Clin Exp Pharmacol Physiol. 1996 Oct-Nov;23(10-11):983-5. [PubMed:8911746 ]
  2. Diabinese® (chlorpropamide)[package insert]. New York City, New York: Pfizer Labs, Division of Pfizer Inc; 2010. [Link]

PMID: 27523609

Chlorpropamide

By

Chlorpropamide

Product: HDAC-IN-3

Identifier : DBSNPE001009
Drug : DB00672 (Chlorpropamide)
Interacting Gene/Enzyme : Glucose-6-phosphate 1-dehydrogenase
Gene Name : G6PD
UniProt ID : P11413
Defining Change(s) :

  • 496C>T

Allele Name : Toledo
Genotype(s) : Not Available
Type(s) : ADR Inferred
Groups : G6PD deficiency
Description : Increased risk of hemolytic anemia.
References :

  1. Eichelbaum M, Evert B: Influence of pharmacogenetics on drug disposition and response. Clin Exp Pharmacol Physiol. 1996 Oct-Nov;23(10-11):983-5. [PubMed:8911746 ]
  2. Diabinese® (chlorpropamide)[package insert]. New York City, New York: Pfizer Labs, Division of Pfizer Inc; 2010. [Link]

PMID: 25892223

Chlorpropamide

By

Chlorpropamide

Product: HDAC-IN-3

Identifier : DBSNPE001009
Drug : DB00672 (Chlorpropamide)
Interacting Gene/Enzyme : Glucose-6-phosphate 1-dehydrogenase
Gene Name : G6PD
UniProt ID : P11413
Defining Change(s) :

  • 496C>T

Allele Name : Toledo
Genotype(s) : Not Available
Type(s) : ADR Inferred
Groups : G6PD deficiency
Description : Increased risk of hemolytic anemia.
References :

  1. Eichelbaum M, Evert B: Influence of pharmacogenetics on drug disposition and response. Clin Exp Pharmacol Physiol. 1996 Oct-Nov;23(10-11):983-5. [PubMed:8911746 ]
  2. Diabinese® (chlorpropamide)[package insert]. New York City, New York: Pfizer Labs, Division of Pfizer Inc; 2010. [Link]

PMID: 25892223

Chlorpropamide

By

Chlorpropamide

Product: Sirtuin modulator 1

Identifier : DBSNPE001010
Drug : DB00672 (Chlorpropamide)
Interacting Gene/Enzyme : Glucose-6-phosphate 1-dehydrogenase
Gene Name : G6PD
UniProt ID : P11413
Defining Change(s) :

  • 497G->A

Allele Name : Naone
Genotype(s) : Not Available
Type(s) : ADR Inferred
Groups : G6PD deficiency
Description : Increased risk of hemolytic anemia.
References :

  1. Eichelbaum M, Evert B: Influence of pharmacogenetics on drug disposition and response. Clin Exp Pharmacol Physiol. 1996 Oct-Nov;23(10-11):983-5. [PubMed:8911746 ]
  2. Diabinese® (chlorpropamide)[package insert]. New York City, New York: Pfizer Labs, Division of Pfizer Inc; 2010. [Link]

PMID: 27776112

Chlorpropamide

By

Chlorpropamide

Product: Sirtuin modulator 1

Identifier : DBSNPE001010
Drug : DB00672 (Chlorpropamide)
Interacting Gene/Enzyme : Glucose-6-phosphate 1-dehydrogenase
Gene Name : G6PD
UniProt ID : P11413
Defining Change(s) :

  • 497G->A

Allele Name : Naone
Genotype(s) : Not Available
Type(s) : ADR Inferred
Groups : G6PD deficiency
Description : Increased risk of hemolytic anemia.
References :

  1. Eichelbaum M, Evert B: Influence of pharmacogenetics on drug disposition and response. Clin Exp Pharmacol Physiol. 1996 Oct-Nov;23(10-11):983-5. [PubMed:8911746 ]
  2. Diabinese® (chlorpropamide)[package insert]. New York City, New York: Pfizer Labs, Division of Pfizer Inc; 2010. [Link]

PMID: 27776112

Chlorpropamide

By

Chlorpropamide

Product: BMS-202

Identifier : DBSNPE001011
Drug : DB00672 (Chlorpropamide)
Interacting Gene/Enzyme : Glucose-6-phosphate 1-dehydrogenase
Gene Name : G6PD
UniProt ID : P11413
Defining Change(s) :

  • 517T->C

Allele Name : Nankang
Genotype(s) : Not Available
Type(s) : ADR Inferred
Groups : G6PD deficiency
Description : Increased risk of hemolytic anemia.
References :

  1. Eichelbaum M, Evert B: Influence of pharmacogenetics on drug disposition and response. Clin Exp Pharmacol Physiol. 1996 Oct-Nov;23(10-11):983-5. [PubMed:8911746 ]
  2. Diabinese® (chlorpropamide)[package insert]. New York City, New York: Pfizer Labs, Division of Pfizer Inc; 2010. [Link]

PMID: 24281001

Chlorpropamide

By

Chlorpropamide

Product: BMS-202

Identifier : DBSNPE001011
Drug : DB00672 (Chlorpropamide)
Interacting Gene/Enzyme : Glucose-6-phosphate 1-dehydrogenase
Gene Name : G6PD
UniProt ID : P11413
Defining Change(s) :

  • 517T->C

Allele Name : Nankang
Genotype(s) : Not Available
Type(s) : ADR Inferred
Groups : G6PD deficiency
Description : Increased risk of hemolytic anemia.
References :

  1. Eichelbaum M, Evert B: Influence of pharmacogenetics on drug disposition and response. Clin Exp Pharmacol Physiol. 1996 Oct-Nov;23(10-11):983-5. [PubMed:8911746 ]
  2. Diabinese® (chlorpropamide)[package insert]. New York City, New York: Pfizer Labs, Division of Pfizer Inc; 2010. [Link]

PMID: 24281001

Chlorpropamide

By

Chlorpropamide

Product: DPC-681

Identifier : DBSNPE001012
Drug : DB00672 (Chlorpropamide)
Interacting Gene/Enzyme : Glucose-6-phosphate 1-dehydrogenase
Gene Name : G6PD
UniProt ID : P11413
Defining Change(s) :

  • 519C->G

Allele Name : Miaoli
Genotype(s) : Not Available
Type(s) : ADR Inferred
Groups : G6PD deficiency
Description : Increased risk of hemolytic anemia.
References :

  1. Eichelbaum M, Evert B: Influence of pharmacogenetics on drug disposition and response. Clin Exp Pharmacol Physiol. 1996 Oct-Nov;23(10-11):983-5. [PubMed:8911746 ]
  2. Diabinese® (chlorpropamide)[package insert]. New York City, New York: Pfizer Labs, Division of Pfizer Inc; 2010. [Link]

PMID: 24368766

Chlorpropamide

By

Chlorpropamide

Product: DPC-681

Identifier : DBSNPE001012
Drug : DB00672 (Chlorpropamide)
Interacting Gene/Enzyme : Glucose-6-phosphate 1-dehydrogenase
Gene Name : G6PD
UniProt ID : P11413
Defining Change(s) :

  • 519C->G

Allele Name : Miaoli
Genotype(s) : Not Available
Type(s) : ADR Inferred
Groups : G6PD deficiency
Description : Increased risk of hemolytic anemia.
References :

  1. Eichelbaum M, Evert B: Influence of pharmacogenetics on drug disposition and response. Clin Exp Pharmacol Physiol. 1996 Oct-Nov;23(10-11):983-5. [PubMed:8911746 ]
  2. Diabinese® (chlorpropamide)[package insert]. New York City, New York: Pfizer Labs, Division of Pfizer Inc; 2010. [Link]

PMID: 24368766

Chlorpropamide

By

Chlorpropamide

Product: Ombrabulin (hydrochloride)

Identifier : DBSNPE001013
Drug : DB00672 (Chlorpropamide)
Interacting Gene/Enzyme : Glucose-6-phosphate 1-dehydrogenase
Gene Name : G6PD
UniProt ID : P11413
Defining Change(s) :

  • 563C->T

Allele Name : Mediterranean, Dallas, Panama‚ Sassari, Cagliari, Birmingham
Genotype(s) : Not Available
Type(s) : ADR Inferred
Groups : G6PD deficiency
Description : Increased risk of hemolytic anemia.
References :

  1. Eichelbaum M, Evert B: Influence of pharmacogenetics on drug disposition and response. Clin Exp Pharmacol Physiol. 1996 Oct-Nov;23(10-11):983-5. [PubMed:8911746 ]
  2. Diabinese® (chlorpropamide)[package insert]. New York City, New York: Pfizer Labs, Division of Pfizer Inc; 2010. [Link]

PMID: 24297180

Chlorpropamide

By

Chlorpropamide

Product: Ombrabulin (hydrochloride)

Identifier : DBSNPE001013
Drug : DB00672 (Chlorpropamide)
Interacting Gene/Enzyme : Glucose-6-phosphate 1-dehydrogenase
Gene Name : G6PD
UniProt ID : P11413
Defining Change(s) :

  • 563C->T

Allele Name : Mediterranean, Dallas, Panama‚ Sassari, Cagliari, Birmingham
Genotype(s) : Not Available
Type(s) : ADR Inferred
Groups : G6PD deficiency
Description : Increased risk of hemolytic anemia.
References :

  1. Eichelbaum M, Evert B: Influence of pharmacogenetics on drug disposition and response. Clin Exp Pharmacol Physiol. 1996 Oct-Nov;23(10-11):983-5. [PubMed:8911746 ]
  2. Diabinese® (chlorpropamide)[package insert]. New York City, New York: Pfizer Labs, Division of Pfizer Inc; 2010. [Link]

PMID: 24297180

Chlorpropamide

By

Chlorpropamide

Product: Grapiprant

Identifier : DBSNPE001014
Drug : DB00672 (Chlorpropamide)
Interacting Gene/Enzyme : Glucose-6-phosphate 1-dehydrogenase
Gene Name : G6PD
UniProt ID : P11413
Defining Change(s) :

  • 592C->T

Allele Name : Coimbra Shunde
Genotype(s) : Not Available
Type(s) : ADR Inferred
Groups : G6PD deficiency
Description : Increased risk of hemolytic anemia.
References :

  1. Eichelbaum M, Evert B: Influence of pharmacogenetics on drug disposition and response. Clin Exp Pharmacol Physiol. 1996 Oct-Nov;23(10-11):983-5. [PubMed:8911746 ]
  2. Diabinese® (chlorpropamide)[package insert]. New York City, New York: Pfizer Labs, Division of Pfizer Inc; 2010. [Link]

PMID: 24317693

Chlorpropamide

By

Chlorpropamide

Product: Grapiprant

Identifier : DBSNPE001014
Drug : DB00672 (Chlorpropamide)
Interacting Gene/Enzyme : Glucose-6-phosphate 1-dehydrogenase
Gene Name : G6PD
UniProt ID : P11413
Defining Change(s) :

  • 592C->T

Allele Name : Coimbra Shunde
Genotype(s) : Not Available
Type(s) : ADR Inferred
Groups : G6PD deficiency
Description : Increased risk of hemolytic anemia.
References :

  1. Eichelbaum M, Evert B: Influence of pharmacogenetics on drug disposition and response. Clin Exp Pharmacol Physiol. 1996 Oct-Nov;23(10-11):983-5. [PubMed:8911746 ]
  2. Diabinese® (chlorpropamide)[package insert]. New York City, New York: Pfizer Labs, Division of Pfizer Inc; 2010. [Link]

PMID: 24317693

Chlorpropamide

By

Chlorpropamide

Product: GSK2838232

Identifier : DBSNPE001015
Drug : DB00672 (Chlorpropamide)
Interacting Gene/Enzyme : Glucose-6-phosphate 1-dehydrogenase
Gene Name : G6PD
UniProt ID : P11413
Defining Change(s) :

  • 593G>A

Allele Name : Nilgiri
Genotype(s) : Not Available
Type(s) : ADR Inferred
Groups : G6PD deficiency
Description : Increased risk of hemolytic anemia.
References :

  1. Eichelbaum M, Evert B: Influence of pharmacogenetics on drug disposition and response. Clin Exp Pharmacol Physiol. 1996 Oct-Nov;23(10-11):983-5. [PubMed:8911746 ]
  2. Diabinese® (chlorpropamide)[package insert]. New York City, New York: Pfizer Labs, Division of Pfizer Inc; 2010. [Link]

PMID: 15782150

Chlorpropamide

By

Chlorpropamide

Product: GSK2838232

Identifier : DBSNPE001015
Drug : DB00672 (Chlorpropamide)
Interacting Gene/Enzyme : Glucose-6-phosphate 1-dehydrogenase
Gene Name : G6PD
UniProt ID : P11413
Defining Change(s) :

  • 593G>A

Allele Name : Nilgiri
Genotype(s) : Not Available
Type(s) : ADR Inferred
Groups : G6PD deficiency
Description : Increased risk of hemolytic anemia.
References :

  1. Eichelbaum M, Evert B: Influence of pharmacogenetics on drug disposition and response. Clin Exp Pharmacol Physiol. 1996 Oct-Nov;23(10-11):983-5. [PubMed:8911746 ]
  2. Diabinese® (chlorpropamide)[package insert]. New York City, New York: Pfizer Labs, Division of Pfizer Inc; 2010. [Link]

PMID: 15782150

Chlorpropamide

By

Chlorpropamide

Product: M1 receptor modulator

Identifier : DBSNPE001016
Drug : DB00672 (Chlorpropamide)
Interacting Gene/Enzyme : Glucose-6-phosphate 1-dehydrogenase
Gene Name : G6PD
UniProt ID : P11413
Defining Change(s) :

  • 679C->T

Allele Name : Radlowo
Genotype(s) : Not Available
Type(s) : ADR Inferred
Groups : G6PD deficiency
Description : Increased risk of hemolytic anemia.
References :

  1. Eichelbaum M, Evert B: Influence of pharmacogenetics on drug disposition and response. Clin Exp Pharmacol Physiol. 1996 Oct-Nov;23(10-11):983-5. [PubMed:8911746 ]
  2. Diabinese® (chlorpropamide)[package insert]. New York City, New York: Pfizer Labs, Division of Pfizer Inc; 2010. [Link]

PMID: 23611635

Chlorpropamide

By

Chlorpropamide

Product: M1 receptor modulator

Identifier : DBSNPE001016
Drug : DB00672 (Chlorpropamide)
Interacting Gene/Enzyme : Glucose-6-phosphate 1-dehydrogenase
Gene Name : G6PD
UniProt ID : P11413
Defining Change(s) :

  • 679C->T

Allele Name : Radlowo
Genotype(s) : Not Available
Type(s) : ADR Inferred
Groups : G6PD deficiency
Description : Increased risk of hemolytic anemia.
References :

  1. Eichelbaum M, Evert B: Influence of pharmacogenetics on drug disposition and response. Clin Exp Pharmacol Physiol. 1996 Oct-Nov;23(10-11):983-5. [PubMed:8911746 ]
  2. Diabinese® (chlorpropamide)[package insert]. New York City, New York: Pfizer Labs, Division of Pfizer Inc; 2010. [Link]

PMID: 23611635

Chlorpropamide

By

Chlorpropamide

Product: GSK2330672

Identifier : DBSNPE001017
Drug : DB00672 (Chlorpropamide)
Interacting Gene/Enzyme : Glucose-6-phosphate 1-dehydrogenase
Gene Name : G6PD
UniProt ID : P11413
Defining Change(s) :

  • 811G>C

Allele Name : Roubaix
Genotype(s) : Not Available
Type(s) : ADR Inferred
Groups : G6PD deficiency
Description : Increased risk of hemolytic anemia.
References :

  1. Eichelbaum M, Evert B: Influence of pharmacogenetics on drug disposition and response. Clin Exp Pharmacol Physiol. 1996 Oct-Nov;23(10-11):983-5. [PubMed:8911746 ]
  2. Diabinese® (chlorpropamide)[package insert]. New York City, New York: Pfizer Labs, Division of Pfizer Inc; 2010. [Link]

PMID: 25036716

Chlorpropamide

By

Chlorpropamide

Product: GSK2330672

Identifier : DBSNPE001017
Drug : DB00672 (Chlorpropamide)
Interacting Gene/Enzyme : Glucose-6-phosphate 1-dehydrogenase
Gene Name : G6PD
UniProt ID : P11413
Defining Change(s) :

  • 811G>C

Allele Name : Roubaix
Genotype(s) : Not Available
Type(s) : ADR Inferred
Groups : G6PD deficiency
Description : Increased risk of hemolytic anemia.
References :

  1. Eichelbaum M, Evert B: Influence of pharmacogenetics on drug disposition and response. Clin Exp Pharmacol Physiol. 1996 Oct-Nov;23(10-11):983-5. [PubMed:8911746 ]
  2. Diabinese® (chlorpropamide)[package insert]. New York City, New York: Pfizer Labs, Division of Pfizer Inc; 2010. [Link]

PMID: 25036716

Chlorpropamide

By

Chlorpropamide

Product: YHO-13351 (free base)

Identifier : DBSNPE001018
Drug : DB00672 (Chlorpropamide)
Interacting Gene/Enzyme : Glucose-6-phosphate 1-dehydrogenase
Gene Name : G6PD
UniProt ID : P11413
Defining Change(s) :

  • 835A->G

Allele Name : Haikou
Genotype(s) : Not Available
Type(s) : ADR Inferred
Groups : G6PD deficiency
Description : Increased risk of hemolytic anemia.
References :

  1. Eichelbaum M, Evert B: Influence of pharmacogenetics on drug disposition and response. Clin Exp Pharmacol Physiol. 1996 Oct-Nov;23(10-11):983-5. [PubMed:8911746 ]
  2. Diabinese® (chlorpropamide)[package insert]. New York City, New York: Pfizer Labs, Division of Pfizer Inc; 2010. [Link]

PMID: 19606815

Chlorpropamide

By

Chlorpropamide

Product: YHO-13351 (free base)

Identifier : DBSNPE001018
Drug : DB00672 (Chlorpropamide)
Interacting Gene/Enzyme : Glucose-6-phosphate 1-dehydrogenase
Gene Name : G6PD
UniProt ID : P11413
Defining Change(s) :

  • 835A->G

Allele Name : Haikou
Genotype(s) : Not Available
Type(s) : ADR Inferred
Groups : G6PD deficiency
Description : Increased risk of hemolytic anemia.
References :

  1. Eichelbaum M, Evert B: Influence of pharmacogenetics on drug disposition and response. Clin Exp Pharmacol Physiol. 1996 Oct-Nov;23(10-11):983-5. [PubMed:8911746 ]
  2. Diabinese® (chlorpropamide)[package insert]. New York City, New York: Pfizer Labs, Division of Pfizer Inc; 2010. [Link]

PMID: 19606815

Chlorpropamide

By

Chlorpropamide

Product: PFK-158

Identifier : DBSNPE001019
Drug : DB00672 (Chlorpropamide)
Interacting Gene/Enzyme : Glucose-6-phosphate 1-dehydrogenase
Gene Name : G6PD
UniProt ID : P11413
Defining Change(s) :

  • 835A->T

Allele Name : Chinese-1
Genotype(s) : Not Available
Type(s) : ADR Inferred
Groups : G6PD deficiency
Description : Increased risk of hemolytic anemia.
References :

  1. Eichelbaum M, Evert B: Influence of pharmacogenetics on drug disposition and response. Clin Exp Pharmacol Physiol. 1996 Oct-Nov;23(10-11):983-5. [PubMed:8911746 ]
  2. Diabinese® (chlorpropamide)[package insert]. New York City, New York: Pfizer Labs, Division of Pfizer Inc; 2010. [Link]

PMID: 16895981

Chlorpropamide

By

Chlorpropamide

Product: PFK-158

Identifier : DBSNPE001019
Drug : DB00672 (Chlorpropamide)
Interacting Gene/Enzyme : Glucose-6-phosphate 1-dehydrogenase
Gene Name : G6PD
UniProt ID : P11413
Defining Change(s) :

  • 835A->T

Allele Name : Chinese-1
Genotype(s) : Not Available
Type(s) : ADR Inferred
Groups : G6PD deficiency
Description : Increased risk of hemolytic anemia.
References :

  1. Eichelbaum M, Evert B: Influence of pharmacogenetics on drug disposition and response. Clin Exp Pharmacol Physiol. 1996 Oct-Nov;23(10-11):983-5. [PubMed:8911746 ]
  2. Diabinese® (chlorpropamide)[package insert]. New York City, New York: Pfizer Labs, Division of Pfizer Inc; 2010. [Link]

PMID: 16895981

Chlorpropamide

By

Chlorpropamide

Product: Relebactam

Identifier : DBSNPE001020
Drug : DB00672 (Chlorpropamide)
Interacting Gene/Enzyme : Glucose-6-phosphate 1-dehydrogenase
Gene Name : G6PD
UniProt ID : P11413
Defining Change(s) :

  • 848A>G

Allele Name : Mizushima
Genotype(s) : Not Available
Type(s) : ADR Inferred
Groups : G6PD deficiency
Description : Increased risk of hemolytic anemia.
References :

  1. Eichelbaum M, Evert B: Influence of pharmacogenetics on drug disposition and response. Clin Exp Pharmacol Physiol. 1996 Oct-Nov;23(10-11):983-5. [PubMed:8911746 ]
  2. Diabinese® (chlorpropamide)[package insert]. New York City, New York: Pfizer Labs, Division of Pfizer Inc; 2010. [Link]

PMID: 17032903

Chlorpropamide

By

Chlorpropamide

Product: Relebactam

Identifier : DBSNPE001020
Drug : DB00672 (Chlorpropamide)
Interacting Gene/Enzyme : Glucose-6-phosphate 1-dehydrogenase
Gene Name : G6PD
UniProt ID : P11413
Defining Change(s) :

  • 848A>G

Allele Name : Mizushima
Genotype(s) : Not Available
Type(s) : ADR Inferred
Groups : G6PD deficiency
Description : Increased risk of hemolytic anemia.
References :

  1. Eichelbaum M, Evert B: Influence of pharmacogenetics on drug disposition and response. Clin Exp Pharmacol Physiol. 1996 Oct-Nov;23(10-11):983-5. [PubMed:8911746 ]
  2. Diabinese® (chlorpropamide)[package insert]. New York City, New York: Pfizer Labs, Division of Pfizer Inc; 2010. [Link]

PMID: 17032903

Chlorpropamide

By

Chlorpropamide

Product: PRT4165

Identifier : DBSNPE001021
Drug : DB00672 (Chlorpropamide)
Interacting Gene/Enzyme : Glucose-6-phosphate 1-dehydrogenase
Gene Name : G6PD
UniProt ID : P11413
Defining Change(s) :

  • 853C->T

Allele Name : Osaka
Genotype(s) : Not Available
Type(s) : ADR Inferred
Groups : G6PD deficiency
Description : Increased risk of hemolytic anemia.
References :

  1. Eichelbaum M, Evert B: Influence of pharmacogenetics on drug disposition and response. Clin Exp Pharmacol Physiol. 1996 Oct-Nov;23(10-11):983-5. [PubMed:8911746 ]
  2. Diabinese® (chlorpropamide)[package insert]. New York City, New York: Pfizer Labs, Division of Pfizer Inc; 2010. [Link]

PMID: 11264244

Chlorpropamide

By

Chlorpropamide

Product: PRT4165

Identifier : DBSNPE001021
Drug : DB00672 (Chlorpropamide)
Interacting Gene/Enzyme : Glucose-6-phosphate 1-dehydrogenase
Gene Name : G6PD
UniProt ID : P11413
Defining Change(s) :

  • 853C->T

Allele Name : Osaka
Genotype(s) : Not Available
Type(s) : ADR Inferred
Groups : G6PD deficiency
Description : Increased risk of hemolytic anemia.
References :

  1. Eichelbaum M, Evert B: Influence of pharmacogenetics on drug disposition and response. Clin Exp Pharmacol Physiol. 1996 Oct-Nov;23(10-11):983-5. [PubMed:8911746 ]
  2. Diabinese® (chlorpropamide)[package insert]. New York City, New York: Pfizer Labs, Division of Pfizer Inc; 2010. [Link]

PMID: 11264244

Chlorpropamide

By

Chlorpropamide

Product: KS176

Identifier : DBSNPE001022
Drug : DB00672 (Chlorpropamide)
Interacting Gene/Enzyme : Glucose-6-phosphate 1-dehydrogenase
Gene Name : G6PD
UniProt ID : P11413
Defining Change(s) :

  • 871G->A

Allele Name : Viangchan, Jammu
Genotype(s) : Not Available
Type(s) : ADR Inferred
Groups : G6PD deficiency
Description : Increased risk of hemolytic anemia.
References :

  1. Eichelbaum M, Evert B: Influence of pharmacogenetics on drug disposition and response. Clin Exp Pharmacol Physiol. 1996 Oct-Nov;23(10-11):983-5. [PubMed:8911746 ]
  2. Diabinese® (chlorpropamide)[package insert]. New York City, New York: Pfizer Labs, Division of Pfizer Inc; 2010. [Link]

PMID: 9831914

Chlorpropamide

By

Chlorpropamide

Product: KS176

Identifier : DBSNPE001022
Drug : DB00672 (Chlorpropamide)
Interacting Gene/Enzyme : Glucose-6-phosphate 1-dehydrogenase
Gene Name : G6PD
UniProt ID : P11413
Defining Change(s) :

  • 871G->A

Allele Name : Viangchan, Jammu
Genotype(s) : Not Available
Type(s) : ADR Inferred
Groups : G6PD deficiency
Description : Increased risk of hemolytic anemia.
References :

  1. Eichelbaum M, Evert B: Influence of pharmacogenetics on drug disposition and response. Clin Exp Pharmacol Physiol. 1996 Oct-Nov;23(10-11):983-5. [PubMed:8911746 ]
  2. Diabinese® (chlorpropamide)[package insert]. New York City, New York: Pfizer Labs, Division of Pfizer Inc; 2010. [Link]

PMID: 9831914

Chlorpropamide

By

Chlorpropamide

Product: VU0357017 (hydrochloride)

Identifier : DBSNPE001023
Drug : DB00672 (Chlorpropamide)
Interacting Gene/Enzyme : Glucose-6-phosphate 1-dehydrogenase
Gene Name : G6PD
UniProt ID : P11413
Defining Change(s) :

  • 916G->A

Allele Name : Seoul
Genotype(s) : Not Available
Type(s) : ADR Inferred
Groups : G6PD deficiency
Description : Increased risk of hemolytic anemia.
References :

  1. Eichelbaum M, Evert B: Influence of pharmacogenetics on drug disposition and response. Clin Exp Pharmacol Physiol. 1996 Oct-Nov;23(10-11):983-5. [PubMed:8911746 ]
  2. Diabinese® (chlorpropamide)[package insert]. New York City, New York: Pfizer Labs, Division of Pfizer Inc; 2010. [Link]

PMID: 6460764

Chlorpropamide

By

Chlorpropamide

Product: VU0357017 (hydrochloride)

Identifier : DBSNPE001023
Drug : DB00672 (Chlorpropamide)
Interacting Gene/Enzyme : Glucose-6-phosphate 1-dehydrogenase
Gene Name : G6PD
UniProt ID : P11413
Defining Change(s) :

  • 916G->A

Allele Name : Seoul
Genotype(s) : Not Available
Type(s) : ADR Inferred
Groups : G6PD deficiency
Description : Increased risk of hemolytic anemia.
References :

  1. Eichelbaum M, Evert B: Influence of pharmacogenetics on drug disposition and response. Clin Exp Pharmacol Physiol. 1996 Oct-Nov;23(10-11):983-5. [PubMed:8911746 ]
  2. Diabinese® (chlorpropamide)[package insert]. New York City, New York: Pfizer Labs, Division of Pfizer Inc; 2010. [Link]

PMID: 6460764

Chlorpropamide

By

Chlorpropamide

Product: Acetylene-linker-Val-Cit-PABC-MMAE

Identifier : DBSNPE001024
Drug : DB00672 (Chlorpropamide)
Interacting Gene/Enzyme : Glucose-6-phosphate 1-dehydrogenase
Gene Name : G6PD
UniProt ID : P11413
Defining Change(s) :

  • 929G->A

Allele Name : Ludhiana
Genotype(s) : Not Available
Type(s) : ADR Inferred
Groups : G6PD deficiency
Description : Increased risk of hemolytic anemia.
References :

  1. Eichelbaum M, Evert B: Influence of pharmacogenetics on drug disposition and response. Clin Exp Pharmacol Physiol. 1996 Oct-Nov;23(10-11):983-5. [PubMed:8911746 ]
  2. Diabinese® (chlorpropamide)[package insert]. New York City, New York: Pfizer Labs, Division of Pfizer Inc; 2010. [Link]

PMID: 26877061

Chlorpropamide

By

Chlorpropamide

Product: Acetylene-linker-Val-Cit-PABC-MMAE

Identifier : DBSNPE001024
Drug : DB00672 (Chlorpropamide)
Interacting Gene/Enzyme : Glucose-6-phosphate 1-dehydrogenase
Gene Name : G6PD
UniProt ID : P11413
Defining Change(s) :

  • 929G->A

Allele Name : Ludhiana
Genotype(s) : Not Available
Type(s) : ADR Inferred
Groups : G6PD deficiency
Description : Increased risk of hemolytic anemia.
References :

  1. Eichelbaum M, Evert B: Influence of pharmacogenetics on drug disposition and response. Clin Exp Pharmacol Physiol. 1996 Oct-Nov;23(10-11):983-5. [PubMed:8911746 ]
  2. Diabinese® (chlorpropamide)[package insert]. New York City, New York: Pfizer Labs, Division of Pfizer Inc; 2010. [Link]

PMID: 26877061

Chlorpropamide

By

Chlorpropamide

Product: NSC305787 (hydrochloride)

Identifier : DBSNPE001025
Drug : DB00672 (Chlorpropamide)
Interacting Gene/Enzyme : Glucose-6-phosphate 1-dehydrogenase
Gene Name : G6PD
UniProt ID : P11413
Defining Change(s) :

  • 977C->A

Allele Name : Farroupilha
Genotype(s) : Not Available
Type(s) : ADR Inferred
Groups : G6PD deficiency
Description : Increased risk of hemolytic anemia.
References :

  1. Eichelbaum M, Evert B: Influence of pharmacogenetics on drug disposition and response. Clin Exp Pharmacol Physiol. 1996 Oct-Nov;23(10-11):983-5. [PubMed:8911746 ]
  2. Diabinese® (chlorpropamide)[package insert]. New York City, New York: Pfizer Labs, Division of Pfizer Inc; 2010. [Link]

PMID: 20884646

Chlorpropamide

By

Chlorpropamide

Product: NSC305787 (hydrochloride)

Identifier : DBSNPE001025
Drug : DB00672 (Chlorpropamide)
Interacting Gene/Enzyme : Glucose-6-phosphate 1-dehydrogenase
Gene Name : G6PD
UniProt ID : P11413
Defining Change(s) :

  • 977C->A

Allele Name : Farroupilha
Genotype(s) : Not Available
Type(s) : ADR Inferred
Groups : G6PD deficiency
Description : Increased risk of hemolytic anemia.
References :

  1. Eichelbaum M, Evert B: Influence of pharmacogenetics on drug disposition and response. Clin Exp Pharmacol Physiol. 1996 Oct-Nov;23(10-11):983-5. [PubMed:8911746 ]
  2. Diabinese® (chlorpropamide)[package insert]. New York City, New York: Pfizer Labs, Division of Pfizer Inc; 2010. [Link]

PMID: 20884646

Chlorpropamide

By

Chlorpropamide

Product: Apigenin

Identifier : DBSNPE001027
Drug : DB00672 (Chlorpropamide)
Interacting Gene/Enzyme : Glucose-6-phosphate 1-dehydrogenase
Gene Name : G6PD
UniProt ID : P11413
Defining Change(s) :

  • 130G>A

Allele Name : Rignano
Genotype(s) : Not Available
Type(s) : ADR Inferred
Groups : G6PD deficiency
Description : Increased risk of hemolytic anemia.
References :

  1. Eichelbaum M, Evert B: Influence of pharmacogenetics on drug disposition and response. Clin Exp Pharmacol Physiol. 1996 Oct-Nov;23(10-11):983-5. [PubMed:8911746 ]
  2. Diabinese® (chlorpropamide)[package insert]. New York City, New York: Pfizer Labs, Division of Pfizer Inc; 2010. [Link]

PMID: 26877022

Chlorpropamide

By

Chlorpropamide

Product: Apigenin

Identifier : DBSNPE001027
Drug : DB00672 (Chlorpropamide)
Interacting Gene/Enzyme : Glucose-6-phosphate 1-dehydrogenase
Gene Name : G6PD
UniProt ID : P11413
Defining Change(s) :

  • 130G>A

Allele Name : Rignano
Genotype(s) : Not Available
Type(s) : ADR Inferred
Groups : G6PD deficiency
Description : Increased risk of hemolytic anemia.
References :

  1. Eichelbaum M, Evert B: Influence of pharmacogenetics on drug disposition and response. Clin Exp Pharmacol Physiol. 1996 Oct-Nov;23(10-11):983-5. [PubMed:8911746 ]
  2. Diabinese® (chlorpropamide)[package insert]. New York City, New York: Pfizer Labs, Division of Pfizer Inc; 2010. [Link]

PMID: 26877022

Chlorpropamide

By

Chlorpropamide

Product: Cucurbitacin I

Identifier : DBSNPE001028
Drug : DB00672 (Chlorpropamide)
Interacting Gene/Enzyme : Glucose-6-phosphate 1-dehydrogenase
Gene Name : G6PD
UniProt ID : P11413
Defining Change(s) :

  • 131C->G

Allele Name : Orissa
Genotype(s) : Not Available
Type(s) : ADR Inferred
Groups : G6PD deficiency
Description : Increased risk of hemolytic anemia.
References :

  1. Eichelbaum M, Evert B: Influence of pharmacogenetics on drug disposition and response. Clin Exp Pharmacol Physiol. 1996 Oct-Nov;23(10-11):983-5. [PubMed:8911746 ]
  2. Diabinese® (chlorpropamide)[package insert]. New York City, New York: Pfizer Labs, Division of Pfizer Inc; 2010. [Link]

PMID: 26000751

Chlorpropamide

By

Chlorpropamide

Product: Cucurbitacin I

Identifier : DBSNPE001028
Drug : DB00672 (Chlorpropamide)
Interacting Gene/Enzyme : Glucose-6-phosphate 1-dehydrogenase
Gene Name : G6PD
UniProt ID : P11413
Defining Change(s) :

  • 131C->G

Allele Name : Orissa
Genotype(s) : Not Available
Type(s) : ADR Inferred
Groups : G6PD deficiency
Description : Increased risk of hemolytic anemia.
References :

  1. Eichelbaum M, Evert B: Influence of pharmacogenetics on drug disposition and response. Clin Exp Pharmacol Physiol. 1996 Oct-Nov;23(10-11):983-5. [PubMed:8911746 ]
  2. Diabinese® (chlorpropamide)[package insert]. New York City, New York: Pfizer Labs, Division of Pfizer Inc; 2010. [Link]

PMID: 26000751

Chlorpropamide

By

Chlorpropamide

Product: mDPR-Val-Cit-PAB-MMAE

Identifier : DBSNPE001029
Drug : DB00672 (Chlorpropamide)
Interacting Gene/Enzyme : Glucose-6-phosphate 1-dehydrogenase
Gene Name : G6PD
UniProt ID : P11413
Defining Change(s) :

  • 1380G>C

Allele Name : G6PDNice
Genotype(s) : Not Available
Type(s) : ADR Inferred
Groups : G6PD deficiency
Description : Increased risk of hemolytic anemia.
References :

  1. Eichelbaum M, Evert B: Influence of pharmacogenetics on drug disposition and response. Clin Exp Pharmacol Physiol. 1996 Oct-Nov;23(10-11):983-5. [PubMed:8911746 ]
  2. Diabinese® (chlorpropamide)[package insert]. New York City, New York: Pfizer Labs, Division of Pfizer Inc; 2010. [Link]

PMID: 24393009

Chlorpropamide

By

Chlorpropamide

Product: mDPR-Val-Cit-PAB-MMAE

Identifier : DBSNPE001029
Drug : DB00672 (Chlorpropamide)
Interacting Gene/Enzyme : Glucose-6-phosphate 1-dehydrogenase
Gene Name : G6PD
UniProt ID : P11413
Defining Change(s) :

  • 1380G>C

Allele Name : G6PDNice
Genotype(s) : Not Available
Type(s) : ADR Inferred
Groups : G6PD deficiency
Description : Increased risk of hemolytic anemia.
References :

  1. Eichelbaum M, Evert B: Influence of pharmacogenetics on drug disposition and response. Clin Exp Pharmacol Physiol. 1996 Oct-Nov;23(10-11):983-5. [PubMed:8911746 ]
  2. Diabinese® (chlorpropamide)[package insert]. New York City, New York: Pfizer Labs, Division of Pfizer Inc; 2010. [Link]

PMID: 24393009

Chlorpropamide

By

Chlorpropamide

Product: Fmoc-Val-Cit-PAB-MMAE

Identifier : DBSNPE001030
Drug : DB00672 (Chlorpropamide)
Interacting Gene/Enzyme : Glucose-6-phosphate 1-dehydrogenase
Gene Name : G6PD
UniProt ID : P11413
Defining Change(s) :

  • 1387C->T

Allele Name : Kamiube, Keelung
Genotype(s) : Not Available
Type(s) : ADR Inferred
Groups : G6PD deficiency
Description : Increased risk of hemolytic anemia.
References :

  1. Eichelbaum M, Evert B: Influence of pharmacogenetics on drug disposition and response. Clin Exp Pharmacol Physiol. 1996 Oct-Nov;23(10-11):983-5. [PubMed:8911746 ]
  2. Diabinese® (chlorpropamide)[package insert]. New York City, New York: Pfizer Labs, Division of Pfizer Inc; 2010. [Link]

PMID: 24356773

Chlorpropamide

By

Chlorpropamide

Product: Fmoc-Val-Cit-PAB-MMAE

Identifier : DBSNPE001030
Drug : DB00672 (Chlorpropamide)
Interacting Gene/Enzyme : Glucose-6-phosphate 1-dehydrogenase
Gene Name : G6PD
UniProt ID : P11413
Defining Change(s) :

  • 1387C->T

Allele Name : Kamiube, Keelung
Genotype(s) : Not Available
Type(s) : ADR Inferred
Groups : G6PD deficiency
Description : Increased risk of hemolytic anemia.
References :

  1. Eichelbaum M, Evert B: Influence of pharmacogenetics on drug disposition and response. Clin Exp Pharmacol Physiol. 1996 Oct-Nov;23(10-11):983-5. [PubMed:8911746 ]
  2. Diabinese® (chlorpropamide)[package insert]. New York City, New York: Pfizer Labs, Division of Pfizer Inc; 2010. [Link]

PMID: 24356773

Chlorpropamide

By

Chlorpropamide

Product: MCC950 (sodium)

Identifier : DBSNPE001031
Drug : DB00672 (Chlorpropamide)
Interacting Gene/Enzyme : Glucose-6-phosphate 1-dehydrogenase
Gene Name : G6PD
UniProt ID : P11413
Defining Change(s) :

  • 1400C->G

Allele Name : Neapolis
Genotype(s) : Not Available
Type(s) : ADR Inferred
Groups : G6PD deficiency
Description : Increased risk of hemolytic anemia.
References :

  1. Eichelbaum M, Evert B: Influence of pharmacogenetics on drug disposition and response. Clin Exp Pharmacol Physiol. 1996 Oct-Nov;23(10-11):983-5. [PubMed:8911746 ]
  2. Diabinese® (chlorpropamide)[package insert]. New York City, New York: Pfizer Labs, Division of Pfizer Inc; 2010. [Link]

PMID: 21798953

Chlorpropamide

By

Chlorpropamide

Product: MCC950 (sodium)

Identifier : DBSNPE001031
Drug : DB00672 (Chlorpropamide)
Interacting Gene/Enzyme : Glucose-6-phosphate 1-dehydrogenase
Gene Name : G6PD
UniProt ID : P11413
Defining Change(s) :

  • 1400C->G

Allele Name : Neapolis
Genotype(s) : Not Available
Type(s) : ADR Inferred
Groups : G6PD deficiency
Description : Increased risk of hemolytic anemia.
References :

  1. Eichelbaum M, Evert B: Influence of pharmacogenetics on drug disposition and response. Clin Exp Pharmacol Physiol. 1996 Oct-Nov;23(10-11):983-5. [PubMed:8911746 ]
  2. Diabinese® (chlorpropamide)[package insert]. New York City, New York: Pfizer Labs, Division of Pfizer Inc; 2010. [Link]

PMID: 21798953

Chlorpropamide

By

Chlorpropamide

Product: Tyr-Gly-Gly-Phe-Met-OH

Identifier : DBSNPE001032
Drug : DB00672 (Chlorpropamide)
Interacting Gene/Enzyme : Glucose-6-phosphate 1-dehydrogenase
Gene Name : G6PD
UniProt ID : P11413
Defining Change(s) :

  • 143T->C

Allele Name : Aures
Genotype(s) : Not Available
Type(s) : ADR Inferred
Groups : G6PD deficiency
Description : Increased risk of hemolytic anemia.
References :

  1. Eichelbaum M, Evert B: Influence of pharmacogenetics on drug disposition and response. Clin Exp Pharmacol Physiol. 1996 Oct-Nov;23(10-11):983-5. [PubMed:8911746 ]
  2. Diabinese® (chlorpropamide)[package insert]. New York City, New York: Pfizer Labs, Division of Pfizer Inc; 2010. [Link]

PMID: 26900925

Chlorpropamide

By

Chlorpropamide

Product: Tyr-Gly-Gly-Phe-Met-OH

Identifier : DBSNPE001032
Drug : DB00672 (Chlorpropamide)
Interacting Gene/Enzyme : Glucose-6-phosphate 1-dehydrogenase
Gene Name : G6PD
UniProt ID : P11413
Defining Change(s) :

  • 143T->C

Allele Name : Aures
Genotype(s) : Not Available
Type(s) : ADR Inferred
Groups : G6PD deficiency
Description : Increased risk of hemolytic anemia.
References :

  1. Eichelbaum M, Evert B: Influence of pharmacogenetics on drug disposition and response. Clin Exp Pharmacol Physiol. 1996 Oct-Nov;23(10-11):983-5. [PubMed:8911746 ]
  2. Diabinese® (chlorpropamide)[package insert]. New York City, New York: Pfizer Labs, Division of Pfizer Inc; 2010. [Link]

PMID: 26900925

Chlorpropamide

By

Chlorpropamide

Product: Glyoxalase I inhibitor (free base)

Identifier : DBSNPE001033
Drug : DB00672 (Chlorpropamide)
Interacting Gene/Enzyme : Glucose-6-phosphate 1-dehydrogenase
Gene Name : G6PD
UniProt ID : P11413
Defining Change(s) :

  • 1442C->G

Allele Name : Split
Genotype(s) : Not Available
Type(s) : ADR Inferred
Groups : G6PD deficiency
Description : Increased risk of hemolytic anemia.
References :

  1. Eichelbaum M, Evert B: Influence of pharmacogenetics on drug disposition and response. Clin Exp Pharmacol Physiol. 1996 Oct-Nov;23(10-11):983-5. [PubMed:8911746 ]
  2. Diabinese® (chlorpropamide)[package insert]. New York City, New York: Pfizer Labs, Division of Pfizer Inc; 2010. [Link]

PMID: 23859623

Chlorpropamide

By

Chlorpropamide

Product: Glyoxalase I inhibitor (free base)

Identifier : DBSNPE001033
Drug : DB00672 (Chlorpropamide)
Interacting Gene/Enzyme : Glucose-6-phosphate 1-dehydrogenase
Gene Name : G6PD
UniProt ID : P11413
Defining Change(s) :

  • 1442C->G

Allele Name : Split
Genotype(s) : Not Available
Type(s) : ADR Inferred
Groups : G6PD deficiency
Description : Increased risk of hemolytic anemia.
References :

  1. Eichelbaum M, Evert B: Influence of pharmacogenetics on drug disposition and response. Clin Exp Pharmacol Physiol. 1996 Oct-Nov;23(10-11):983-5. [PubMed:8911746 ]
  2. Diabinese® (chlorpropamide)[package insert]. New York City, New York: Pfizer Labs, Division of Pfizer Inc; 2010. [Link]

PMID: 23859623

Chlorpropamide

By

Chlorpropamide

Product: N-Acetyl-Calicheamicin

Identifier : DBSNPE001034
Drug : DB00672 (Chlorpropamide)
Interacting Gene/Enzyme : Glucose-6-phosphate 1-dehydrogenase
Gene Name : G6PD
UniProt ID : P11413
Defining Change(s) :

  • 148C->T

Allele Name : Kambos
Genotype(s) : Not Available
Type(s) : ADR Inferred
Groups : G6PD deficiency
Description : Increased risk of hemolytic anemia.
References :

  1. Eichelbaum M, Evert B: Influence of pharmacogenetics on drug disposition and response. Clin Exp Pharmacol Physiol. 1996 Oct-Nov;23(10-11):983-5. [PubMed:8911746 ]
  2. Diabinese® (chlorpropamide)[package insert]. New York City, New York: Pfizer Labs, Division of Pfizer Inc; 2010. [Link]

PMID: 19423778

Chlorpropamide

By

Chlorpropamide

Product: N-Acetyl-Calicheamicin

Identifier : DBSNPE001034
Drug : DB00672 (Chlorpropamide)
Interacting Gene/Enzyme : Glucose-6-phosphate 1-dehydrogenase
Gene Name : G6PD
UniProt ID : P11413
Defining Change(s) :

  • 148C->T

Allele Name : Kambos
Genotype(s) : Not Available
Type(s) : ADR Inferred
Groups : G6PD deficiency
Description : Increased risk of hemolytic anemia.
References :

  1. Eichelbaum M, Evert B: Influence of pharmacogenetics on drug disposition and response. Clin Exp Pharmacol Physiol. 1996 Oct-Nov;23(10-11):983-5. [PubMed:8911746 ]
  2. Diabinese® (chlorpropamide)[package insert]. New York City, New York: Pfizer Labs, Division of Pfizer Inc; 2010. [Link]

PMID: 19423778

Chlorpropamide

By

Chlorpropamide

Product: Olmutinib

Identifier : DBSNPE001035
Drug : DB00672 (Chlorpropamide)
Interacting Gene/Enzyme : Glucose-6-phosphate 1-dehydrogenase
Gene Name : G6PD
UniProt ID : P11413
Defining Change(s) :

  • 170G>A

Allele Name : Palesdivina
Genotype(s) : Not Available
Type(s) : ADR Inferred
Groups : G6PD deficiency
Description : Increased risk of hemolytic anemia.
References :

  1. Eichelbaum M, Evert B: Influence of pharmacogenetics on drug disposition and response. Clin Exp Pharmacol Physiol. 1996 Oct-Nov;23(10-11):983-5. [PubMed:8911746 ]
  2. Diabinese® (chlorpropamide)[package insert]. New York City, New York: Pfizer Labs, Division of Pfizer Inc; 2010. [Link]

PMID: 19721412

Chlorpropamide

By

Chlorpropamide

Product: Olmutinib

Identifier : DBSNPE001035
Drug : DB00672 (Chlorpropamide)
Interacting Gene/Enzyme : Glucose-6-phosphate 1-dehydrogenase
Gene Name : G6PD
UniProt ID : P11413
Defining Change(s) :

  • 170G>A

Allele Name : Palesdivina
Genotype(s) : Not Available
Type(s) : ADR Inferred
Groups : G6PD deficiency
Description : Increased risk of hemolytic anemia.
References :

  1. Eichelbaum M, Evert B: Influence of pharmacogenetics on drug disposition and response. Clin Exp Pharmacol Physiol. 1996 Oct-Nov;23(10-11):983-5. [PubMed:8911746 ]
  2. Diabinese® (chlorpropamide)[package insert]. New York City, New York: Pfizer Labs, Division of Pfizer Inc; 2010. [Link]

PMID: 19721412

Chlorpropamide

By

Chlorpropamide

Product: GPRP (acetate)

Identifier : DBSNPE001036
Drug : DB00672 (Chlorpropamide)
Interacting Gene/Enzyme : Glucose-6-phosphate 1-dehydrogenase
Gene Name : G6PD
UniProt ID : P11413
Defining Change(s) :

  • 172G->A

Allele Name : Metaponto
Genotype(s) : Not Available
Type(s) : ADR Inferred
Groups : G6PD deficiency
Description : Increased risk of hemolytic anemia.
References :

  1. Eichelbaum M, Evert B: Influence of pharmacogenetics on drug disposition and response. Clin Exp Pharmacol Physiol. 1996 Oct-Nov;23(10-11):983-5. [PubMed:8911746 ]
  2. Diabinese® (chlorpropamide)[package insert]. New York City, New York: Pfizer Labs, Division of Pfizer Inc; 2010. [Link]

PMID: 12496245

Chlorpropamide

By

Chlorpropamide

Product: GPRP (acetate)

Identifier : DBSNPE001036
Drug : DB00672 (Chlorpropamide)
Interacting Gene/Enzyme : Glucose-6-phosphate 1-dehydrogenase
Gene Name : G6PD
UniProt ID : P11413
Defining Change(s) :

  • 172G->A

Allele Name : Metaponto
Genotype(s) : Not Available
Type(s) : ADR Inferred
Groups : G6PD deficiency
Description : Increased risk of hemolytic anemia.
References :

  1. Eichelbaum M, Evert B: Influence of pharmacogenetics on drug disposition and response. Clin Exp Pharmacol Physiol. 1996 Oct-Nov;23(10-11):983-5. [PubMed:8911746 ]
  2. Diabinese® (chlorpropamide)[package insert]. New York City, New York: Pfizer Labs, Division of Pfizer Inc; 2010. [Link]

PMID: 12496245

Chlorpropamide

By

Chlorpropamide

Product: Eupatilin

Identifier : DBSNPE001037
Drug : DB00672 (Chlorpropamide)
Interacting Gene/Enzyme : Glucose-6-phosphate 1-dehydrogenase
Gene Name : G6PD
UniProt ID : P11413
Defining Change(s) :

  • 185C->T

Allele Name : Musashino
Genotype(s) : Not Available
Type(s) : ADR Inferred
Groups : G6PD deficiency
Description : Increased risk of hemolytic anemia.
References :

  1. Eichelbaum M, Evert B: Influence of pharmacogenetics on drug disposition and response. Clin Exp Pharmacol Physiol. 1996 Oct-Nov;23(10-11):983-5. [PubMed:8911746 ]
  2. Diabinese® (chlorpropamide)[package insert]. New York City, New York: Pfizer Labs, Division of Pfizer Inc; 2010. [Link]

PMID: 10818101

Chlorpropamide

By

Chlorpropamide

Product: Eupatilin

Identifier : DBSNPE001037
Drug : DB00672 (Chlorpropamide)
Interacting Gene/Enzyme : Glucose-6-phosphate 1-dehydrogenase
Gene Name : G6PD
UniProt ID : P11413
Defining Change(s) :

  • 185C->T

Allele Name : Musashino
Genotype(s) : Not Available
Type(s) : ADR Inferred
Groups : G6PD deficiency
Description : Increased risk of hemolytic anemia.
References :

  1. Eichelbaum M, Evert B: Influence of pharmacogenetics on drug disposition and response. Clin Exp Pharmacol Physiol. 1996 Oct-Nov;23(10-11):983-5. [PubMed:8911746 ]
  2. Diabinese® (chlorpropamide)[package insert]. New York City, New York: Pfizer Labs, Division of Pfizer Inc; 2010. [Link]

PMID: 10818101

Chlorpropamide

By

Chlorpropamide

Product: Quercitrin

Identifier : DBSNPE001038
Drug : DB00672 (Chlorpropamide)
Interacting Gene/Enzyme : Glucose-6-phosphate 1-dehydrogenase
Gene Name : G6PD
UniProt ID : P11413
Defining Change(s) :

  • 202G->A

Allele Name : Asahi
Genotype(s) : Not Available
Type(s) : ADR Inferred
Groups : G6PD deficiency
Description : Increased risk of hemolytic anemia.
References :

  1. Eichelbaum M, Evert B: Influence of pharmacogenetics on drug disposition and response. Clin Exp Pharmacol Physiol. 1996 Oct-Nov;23(10-11):983-5. [PubMed:8911746 ]
  2. Diabinese® (chlorpropamide)[package insert]. New York City, New York: Pfizer Labs, Division of Pfizer Inc; 2010. [Link]

PMID: 24594970

Chlorpropamide

By

Chlorpropamide

Product: Quercitrin

Identifier : DBSNPE001038
Drug : DB00672 (Chlorpropamide)
Interacting Gene/Enzyme : Glucose-6-phosphate 1-dehydrogenase
Gene Name : G6PD
UniProt ID : P11413
Defining Change(s) :

  • 202G->A

Allele Name : Asahi
Genotype(s) : Not Available
Type(s) : ADR Inferred
Groups : G6PD deficiency
Description : Increased risk of hemolytic anemia.
References :

  1. Eichelbaum M, Evert B: Influence of pharmacogenetics on drug disposition and response. Clin Exp Pharmacol Physiol. 1996 Oct-Nov;23(10-11):983-5. [PubMed:8911746 ]
  2. Diabinese® (chlorpropamide)[package insert]. New York City, New York: Pfizer Labs, Division of Pfizer Inc; 2010. [Link]

PMID: 24594970

Chlorpropamide

By

Chlorpropamide

Product: LED209

Identifier : DBSNPE001039
Drug : DB00672 (Chlorpropamide)
Interacting Gene/Enzyme : Glucose-6-phosphate 1-dehydrogenase
Gene Name : G6PD
UniProt ID : P11413
Defining Change(s) :

  • 202G->A
  • 376A->G

Allele Name : A- (202), Ferrara I
Genotype(s) : Not Available
Type(s) : ADR Inferred
Groups : G6PD deficiency
Description : Increased risk of hemolytic anemia.
References :

  1. Eichelbaum M, Evert B: Influence of pharmacogenetics on drug disposition and response. Clin Exp Pharmacol Physiol. 1996 Oct-Nov;23(10-11):983-5. [PubMed:8911746 ]
  2. Diabinese® (chlorpropamide)[package insert]. New York City, New York: Pfizer Labs, Division of Pfizer Inc; 2010. [Link]

PMID: 25484239

Chlorpropamide

By

Chlorpropamide

Product: LED209

Identifier : DBSNPE001039
Drug : DB00672 (Chlorpropamide)
Interacting Gene/Enzyme : Glucose-6-phosphate 1-dehydrogenase
Gene Name : G6PD
UniProt ID : P11413
Defining Change(s) :

  • 202G->A
  • 376A->G

Allele Name : A- (202), Ferrara I
Genotype(s) : Not Available
Type(s) : ADR Inferred
Groups : G6PD deficiency
Description : Increased risk of hemolytic anemia.
References :

  1. Eichelbaum M, Evert B: Influence of pharmacogenetics on drug disposition and response. Clin Exp Pharmacol Physiol. 1996 Oct-Nov;23(10-11):983-5. [PubMed:8911746 ]
  2. Diabinese® (chlorpropamide)[package insert]. New York City, New York: Pfizer Labs, Division of Pfizer Inc; 2010. [Link]

PMID: 25484239

Chlorpropamide

By

Chlorpropamide

Product: DprE1-IN-1

Identifier : DBSNPE001041
Drug : DB00672 (Chlorpropamide)
Interacting Gene/Enzyme : Glucose-6-phosphate 1-dehydrogenase
Gene Name : G6PD
UniProt ID : P11413
Defining Change(s) :

  • 241C->T

Allele Name : Ube Konan
Genotype(s) : Not Available
Type(s) : ADR Inferred
Groups : G6PD deficiency
Description : Increased risk of hemolytic anemia.
References :

  1. Eichelbaum M, Evert B: Influence of pharmacogenetics on drug disposition and response. Clin Exp Pharmacol Physiol. 1996 Oct-Nov;23(10-11):983-5. [PubMed:8911746 ]
  2. Diabinese® (chlorpropamide)[package insert]. New York City, New York: Pfizer Labs, Division of Pfizer Inc; 2010. [Link]

PMID: 23630098

Chlorpropamide

By

Chlorpropamide

Product: DprE1-IN-1

Identifier : DBSNPE001041
Drug : DB00672 (Chlorpropamide)
Interacting Gene/Enzyme : Glucose-6-phosphate 1-dehydrogenase
Gene Name : G6PD
UniProt ID : P11413
Defining Change(s) :

  • 241C->T

Allele Name : Ube Konan
Genotype(s) : Not Available
Type(s) : ADR Inferred
Groups : G6PD deficiency
Description : Increased risk of hemolytic anemia.
References :

  1. Eichelbaum M, Evert B: Influence of pharmacogenetics on drug disposition and response. Clin Exp Pharmacol Physiol. 1996 Oct-Nov;23(10-11):983-5. [PubMed:8911746 ]
  2. Diabinese® (chlorpropamide)[package insert]. New York City, New York: Pfizer Labs, Division of Pfizer Inc; 2010. [Link]

PMID: 23630098

Chlorpropamide

By

Chlorpropamide

Product: A-1155463

Identifier : DBSNPE001042
Drug : DB00672 (Chlorpropamide)
Interacting Gene/Enzyme : Glucose-6-phosphate 1-dehydrogenase
Gene Name : G6PD
UniProt ID : P11413
Defining Change(s) :

  • 242G->A

Allele Name : Lagosanto
Genotype(s) : Not Available
Type(s) : ADR Inferred
Groups : G6PD deficiency
Description : Increased risk of hemolytic anemia.
References :

  1. Eichelbaum M, Evert B: Influence of pharmacogenetics on drug disposition and response. Clin Exp Pharmacol Physiol. 1996 Oct-Nov;23(10-11):983-5. [PubMed:8911746 ]
  2. Diabinese® (chlorpropamide)[package insert]. New York City, New York: Pfizer Labs, Division of Pfizer Inc; 2010. [Link]

PMID: 22080048

Chlorpropamide

By

Chlorpropamide

Product: A-1155463

Identifier : DBSNPE001042
Drug : DB00672 (Chlorpropamide)
Interacting Gene/Enzyme : Glucose-6-phosphate 1-dehydrogenase
Gene Name : G6PD
UniProt ID : P11413
Defining Change(s) :

  • 242G->A

Allele Name : Lagosanto
Genotype(s) : Not Available
Type(s) : ADR Inferred
Groups : G6PD deficiency
Description : Increased risk of hemolytic anemia.
References :

  1. Eichelbaum M, Evert B: Influence of pharmacogenetics on drug disposition and response. Clin Exp Pharmacol Physiol. 1996 Oct-Nov;23(10-11):983-5. [PubMed:8911746 ]
  2. Diabinese® (chlorpropamide)[package insert]. New York City, New York: Pfizer Labs, Division of Pfizer Inc; 2010. [Link]

PMID: 22080048

Chlorpropamide

By

Chlorpropamide

Product: Microcystin-LR

Identifier : DBSNPE001043
Drug : DB00672 (Chlorpropamide)
Interacting Gene/Enzyme : Glucose-6-phosphate 1-dehydrogenase
Gene Name : G6PD
UniProt ID : P11413
Defining Change(s) :

  • 274C->T

Allele Name : Guangzhou
Genotype(s) : Not Available
Type(s) : ADR Inferred
Groups : G6PD deficiency
Description : Increased risk of hemolytic anemia.
References :

  1. Eichelbaum M, Evert B: Influence of pharmacogenetics on drug disposition and response. Clin Exp Pharmacol Physiol. 1996 Oct-Nov;23(10-11):983-5. [PubMed:8911746 ]
  2. Diabinese® (chlorpropamide)[package insert]. New York City, New York: Pfizer Labs, Division of Pfizer Inc; 2010. [Link]

PMID: 19539751

Chlorpropamide

By

Chlorpropamide

Product: Microcystin-LR

Identifier : DBSNPE001043
Drug : DB00672 (Chlorpropamide)
Interacting Gene/Enzyme : Glucose-6-phosphate 1-dehydrogenase
Gene Name : G6PD
UniProt ID : P11413
Defining Change(s) :

  • 274C->T

Allele Name : Guangzhou
Genotype(s) : Not Available
Type(s) : ADR Inferred
Groups : G6PD deficiency
Description : Increased risk of hemolytic anemia.
References :

  1. Eichelbaum M, Evert B: Influence of pharmacogenetics on drug disposition and response. Clin Exp Pharmacol Physiol. 1996 Oct-Nov;23(10-11):983-5. [PubMed:8911746 ]
  2. Diabinese® (chlorpropamide)[package insert]. New York City, New York: Pfizer Labs, Division of Pfizer Inc; 2010. [Link]

PMID: 19539751

Chlorpropamide

By

Chlorpropamide

Product: Anlotinib

Identifier : DBSNPE001044
Drug : DB00672 (Chlorpropamide)
Interacting Gene/Enzyme : Glucose-6-phosphate 1-dehydrogenase
Gene Name : G6PD
UniProt ID : P11413
Defining Change(s) :

  • 323T->A

Allele Name : Hammersmith
Genotype(s) : Not Available
Type(s) : ADR Inferred
Groups : G6PD deficiency
Description : Increased risk of hemolytic anemia.
References :

  1. Eichelbaum M, Evert B: Influence of pharmacogenetics on drug disposition and response. Clin Exp Pharmacol Physiol. 1996 Oct-Nov;23(10-11):983-5. [PubMed:8911746 ]
  2. Diabinese® (chlorpropamide)[package insert]. New York City, New York: Pfizer Labs, Division of Pfizer Inc; 2010. [Link]

PMID: 24084856

Chlorpropamide

By

Chlorpropamide

Product: Anlotinib

Identifier : DBSNPE001044
Drug : DB00672 (Chlorpropamide)
Interacting Gene/Enzyme : Glucose-6-phosphate 1-dehydrogenase
Gene Name : G6PD
UniProt ID : P11413
Defining Change(s) :

  • 323T->A

Allele Name : Hammersmith
Genotype(s) : Not Available
Type(s) : ADR Inferred
Groups : G6PD deficiency
Description : Increased risk of hemolytic anemia.
References :

  1. Eichelbaum M, Evert B: Influence of pharmacogenetics on drug disposition and response. Clin Exp Pharmacol Physiol. 1996 Oct-Nov;23(10-11):983-5. [PubMed:8911746 ]
  2. Diabinese® (chlorpropamide)[package insert]. New York City, New York: Pfizer Labs, Division of Pfizer Inc; 2010. [Link]

PMID: 24084856

Chlorpropamide

By

Chlorpropamide

Product: GSK2256294A

Identifier : DBSNPE001045
Drug : DB00672 (Chlorpropamide)
Interacting Gene/Enzyme : Glucose-6-phosphate 1-dehydrogenase
Gene Name : G6PD
UniProt ID : P11413
Defining Change(s) :

  • 34G->T

Allele Name : Sinnai
Genotype(s) : Not Available
Type(s) : ADR Inferred
Groups : G6PD deficiency
Description : Increased risk of hemolytic anemia.
References :

  1. Eichelbaum M, Evert B: Influence of pharmacogenetics on drug disposition and response. Clin Exp Pharmacol Physiol. 1996 Oct-Nov;23(10-11):983-5. [PubMed:8911746 ]
  2. Diabinese® (chlorpropamide)[package insert]. New York City, New York: Pfizer Labs, Division of Pfizer Inc; 2010. [Link]

PMID: 19165849

Chlorpropamide

By

Chlorpropamide

Product: GSK2256294A

Identifier : DBSNPE001045
Drug : DB00672 (Chlorpropamide)
Interacting Gene/Enzyme : Glucose-6-phosphate 1-dehydrogenase
Gene Name : G6PD
UniProt ID : P11413
Defining Change(s) :

  • 34G->T

Allele Name : Sinnai
Genotype(s) : Not Available
Type(s) : ADR Inferred
Groups : G6PD deficiency
Description : Increased risk of hemolytic anemia.
References :

  1. Eichelbaum M, Evert B: Influence of pharmacogenetics on drug disposition and response. Clin Exp Pharmacol Physiol. 1996 Oct-Nov;23(10-11):983-5. [PubMed:8911746 ]
  2. Diabinese® (chlorpropamide)[package insert]. New York City, New York: Pfizer Labs, Division of Pfizer Inc; 2010. [Link]

PMID: 19165849

Chlorpropamide

By

Chlorpropamide

Product: JNJ-42165279

Identifier : DBSNPE001046
Drug : DB00672 (Chlorpropamide)
Interacting Gene/Enzyme : Glucose-6-phosphate 1-dehydrogenase
Gene Name : G6PD
UniProt ID : P11413
Defining Change(s) :

  • 376A->G
  • 680G->T

Allele Name : A- (680)
Genotype(s) : Not Available
Type(s) : ADR Inferred
Groups : G6PD deficiency
Description : Increased risk of hemolytic anemia.
References :

  1. Eichelbaum M, Evert B: Influence of pharmacogenetics on drug disposition and response. Clin Exp Pharmacol Physiol. 1996 Oct-Nov;23(10-11):983-5. [PubMed:8911746 ]
  2. Diabinese® (chlorpropamide)[package insert]. New York City, New York: Pfizer Labs, Division of Pfizer Inc; 2010. [Link]

PMID: 18605728

Chlorpropamide

By

Chlorpropamide

Product: JNJ-42165279

Identifier : DBSNPE001046
Drug : DB00672 (Chlorpropamide)
Interacting Gene/Enzyme : Glucose-6-phosphate 1-dehydrogenase
Gene Name : G6PD
UniProt ID : P11413
Defining Change(s) :

  • 376A->G
  • 680G->T

Allele Name : A- (680)
Genotype(s) : Not Available
Type(s) : ADR Inferred
Groups : G6PD deficiency
Description : Increased risk of hemolytic anemia.
References :

  1. Eichelbaum M, Evert B: Influence of pharmacogenetics on drug disposition and response. Clin Exp Pharmacol Physiol. 1996 Oct-Nov;23(10-11):983-5. [PubMed:8911746 ]
  2. Diabinese® (chlorpropamide)[package insert]. New York City, New York: Pfizer Labs, Division of Pfizer Inc; 2010. [Link]

PMID: 18605728

Chlorpropamide

By

Chlorpropamide

Product: Tocofersolan

Identifier : DBSNPE001047
Drug : DB00672 (Chlorpropamide)
Interacting Gene/Enzyme : Glucose-6-phosphate 1-dehydrogenase
Gene Name : G6PD
UniProt ID : P11413
Defining Change(s) :

  • 376A->G
  • 968T->C

Allele Name : A- (968), Betica,Selma, Guantanamo
Genotype(s) : Not Available
Type(s) : ADR Inferred
Groups : G6PD deficiency
Description : Increased risk of hemolytic anemia.
References :

  1. Eichelbaum M, Evert B: Influence of pharmacogenetics on drug disposition and response. Clin Exp Pharmacol Physiol. 1996 Oct-Nov;23(10-11):983-5. [PubMed:8911746 ]
  2. Diabinese® (chlorpropamide)[package insert]. New York City, New York: Pfizer Labs, Division of Pfizer Inc; 2010. [Link]

PMID: 25176316

Chlorpropamide

By

Chlorpropamide

Product: PS-1145

Identifier : DBSNPE001048
Drug : DB00672 (Chlorpropamide)
Interacting Gene/Enzyme : Glucose-6-phosphate 1-dehydrogenase
Gene Name : G6PD
UniProt ID : P11413
Defining Change(s) :

  • 383T>G

Allele Name : Salerno Pyrgos
Genotype(s) : Not Available
Type(s) : ADR Inferred
Groups : G6PD deficiency
Description : Increased risk of hemolytic anemia.
References :

  1. Eichelbaum M, Evert B: Influence of pharmacogenetics on drug disposition and response. Clin Exp Pharmacol Physiol. 1996 Oct-Nov;23(10-11):983-5. [PubMed:8911746 ]
  2. Diabinese® (chlorpropamide)[package insert]. New York City, New York: Pfizer Labs, Division of Pfizer Inc; 2010. [Link]

PMID: 24626197

Chlorpropamide

By

Chlorpropamide

Product: GSK0660

Identifier : DBSNPE001049
Drug : DB00672 (Chlorpropamide)
Interacting Gene/Enzyme : Glucose-6-phosphate 1-dehydrogenase
Gene Name : G6PD
UniProt ID : P11413
Defining Change(s) :

  • 392G->T

Allele Name : Quing Yan
Genotype(s) : Not Available
Type(s) : ADR Inferred
Groups : G6PD deficiency
Description : Increased risk of hemolytic anemia.
References :

  1. Eichelbaum M, Evert B: Influence of pharmacogenetics on drug disposition and response. Clin Exp Pharmacol Physiol. 1996 Oct-Nov;23(10-11):983-5. [PubMed:8911746 ]
  2. Diabinese® (chlorpropamide)[package insert]. New York City, New York: Pfizer Labs, Division of Pfizer Inc; 2010. [Link]

PMID: 17406637

Chlorpropamide

By

Chlorpropamide

Product: PD 151746

Identifier : DBSNPE001050
Drug : DB00672 (Chlorpropamide)
Interacting Gene/Enzyme : Glucose-6-phosphate 1-dehydrogenase
Gene Name : G6PD
UniProt ID : P11413
Defining Change(s) :

  • 40G->A

Allele Name : Lages
Genotype(s) : Not Available
Type(s) : ADR Inferred
Groups : G6PD deficiency
Description : Increased risk of hemolytic anemia.
References :

  1. Eichelbaum M, Evert B: Influence of pharmacogenetics on drug disposition and response. Clin Exp Pharmacol Physiol. 1996 Oct-Nov;23(10-11):983-5. [PubMed:8911746 ]
  2. Diabinese® (chlorpropamide)[package insert]. New York City, New York: Pfizer Labs, Division of Pfizer Inc; 2010. [Link]

PMID: 28257176

Chlorpropamide

By

Chlorpropamide

Product: Oltipraz

Identifier : DBSNPE001051
Drug : DB00672 (Chlorpropamide)
Interacting Gene/Enzyme : Glucose-6-phosphate 1-dehydrogenase
Gene Name : G6PD
UniProt ID : P11413
Defining Change(s) :

  • 466G->A

Allele Name : Ilesha
Genotype(s) : Not Available
Type(s) : ADR Inferred
Groups : G6PD deficiency
Description : Increased risk of hemolytic anemia.
References :

  1. Eichelbaum M, Evert B: Influence of pharmacogenetics on drug disposition and response. Clin Exp Pharmacol Physiol. 1996 Oct-Nov;23(10-11):983-5. [PubMed:8911746 ]
  2. Diabinese® (chlorpropamide)[package insert]. New York City, New York: Pfizer Labs, Division of Pfizer Inc; 2010. [Link]

PMID: 23527575

Chlorpropamide

By

Chlorpropamide

Product: Calyculin A

Identifier : DBSNPE001052
Drug : DB00672 (Chlorpropamide)
Interacting Gene/Enzyme : Glucose-6-phosphate 1-dehydrogenase
Gene Name : G6PD
UniProt ID : P11413
Defining Change(s) :

  • 487G->A

Allele Name : Mahidol
Genotype(s) : Not Available
Type(s) : ADR Inferred
Groups : G6PD deficiency
Description : Increased risk of hemolytic anemia.
References :

  1. Eichelbaum M, Evert B: Influence of pharmacogenetics on drug disposition and response. Clin Exp Pharmacol Physiol. 1996 Oct-Nov;23(10-11):983-5. [PubMed:8911746 ]
  2. Diabinese® (chlorpropamide)[package insert]. New York City, New York: Pfizer Labs, Division of Pfizer Inc; 2010. [Link]

PMID: 21769097

Chlorpropamide

By

Chlorpropamide

Product: CB-5083

Identifier : DBSNPE001053
Drug : DB00672 (Chlorpropamide)
Interacting Gene/Enzyme : Glucose-6-phosphate 1-dehydrogenase
Gene Name : G6PD
UniProt ID : P11413
Defining Change(s) :

  • 542A->T

Allele Name : Malaga
Genotype(s) : Not Available
Type(s) : ADR Inferred
Groups : G6PD deficiency
Description : Increased risk of hemolytic anemia.
References :

  1. Eichelbaum M, Evert B: Influence of pharmacogenetics on drug disposition and response. Clin Exp Pharmacol Physiol. 1996 Oct-Nov;23(10-11):983-5. [PubMed:8911746 ]
  2. Diabinese® (chlorpropamide)[package insert]. New York City, New York: Pfizer Labs, Division of Pfizer Inc; 2010. [Link]

PMID: 20361787

Chlorpropamide

By

Chlorpropamide

Product: MCB-613

Identifier : DBSNPE001054
Drug : DB00672 (Chlorpropamide)
Interacting Gene/Enzyme : Glucose-6-phosphate 1-dehydrogenase
Gene Name : G6PD
UniProt ID : P11413
Defining Change(s) :

  • 634A->G

Allele Name : Sibari
Genotype(s) : Not Available
Type(s) : ADR Inferred
Groups : G6PD deficiency
Description : Increased risk of hemolytic anemia.
References :

  1. Eichelbaum M, Evert B: Influence of pharmacogenetics on drug disposition and response. Clin Exp Pharmacol Physiol. 1996 Oct-Nov;23(10-11):983-5. [PubMed:8911746 ]
  2. Diabinese® (chlorpropamide)[package insert]. New York City, New York: Pfizer Labs, Division of Pfizer Inc; 2010. [Link]

PMID: 23589874

Chlorpropamide

By

Chlorpropamide

Product: Peficitinib

Identifier : DBSNPE001055
Drug : DB00672 (Chlorpropamide)
Interacting Gene/Enzyme : Glucose-6-phosphate 1-dehydrogenase
Gene Name : G6PD
UniProt ID : P11413
Defining Change(s) :

  • 680G->A

Allele Name : Mexico City
Genotype(s) : Not Available
Type(s) : ADR Inferred
Groups : G6PD deficiency
Description : Increased risk of hemolytic anemia.
References :

  1. Eichelbaum M, Evert B: Influence of pharmacogenetics on drug disposition and response. Clin Exp Pharmacol Physiol. 1996 Oct-Nov;23(10-11):983-5. [PubMed:8911746 ]
  2. Diabinese® (chlorpropamide)[package insert]. New York City, New York: Pfizer Labs, Division of Pfizer Inc; 2010. [Link]

PMID: 21671682

Chlorpropamide

By

Chlorpropamide

Product: BAY 41-2272

Identifier : DBSNPE001056
Drug : DB00672 (Chlorpropamide)
Interacting Gene/Enzyme : Glucose-6-phosphate 1-dehydrogenase
Gene Name : G6PD
UniProt ID : P11413
Defining Change(s) :

  • 703C->T

Allele Name : Nanning
Genotype(s) : Not Available
Type(s) : ADR Inferred
Groups : G6PD deficiency
Description : Increased risk of hemolytic anemia.
References :

  1. Eichelbaum M, Evert B: Influence of pharmacogenetics on drug disposition and response. Clin Exp Pharmacol Physiol. 1996 Oct-Nov;23(10-11):983-5. [PubMed:8911746 ]
  2. Diabinese® (chlorpropamide)[package insert]. New York City, New York: Pfizer Labs, Division of Pfizer Inc; 2010. [Link]

PMID: 22767087

Chlorpropamide

By

Chlorpropamide

Product: (R,S)-Ivosidenib

Identifier : DBSNPE001057
Drug : DB00672 (Chlorpropamide)
Interacting Gene/Enzyme : Glucose-6-phosphate 1-dehydrogenase
Gene Name : G6PD
UniProt ID : P11413
Defining Change(s) :

  • 844G->C

Allele Name : Seattle, Lodi, Modena, Ferrara II, Athens-like
Genotype(s) : Not Available
Type(s) : ADR Inferred
Groups : G6PD deficiency
Description : Increased risk of hemolytic anemia.
References :

  1. Eichelbaum M, Evert B: Influence of pharmacogenetics on drug disposition and response. Clin Exp Pharmacol Physiol. 1996 Oct-Nov;23(10-11):983-5. [PubMed:8911746 ]
  2. Diabinese® (chlorpropamide)[package insert]. New York City, New York: Pfizer Labs, Division of Pfizer Inc; 2010. [Link]

PMID: 21106824

Chlorpropamide

By

Chlorpropamide

Product: Velneperit

Identifier : DBSNPE001058
Drug : DB00672 (Chlorpropamide)
Interacting Gene/Enzyme : Glucose-6-phosphate 1-dehydrogenase
Gene Name : G6PD
UniProt ID : P11413
Defining Change(s) :

  • 844G->T

Allele Name : Bajo Maumere
Genotype(s) : Not Available
Type(s) : ADR Inferred
Groups : G6PD deficiency
Description : Increased risk of hemolytic anemia.
References :

  1. Eichelbaum M, Evert B: Influence of pharmacogenetics on drug disposition and response. Clin Exp Pharmacol Physiol. 1996 Oct-Nov;23(10-11):983-5. [PubMed:8911746 ]
  2. Diabinese® (chlorpropamide)[package insert]. New York City, New York: Pfizer Labs, Division of Pfizer Inc; 2010. [Link]

PMID: 10849201

Chlorpropamide

By

Chlorpropamide

Product: Vesnarinone

Identifier : DBSNPE001059
Drug : DB00672 (Chlorpropamide)
Interacting Gene/Enzyme : Glucose-6-phosphate 1-dehydrogenase
Gene Name : G6PD
UniProt ID : P11413
Defining Change(s) :

  • 854G->A

Allele Name : Montalbano
Genotype(s) : Not Available
Type(s) : ADR Inferred
Groups : G6PD deficiency
Description : Increased risk of hemolytic anemia.
References :

  1. Eichelbaum M, Evert B: Influence of pharmacogenetics on drug disposition and response. Clin Exp Pharmacol Physiol. 1996 Oct-Nov;23(10-11):983-5. [PubMed:8911746 ]
  2. Diabinese® (chlorpropamide)[package insert]. New York City, New York: Pfizer Labs, Division of Pfizer Inc; 2010. [Link]

PMID: 22245750

Chlorpropamide

By

Chlorpropamide

Product: SW044248

Identifier : DBSNPE001060
Drug : DB00672 (Chlorpropamide)
Interacting Gene/Enzyme : Glucose-6-phosphate 1-dehydrogenase
Gene Name : G6PD
UniProt ID : P11413
Defining Change(s) :

  • 949G->A

Allele Name : Kalyan-Kerala, Jamnaga, Rohini
Genotype(s) : Not Available
Type(s) : ADR Inferred
Groups : G6PD deficiency
Description : Increased risk of hemolytic anemia.
References :

  1. Eichelbaum M, Evert B: Influence of pharmacogenetics on drug disposition and response. Clin Exp Pharmacol Physiol. 1996 Oct-Nov;23(10-11):983-5. [PubMed:8911746 ]
  2. Diabinese® (chlorpropamide)[package insert]. New York City, New York: Pfizer Labs, Division of Pfizer Inc; 2010. [Link]

PMID: 20682645

Chlorpropamide

By

Chlorpropamide

Product: (-)-p-Bromotetramisole (oxalate)

Identifier : DBSNPE001061
Drug : DB00672 (Chlorpropamide)
Interacting Gene/Enzyme : Glucose-6-phosphate 1-dehydrogenase
Gene Name : G6PD
UniProt ID : P11413
Defining Change(s) :

  • 95A->G

Allele Name : Gaohe
Genotype(s) : Not Available
Type(s) : ADR Inferred
Groups : G6PD deficiency
Description : Increased risk of hemolytic anemia.
References :

  1. Eichelbaum M, Evert B: Influence of pharmacogenetics on drug disposition and response. Clin Exp Pharmacol Physiol. 1996 Oct-Nov;23(10-11):983-5. [PubMed:8911746 ]
  2. Diabinese® (chlorpropamide)[package insert]. New York City, New York: Pfizer Labs, Division of Pfizer Inc; 2010. [Link]

PMID: 10960471

By

Related Post

You Missed

Uncategorized

VEGFA (Human) Recombinant Protein

Uncategorized

Scgb1a1 (Rat) Recombinant Protein

Uncategorized

MSTN (Human) Recombinant Protein

Uncategorized

FLT3LG (Human) Recombinant Protein (P01)